Back to EveryPatent.com
United States Patent |
6,214,979
|
Gelfand
,   et al.
|
April 10, 2001
|
Homogeneous assay system
Abstract
A process of detecting a target nucleic acid using labeled oligonucleotides
uses the 5' to 3' nuclease activity of a nucleic acid polymerase to cleave
annealed labeled oligonucleotide from hybridized duplexes and release
labeled oligonucleotide fragments for detection. This process is easily
incorporated into a PCR amplification assay.
Inventors:
|
Gelfand; David H. (Oakland, CA);
Holland; Pamela M. (Seattle, WA);
Saiki; Randall K. (Richmond, CA);
Watson; Robert M. (Berkeley, CA)
|
Assignee:
|
Roche Molecular Systems (Alameda, CA)
|
Appl. No.:
|
934378 |
Filed:
|
September 19, 1997 |
Current U.S. Class: |
536/22.1; 435/6; 436/501; 536/23.1; 536/24.3 |
Intern'l Class: |
C07H 021/00 |
Field of Search: |
435/6,810
436/501
935/77,78
536/22.1,23.1,24.3
|
References Cited
U.S. Patent Documents
4711955 | Dec., 1987 | Ward et al. | 536/29.
|
4868103 | Sep., 1989 | Stavrionopoulos et al. | 435/5.
|
4996143 | Feb., 1991 | Heller et al. | 435/6.
|
5312728 | May., 1994 | Lizardi et al. | 435/6.
|
Foreign Patent Documents |
0070685 | Jan., 1983 | EP.
| |
0070686 | Jan., 1983 | EP.
| |
0070687 | Jan., 1983 | EP.
| |
Other References
Nobel et al., Nucleic Acids Research, vol. 12, No. 7, pp 3387-3403, 1984.*
Heller et al. [Rapid Detection and Identification of Inspections Agents,
Academic Press, Inc.], pp. 245-256, 1985.*
Matthews et al., Analytical Biochemistry, vol. 169, pp 1-25, 1988.*
Cardullo et al., Proceedings of the National Academy of Sciences (USA) vol.
85, pp. 8790-8794, 1988.*
Telser et al., J. Am. Chem. Soc., vol. 111, pp. 6966-6976, 1989.*
Morrison et al., Analytical Biochemistry, vol. 183, pp.231-244, 1989.*
Iyer et al., J. Am. Chem. Soc., vol. 112, pp. 1253-1254, 1990.*
Bollum, Journal of Biological Chemistry, vol. 237, No. 6, pp. 1945-1949,
1962.*
Ter et al., Gene, vol. 10, pp. 177-183, 1980.*
Austermann et al., Biochemical Pharmacology, vol. 43, No. 12, pp.
2581-2589, 1992.
|
Primary Examiner: Marschel; Ardin H.
Attorney, Agent or Firm: Petry; Douglas A.
Parent Case Text
This is a continuation of application Ser. No. 08/428,941 filed Apr. 25,
1995, now U.S. Pat. No. 5,804,375; which is a continuation of 07/961,884
filed Jan. 5, 1993 which issued as U.S. Pat. No. 5,487,972 on Jan. 30,
1996,, which was filed under 35 USC.sctn.371 as PCT/US91/05571, filed Apr.
6, 1991; which is a Continuation-In Part of U.S. Ser. No. 07/563,758 filed
Aug. 6, 1990 which issued as U.S. Pat. No. 5,210,015.
Claims
What is claimed is:
1. A detectably labeled oligonucleotide probe, which probe is blocked at
the 3' terminus to prohibit polymerase catalyzed extension of said probe,
wherein said blocking is achieved either by adding a chemical moiety to
the 3' hydroxyl of the terminal nucleotide, which chemical moiety does not
also serve as a label for subsequent detection, or by removing said 3'
hydroxyl; and wherein said labeled oligonucleotide probe comprises a pair
of non-radioactive interactive labels consisting of a first label and a
second label, said first label and second label attached to said
oligonucleotide directly or indirectly, and wherein said first label is
separated from said second label by a nuclease susceptible cleavage site.
