Back to EveryPatent.com
United States Patent | 6,231,868 |
Vakharia ,   et al. | May 15, 2001 |
A system for the generation of live, nonpathogenic Birnavirus such as infectious bursal disease virus (IBDV), a segmented double-stranded (ds)RNA virus of the Birnavirdae family, using synthetic transcripts derived from cloned DNA has been developed. Independent full-length cDNA clones were constructed which contained the coding and non-coding regions of RNA segments A and B of IBDV, respectively. Segment A was modified to prevent the expression of NS protein. Synthetic RNAs of both segments were produced by in vitro transcription of linearized plasmids with T7 RNA polymerase. Transfection of Vero cells with combined plus-sense transcripts of both segments generated infectious virus as early as 36 hours post-transfection. The development of a system for producing NS protein deficient IBDV will greatly facilitate studies of immunosuppression, and aid in the development of live attenuated vaccines for IBDV.
Inventors: | Vakharia; Vikram N. (Bowie, MD); Yao; Kun (College Park, MD) |
Assignee: | University of Maryland-Biotechnology Institute (College Park, MD) |
Appl. No.: | 940968 |
Filed: | September 30, 1997 |
Current U.S. Class: | 424/204.1; 424/199.1; 424/816; 435/235.1; 435/236; 435/320.1; 435/471; 536/23.72 |
Intern'l Class: | A61K 039/12; C12N 007/01; C12N 007/04; C12N 015/40 |
Field of Search: | 435/236,235.1,472,471,320.1 424/204.1,199.1,816 536/23.72 |
4530831 | Jul., 1985 | Lutticken et al. | |
5192539 | Mar., 1993 | Van Der Marel et al. | |
5310678 | May., 1994 | Bingham et al. | |
Foreign Patent Documents | |||
0352835 A1 | Jan., 1990 | EP. | |
WO86/07060 | Dec., 1986 | WO. | |
WO91/05569 | May., 1991 | WO. | |
WO91/16925 | Nov., 1991 | WO. | |
WO93/03145 | Feb., 1993 | WO. | |
WO94/06904 | Mar., 1994 | WO. | |
WO95/26196 | Mar., 1995 | WO. |
Heppell et al, Journal of General Virology 76: 2091-2096, 1995.* Mundt et al, Journal of Virology 71:5647-5651, 1997.* Egbert Mundt & Hermann Muller, Virology, Complete Nucleotide Sequences of 5'-and 3'-Noncoding Regions of Both Genome Segments of Different Strains of Infectious Bursal Disease Virus, (1995), pp 10-18, vol. 209. U. Spies & H. Muller, Journal of General Virology, Demonstration of enzyme activities required for cap structure formation in infectious bursal disease virus, a member of the birnavirus group, (1990), pp 977-981, vol. 71. S. Zou & E.G. Brown, Virology, Identification of Sequence Elements Containing Signals for Replication and Encapsidation of the Reovirus M1 Genome Segment, (1992), pp 377-388, vol. 186. Mario I. Gorziglia & Peter L. Collins, Proc. Natl. Acad. Sci. USA, Intracellular amplification and expression of a synthetic analog of rotavirus genomic RNA bearing a foreign marker gene: Mapping cis-acting nucleotides in the 3'-noncoding region, Jul. 1992, pp 5784-5788, vol. 89. Jean-Christophe Boyer & Anne-Lise Haenni, Virology, Infectious Transcripts and cDNA Clones of RNA Viruses, (1994), pp 415-426, vol. 198. Sylvie Van Der Were, Jonathan Bradley, Eckard Wimmer, F. William Studier, & John J. Dunn, Proc. Natl, Acad. Sci. USA, Synthesis of infectious poliovirus RNA by purified T7 RNA polymerase, Apr. 1986, pp 2330-2334, vol. 83. Wilem Luytjes, Mark Krystal, Masasyoshl Enami, Jeffrey D. Parvin, & Peter Palese, Cell, Amplification, Expression and Packing of a Foreign Gene : by Influenza Virus, Dec. 22, 1989, pp 1107-1113, vol. 59. Matthias J. Schnell, Teshome Mebatsion & Karl-Klaus Conzelmann, The EMBO Journal, Infectious rabies viruses from cloned cDNA, (1994), pp 4195-4203. vol. 13. Michael R. Roner, Lisa A. Sutphin, & Wolfgang K. Joklik, Virology, Reovirus RNA Is Infectious, (1990), pp 845-852, vol. 179. Vikram N. Vakharia, Junkun He, Basheer Ahamed, David B. Snyder, Virus Research, Molecular basis of antigenic variation in infectious bursal disease virus, (1994), pp 265-273, vol. 31. H. Muller, H. Lange & H. Becht, Virus Research, Formation, characterization and interfering capacity of a small plaque mutant and of incomplete virus particles of infectious bursal disease virus, (1986), pp 297-309, vol. 4. Baoshan Chen, Gil H. Choi, & Donald L. Nuss, Science, Attenuation of Fungal Virulence by Synthetic Infectious Hypovirus Transcripts, Jun. 17, 1994, pp 1762-1764, vol. 264. Peter Dobos, Virology, Protein-Primed RNA Synthesis In Vitro by the Virion-Associated RNA Polymerase Of Infectious Pancreatic Necrosis Virus, (1995), pp 19-25, vol. 208. John T. Patton, Virus Research, Synthesis of Simian Rotavirus SA11 Double-Stranded RNA in A Cell-Free System, (1986/87), pp 217-233, vol. 6. D.B. Snyder, V.N. Vakharia, S.A. Mengel-Whereat, G.H. Edwards, P.K. Savage, D. Lutticken, and M.A. Goodwin, Active Cross-Protection Induced by a Recombinant Baculovirus Expressing Chimeric Infectious Bursal Disease Virus Structural Proteins, Avian Diseases, (1994), vol. 38, No. 4 pp. 701-707. V.N. Vakharia, Development of Recombinant Vaccines Against Infectious Bursal Disease, (1997), vol. 3. Biotechnology Annual Review, pp. 151-168. E. Mundt and V.N. Vakharia, Synthetic Transcripts of Double-Stranded Birnavirus Genome are Infectious, Proc. Natl. Acad. Sci. USA (Oct., 1996), vol. 93 pp. 11131-11136. Bayliss et al., A Comparison of the Sequences of Segment A of Four Infectious Bursal Disease Virus Strains and Identification of a Variable Region VP2. Journal of General Virology. vol. 71, pp. 1303-1312. Mundt et al., Identification of a Novel Viral Protein in Infectious Bursal Disease Virus Infected Cells. Journal of General Virology. vol. 76, pp. 437-443. Mundt et al., Complete Nucleotide Sequences of 5' and 3' Noncoding Regions of Both Genome Segments of Different Strains of Infectious Bursal Disease Virus. Virology vol. 209, pp. 10-18. Spies et al. Nucleotide Sequence of Infectious Bursal Disease Virus Genome Segment A Delineates Two Major Open Reading Frame. Nucleic Acids Research vol. 17, No. 19, p. 7982. Morgan et al., Sequence of the Small Double Stranded RNA Genomic Segment of Infectious Bursal Disease Virus and its Deduced 90kDa Product. Virology, vol. 163, pp. 240-242. Michael Schonberg, Samuel C. Silverstein, Daniel H. Levin, & George Acs, Proc. Natl. Acad. Sci., Asynchronous Synthesis of the Complementary Strands of the Reovirus Genome, Feb. 1971, pp 505-508, vol. 68, No. 2. Dayue Chen, Carl Q.-Y. Zeng, Melissa, J. Wentz, Mario Gorziglia, Mary K. Estes, & Robert F. Ramig., Journal of Virology, Template-Dependent, In Vitro Replication of Rotavirus RNA, (Nov. 1994, pp. 7030-7039, vol. 68, No. 11. Jahrestagung Gesellschaft fur Virologie 1997; Tagungsort: Universitat Hanburg 10.bis; Figs. 1-7; Mar. 13, 1997 (with English translation). Bundesforschungsanstalt fur Viruskrankheiten de Tiere; Jahresbericht 1996, p. 51, Published Apr. 16, 1997; (with English translation). |
Viral Protein Molecular Weight VP1 90 kDa VP2 41 kDa VP3 32 kDa VP4 28 kDa VP5 (NS) 17 kDa
TABLE 1 Gross and microscopic lesions in the bursa of Fabricius from chickens infected with rD78 or rD78NS.DELTA.IBDV Days post- Pathology infection Groups gross.sup.a microscopic.sup.b 2 control - - rD78 - ++ (4/8) rD78NS.DELTA. - - 4 control - - rD78 - +++ (6/8) rD78NS.DELTA. - - 6 control - - rD78 + +++ (8/8) rD78NS.DELTA. - - 9 control - - rD78 + +++ (7/8) rD78NS.DELTA. - - 21 control - - rD78 - - rD78NS.DELTA. - - .sup.a +, small bursa: -, no gross lesion. .sup.b +, multifocal purulent necrotizing bursitis with follicular depletion. -, no histological lesion. Numbers in parentheses represent number of bursa with lesions/number of bursa examined. The result is the representative of two independent experiments.