2. The detectably labeled oligonucleotide probe of claim 1 where in said
first label is at the 5' terminus and said second label is at the 3'
terminus.
3. The detectably labeled oligonucleotide probe of claim 1 wherein said
first and second labels comprise a pair of interactive signal-generating
labels positioned on said labeled oligonucleotide to quench the generation
of detectable signal.
4. The detectably labeled oligonucleotide probe of claim 3 wherein said
first label is a fluorophore and said second label is a quencher which
interacts therewith.
Description
This invention relates generally to the field of nucleic acid chemistry.
More specifically, it relates to the use of the 5' to 3' nuclease activity
of a nucleic acid polymerase to degrade a labeled oligonucleotide in a
hybridized duplex composed of the labeled oligonucleotide and a target
oligonucleotide sequence and form detectable labeled fragments.
Investigational microbiological techniques are routinely applied to
diagnostic assays. For example, U.S. Pat. No. 4,358,535 discloses a method
for detecting pathogens by spotting a sample (e.g., blood, cells, saliva,
etc.) on a filter (e.g., nitrocellulose), lysing the cells, and fixing the
DNA through chemical denaturation and heating. Then, labeled DNA probes
are added and allowed to hybridize with the fixed sample DNA,
hybridization indicating the presence of the pathogen's DNA. The sample
DNA in this case may be amplified by culturing the cells or organisms in
place on the filter.
A significant improvement in DNA amplification, the polymerase chain
reaction (PCR) technique, is disclosed in U.S. Pat. Nos. 4,683,202;
4,683,195; 4,800,159; and 4,965,188. In its simplest form, PCR is an in
vitro method for the enzymatic synthesis of specific DNA sequences, using
two oligonucleotide primers that hybridize to opposite strands and flank
the region of interest in the target DNA. A repetitive series of reaction
steps involving template denaturation, primer annealing, and the extension
of the annealed primers by DNA polymerase results in the exponential
accumulation of a specific fragment whose termini are defined by the 5'
ends of the primers. PCR is capable of producing a selective enrichment of
a specific DNA sequence by a factor of 10.sup.9. The PCR method is also
described in Saiki et al., 1985, Science 230:1350.
Detection methods generally employed in standard PCR techniques use a
labeled probe with the amplified DNA in a hybridization assay. For
example, EP Publication No. 237,362 and PCT Publication No. 89/11548
disclose assay methods wherein the PCR-amplified DNA is first fixed to a
filter, and then a specific oligonucleotide probe is added and allowed to
hybridize. Preferably, the probe is labeled, e.g., with .sup.32 P, biotin,
horseradish peroxidase (HRP), etc., to allow for detection of
hybridization. The reverse is also suggested, that is, the probe is
instead bound to the membrane, and the PCR-amplified sample DNA is added.
Other means of detection include the use of fragment length polymorphism
(PCR-FLP), hybridization to allele-specific oligonucleotide (ASO) probes
(Saika et al, 1986, Nature 324:163), or direct sequencing via the dideoxy
method using amplified DNA rather than cloned DNA. The standard PCR
technique operates essentially by replicating a DNA sequence positioned
between two primers, providing as the major product of the reaction a DNA
sequence of discrete length terminating with the primer at the 5' end of
each strand. Thus, insertions and deletions between the primers result in
product sequences of different lengths, which can be detected by sizing
the product in PCR-FLP. In an example of ASO hybridization, the amplified
DNA is fixed to a nylon filter (by, for example, UV irradiation) in a
series of "dot blots", then allowed to hybridize with an oligonucleotide
probe labeled with HRP under stringent conditions. After washing,
tetramethylbenzidine (TMB) and hydrogen peroxide are added: HRP catalyzes
the hydrogen peroxide oxidation of TMB to a soluble blue dye that can be
precipitated, indicating hybridized probe.
While the PCR technique as presently practiced is an extremely powerful
method for amplifying nucleic acid sequences, the detection of the
amplified material requires additional manipulation and subsequent
handling of the PCR products to determine whether the target DNA is
present. It would be desirable to decrease the number of subsequent
handling steps currently required for the detection of amplified material.
A "homogeneous" assay system, that is, one which generates signal while
the target sequence is amplified, requiring minimal post-amplification
handling, would be ideal.
The present invention provides a process for the detection of a target
nucleic acid sequence in a sample, said process comprising:
(a) contacting a sample comprising single-stranded nucleic acids with an
oligonucleotide containing a sequence complementary to a region of the
target nucleic acid and a labeled oligonucleotide containing a sequence
complementary to a second region of the same target nucleic acid strand,
but not including the nucleic acid sequence defined by the first
oligonucleotide, to create a mixture of duplexes during hybridization
conditions, wherein the duplexes comprise the target nucleic acid annealed
to the first oligonucleotide and to the labeled oligonucleotide such that
the 3' end of the first oligonucleotide is adjacent to the 5' end of the
labeled oligonucleotide;
(b) maintaining the mixture of step (a) with a template-dependent nucleic
acid polymerase having a 5' to 3' nuclease activity under conditions
sufficient to permit the 5' to 3' nuclease activity of the polymerase to
cleave the annealed, labeled oligonucleotide and release labeled
fragments; and
(c) detecting and/or measuring the release of labeled fragments.
This process is especially suited for analysis of nucleic acid amplified by
PCR. This process is an improvement over known PCR detection methods
because it allows for both amplification of a target and the release of a
label for detection to be accomplished in a reaction system without resort
to multiple handling steps of the amplified product Thus, in another
embodiment of the invention, a polymerase chain reaction amplification
method for concurrent amplification and detection of a target nucleic acid
sequence in a sample is provided. This method comprises:
(a) providing to a PCR assay containing said sample, at least one labeled
oligonucleotide containing a sequence complementary to a region of the
target nucleic acid, wherein said labeled oligonucleotide anneals within
the target nucleic acid sequence bounded by the oligonucleotide primers of
step (b);
(b) providing a set of oligonucleotide primers, wherein a first primer
contains a sequence complementary to a region in one strand of the target
nucleic acid sequence and primes the synthesis of a complementary DNA
strand, and a second primer contains a sequence complementary to a region
in a-second strand of the target nucleic acid sequence and primes the
synthesis of a complementary DNA strand; and wherein each oligonucleotide
primer is selected to anneal to its complementary template upstream of any
labeled oligonucleotide annealed to the same nucleic acid strand;
(c) amplifying the target nucleic acid sequence employing a nucleic acid
polymerase having 5' to 3' nuclease activity as a template-dependent
polymerizing agent under conditions which are permissive for PCR cycling
steps of (i) annealing of primers and labeled oligonucleotide to a
template nucleic acid sequence contained within the target region, and
(ii) extending the primer, wherein said nucleic acid polymerase
synthesizes a primer extension product while the 5' to 3' nuclease
activity of the nucleic acid polymerase simultaneously releases labeled
fragments from the annealed duplexes comprising labeled oligonucleotide
and its complementary template nucleic acid sequences, thereby creating
detectable labeled fragments; and
(d) detecting and/or measuring the release of labeled fragments to
determine the presence or absence of target sequence in the sample.
BRIEF DESCRIPTION OF THE DRAWINGS
FIG. 1 is an autoradiograph of a DEAE cellulose thin layer chromatography
(TLC) plate illustrating the release of labeled fragments from cleaved
probe.
FIG. 2 is an autoradiograph of DEAE cellulose TLC plates illustrating the
thermostability of the labeled probe.
FIGS. 3A and 3B are autoradiographs of DEAE cellulose TLC plates showing
that the amount of labeled probe fragment released correlates with an
increase in PCR cycle number and starting template DNA concentration.