TABLE 2 Detection of virus in the bursa of chickens infected with rD78 or rD78NS.DELTA.IBDV.sup.a Isolation of virus on day: RT-PCR on day: Group(s) 2 4 6 9 21 2 4 6 9 21 control - - - - - - - - - - rD78 + + + - - + + + - - rD78NS.DELTA. + + + + - + + + + - .sup.a +, virus detected by virus isolation, or by PT-PCR: -, no virus detected.
TABLE 3 Virus and virus-neutralizing antibody titers of chickens infected with rD78 or rD78NS.DELTA. IBDV Virus titers.sup.a (PFU/ml) in bursa on day: VN titer.sup.b (log.sub.2) on day: Group(s) 2 4 6 9 21 14 21 Control 0 0 0 0 0 .ltoreq.2 .ltoreq.2 rD78 7.2 .times. 10.sup.6 2.3 .times. 10.sup.6 1.3 .times. 10.sup.2 0 0 11.3 .+-. 1.1 12.2 .+-. 0.4 rD78NS.DELTA. 3.0 .times. 10.sup.5 6.8 .times. 10.sup.5 2.2 .times. 10.sup.6 1.8 .times. 10.sup.2 0 10.8 .+-. 0.5 12.0 .+-. 0.1 .sup.a Virus titers were determined by plaque assays on CEF cells. .sup.b Virus neutralizations were performed on CEF cells, and the ability to neutralize 500 PFU of D78 wild-type virus is represented as log of the 50% endpoint titer.
TABLE 4 Oligonucleotides Used for the Construction of Full Length cDNA Clones of IBDV Genomic Segments of A and B. Nucleotide Sequence Orientation Name Nucleotide Number TAATCGACTCACTATAGGATACGATCGGTCTGACCCCGGGGGAGTCA [SEQ ID NO: 9] + A5'-D78 1-31 TGTACAGGGGACCCGCGAACGGATCCAATT [SEQ ID NO: 10] - A3'-D78 3237-3261 CGTCGACTACGGGATTGTGG [SEQ ID NO: 11] - A5-IPD78 1711-1730 AGTCGACGGGATTCTTGCTT [SEQ ID NO: 12] + A3-IPD78 1723-1742 ATGACAAACCTGCAAGAT [SEQ ID NO: 13] + RsrIIF 131-148 CTGACAGATGCTAGCTACAATGGG [SEQ ID NO: 14] + Nhe.DELTA.(+) 536-559 GTCCCGTCACACTAGTGGCCTA [SEQ ID NO: 15] + Spe.DELTA.(+) 1170-1191 CCTCTCTTAACACGCAGTCG [SEQ ID NO: 16] - SacIIR 1174-1793 AGAGAATTCTAATACGACTCACTATAGGATACGATGGGTCTGAC [SEQ ID NO: 17] + B5'-P2 1-18 CGATCTGCTGCAGGGGGCCCCCGCAGGCGAAGG [SEQ ID NO: 18] - 2807-2827 CTTGAGACTCTTGTTCTCTACTCC [SEQ ID NO: 19] - B5-IPP2 1915-1938 ATACAGCAAAGATCTCGGG [SEQ ID NO: 20] + B3-IPP2 1839-1857 Composition and location of the oligonucleotide primers used for cloning. T7 promoter sequences are marked with italic type, the virus specific sequences are underlined, and the restriction sites marked in boldface type. Orientation of the virus-specific sequence of the primer is shown for sense (+) and antisense (-). The positions where the primers bind (nucleotide number) are according to the published sequences of P2 strain.
TABLE 5 Generation of Infectious IBDV From Synthetic RNAs of Segment A and B. Material Transfected CPE Immunofluorescence ssRNA A + B, DNase-treated + + ssRNA A + B, RNase-treated - - ssRNA A + B, untreated + + ssRNA A, untreated - - ssRNA B, untreated - - Lipofectin only - -
TABLE 6 Recovery of Virus at Various Times Post-Transfection. Time in hours post-transfection CPE Immunofluorescence pfu/ml 4 - - 0 8 - - 0 16 - - 0 24 - - 0 36 + + 2.3 .times. 10.sup.2 48 + + 6.0 .times. 10.sup.1