FIG. 4 illustrates the polymerization independent 5'-3' nuclease activity
of Taq DNA polymerase shown in the autoradiograph using a series of
primers which anneal from zero to 20 nucleotides upstream of the probe.
FIG. 5 is an autoradiograph showing the release of labeled probe fragments
under increasing incubation temperatures and time, wherein the composition
at the 5' end of the probe is GC rich.
FIG. 6 is an autoradiograph showing the release of labeled probe fragments
under increasing incubation temperatures and time, wherein the composition
at the 5' end of the probe is AT rich.
FIG. 7 provides 5% acrylamide electrophoresis gel analysis of a 142 base
pair HIV product, amplified in the presence or absence of labeled probe.
FIG. 8 is a composite of two autoradiographs of TLC analysis of aliquots of
PCR amplification products which show that radiolabel release occurs and
increases in amount with both increases in starting template and with
longer thermocycling.
FIG. 9 is a schematic for a reaction in which an NHS-active ester
derivative of biotin is added to the 3'-amine of an oligonucleotide probe.
FIG. 10 is a schematic for a reaction in which a biotin hydrazide is used
to label an oligonucleotide probe that has a 3'-ribonucleotide.
FIG. 11 is a schematic for labeling an oligonucleotide probe with biotin
using a biotin phosphoramidite.
FIG. 12 shows a reagents for labeling oligonucleotide probes with biotin.
FIG. 13 shows an oligonucleotide probe labeled with rhodamine-X-590 and
crystal violet.
FIG. 14 shows a schematic for a reaction to generate an active acyl azide
of crystal violet.
FIG. 15 shows a schematic for a reaction to add an amine to a thymidine for
use in conjugating a label to an oligonucleotide probe.
FIG. 16 shows typical results and relation of signal to input target number
for the present method using Bakerbond.TM. PEI solid phase extractant.
As used herein, a "sample" refers to any substance containing or presumed
to contain nucleic acid and includes a sample of tissue or fluid isolated
from an individual or individuals, including but not limited to, for
example, skin, plasma, serum, spinal fluid, lymph fluid, synovial fluid,
urine, tears, blood cells, organs, tumors, and also to samples of in vitro
cell culture constituents (including but not limited to conditioned medium
resulting from the growth of cells in cell culture medium, recombinant
cells and cell components).
As used herein, the terms "nucleic acid", "polynucleotide" and
"oligonucleotide" refer to primers, probes, oligomer fragments to be
detected, oligomer controls and unlabeled blocking oligomers and shall be
generic to polydeoxyribonucleotides (containing 2-deoxy-D-ribose), to
polyribonucleotides (containing D-ribose), and to any other type of
polynucleotide which is an N-glycoside of a purine or pyrimidine base, or
modified purine or pyrimidine bases. There is no intended distinction in
length between the term "nucleic acid", "polynucleotide" and
"oligonucleotide", and these terms will be used interchangeably. These
terms refer only to the primary structure of the molecule. Thus, these
terms include double- and single-stranded DNA, as well as double- and
single-stranded RNA. The oligonucleotide is comprised of a sequence of
approximately at least 6 nucleotides, preferably at least about 10-12
nucleotides, and more preferably at least about 15-20 nucleotides
corresponding to a region of the designated nucleotide sequence.
"Corresponding" means identical to or complementary to the designated
sequence.
The oligonucleotide is not necessarily physically derived from any existing
or natural sequence but may be generated in any manner, including chemical
synthesis, DNA replication, reverse transcription or a combination
thereof. The terms "oligonucleotide" or "nucleic acid" intend a
polynucleotide of genomic DNA or RNA, cDNA, semisynthetic, or synthetic
origin which, by virtue of its origin or manipulation: (1) is not
associated with all or a portion of the polynucleotide with which it is
associated in nature; and/or (2) is linked to a polynucleotide other than
that to which it is linked in nature; and (3) is not found in nature.
Because mononucleotides are reacted to make oligonucleotides in a manner
such that the 5' phosphate of one mononucleotide pentose ring is attached
to the 3' oxygen of its neighbor in one direction via a phosphodiester
linkage, an end of an oligonucleotide is referred to as the "5' end" if
its 5' phosphate is not linked to the 3' oxygen of a mononucleotide
pentose ring and as the "3' end" if its 3' oxygen is not linked to a 5'
phosphate of a subsequent mononucleotide pentose ring. As used herein, a
nucleic acid sequence, even if internal to a larger oligonucleotide, also
may be said to have 5' and 3' ends.
When two different, non-overlapping oligonucleotides anneal to different
regions of the same linear complementary nucleic acid sequence, and the 3'
end of one oligonucleotide points toward the 5' end of the other, the
former may be called the "upstream" oligonucleotide and the latter the
"downstream" oligonucleotide.
The term "primer" may refer to more than one primer and refers to an
oligonucleotide, whether occurring naturally, as in a purified restriction
digest, or produced synthetically, which is capable of acting as a point
of initiation of synthesis along a complementary strand when placed under
conditions in which synthesis of a primer extension product which is
complementary to a nucleic acid strand is catalyzed. Such conditions
include the presence of four different deoxyribonucleoside triphosphates
and a polymerization-inducing agent such as DNA polymerase or reverse
transcriptase, in a suitable buffer ("buffer" includes substituents which
are cofactors, or which affect pH, ionic strength, etc.), and at a
suitable temperature. The primer is preferably single-stranded for maximum
efficiency in amplification.
The complement of a nucleic acid sequence as used herein refers to an
oligonucleotde which, when aligned with the nucleic acid sequence such
that the 5' end of one sequence is paired with the 3' end of the other, is
in "antiparallel association." Certain bases not commonly found in natural
nucleic acids may be included in the nucleic acids of the present
invention and include, for example, inosine and 7-deazaguanine.
Complementarity need not be perfect; stable duplexes may contain
mismatched base pairs or unmatched bases Those skilled in the art of
nucleic acid technology can determine duplex stability empirically
considering a number of variables including, for example, the length of
the oligonucleotide, base composition and sequence of the oligonucleotide,
ionic strength, and incidence of mismatched base pairs.
Stability of a nucleic acid duplex is measured by the melting temperature,
or "T.sub.m." The T.sub.m of a particular nucleic acid duplex under
specified conditions is the temperature at which half of the base pairs
have disassociated.
As used herein, the term "target sequence" or "target nucleic acid
sequence" refers to a region of the oligonucleotide which is to be either
amplified, detected or both. The target sequence resides between the two
primer sequences used for amplification.
As used herein, the term "probe" refers to a labeled oligonucleotide which
forms a duplex structure with a sequence in the target nucleic acid, due
to complementarity of at least one sequence in the probe with a sequence
in the target region. The probe, preferably, does not contain a sequence
complementary to sequence(s) used to prime the polymerase chain reaction.
Generally the 3' terminus of the probe will be "blocked" to prohibit
incorporation of the probe into a primer extension product. "Blocking" can
be achieved by using non-complementary bases or by adding a chemical
moiety such as biotin or a phosphate group to the 3' hydroxyl of the last
nucleotide, which may, depending upon the selected moiety, serve a dual
purpose by also acting as a label for subsequent detection or capture of
the nucleic acid attached to the label. Blocking can also be achieved by
removing the 3'-OH or by using a nucleotide that lacks a 3'-OH such as a
dideoxynucleotide.
The term "label" as used herein refers to any atom or molecule which can be
used to provide a detectable (preferably quantifiable) signal, and which
can be attached to a nucleic acid or protein. Labels may provide signals
detectable by fluorescence, radioactivity, colorimetry, gravimetry, X-ray
diffraction or absorption, magnetism, enzymatic activity, and the like.
As defined herein, "5'.fwdarw.3' nuclease activity" or "5' to 3' nuclease
activity" refers to that activity of a template-specific nucleic acid
polymerase including either a 5'.fwdarw.3' exonuclease activity
traditionally associated with some DNA polymerases whereby nucleotides are
removed from the 5' end of an oligonucleotide in a sequential manner,
(i.e., E. coli DNA polymerase I has this activity whereas the Klenow
fragment does not), or a 5'.fwdarw.3' endonuclease activity wherein
cleavage occurs more than one phosphodiester bond (nucleotide) from the 5'
end, or both.
The term "adjacent" as used herein refers to the positioning of the primer
with respect to the probe on its complementary strand of the template
nucleic acid. The primer and probe may be separated by 1 to about 20
nucleotides, more preferably, about 1 to 10 nucleotides, or may directly
abut one another, as may be desirable for a detection with a
polymerization-independent process. Alternatively, for use in the
polymerization-dependent process, as when the present method is used in
the PCR amplification and detection methods as taught herein, the
"adjacency" may be anywhere within the sequence to be amplified, anywhere
downstream of a primer such that primer extension will position the
polymerase so that cleavage of the probe occurs.
As used herein, the term "thermostable nucleic acid polymerase" refers to
an enzyme which is relatively stable to heat when compared, for example,
to nucleotide polymerases from E. coli and which catalyzes the
polymerization of nucleoside triphosphates. Generally, the enzyme will
initiate synthesis at the 3'-end of the primer annealed to the target
sequence, and will proceed in the 5'-direction along the template, and if
possessing a 5' to 3' nuclease activity, hydrolyzing intervening, annealed
probe to release both labeled and unlabeled probe fragments, until
synthesis terminates. A representative thermostable enzyme isolated from
Thermus aquaticus (Tag) is described in U.S. Pat. No. 4,889,818 and a
method for using it in conventional PCR is described in Saiki et al, 1988,
Science 239:487.
Taq DNA polymerase has a DNA synthesis-dependent, strand replacement 5'-3'
exonuclease activity (see Gelfand, "Taq DNA Polymerase" in PCR Technology
Principles and Applications for DNA Amplification, Erlich, Ed., Stockton
Press, N.Y. (1989), Chapter 2). In solution, there is little, if any,
degradation of labeled oligonucleotides.
The practice of the present invention will employ, unless otherwise
indicated, conventional techniques of molecular biology, microbiology and
recombinant DNA techniques, which are within the skill of the art. Such
techniques are explained fully in the literature. See e.g., Sambrook,
Fritsch & Maniatis, Molecular Cloning: A Laboratory Manual, Second Edition
(1989); Oligonucleotide Synthesis (M. J. Gait, ed., 1984); Nucleic Acid
Hybridization (B. D. Hames & S. J. Higgins, eds., 1984); A Practical Guide
to Molecular Cloning (B. Perbal, 1984); and a series, Methods in
Enzymology (Academic Press, Inc.). All patents, patent applications, and
publications mentioned herein, both supra and infra, are hereby
incorporated by reference.
The various aspects of the invention are based on a special property of
nucleic acid polymerases. Nucleic acid polymerases can possess several
activities, among them, a 5' to 3' nuclease activity whereby the nucleic
acid polymerase can cleave mononucleotides or small oligonucleotides from
an oligonucleotide annealed to its larger, complementary polynucleotide.
In order for cleavage to occur efficiently, an upstream oligonucleotide
must also be annealed to the same larger polynucleotide.
The 3' end of this upstream oligonucleotide provides the initial binding
site for the nucleic acid polymerase. As soon as the bound polymerase
encounters the 5' end of the downstream oligonucleotide, the polymerase
can cleave mononucleotides or small oligonucleotides therefrom.
The two oligonucleotides can be designed such that they anneal in close
proximity on the complementary target nucleic acid such that binding of
the nucleic acid polymerase to the 3' end of the upstream oligonucleotide
automatically puts it in contact with the 5' end of the downstream
oligonucleotide. This process, because polymerization is not required to
bring the nucleic acid polymerase into position to accomplish the
cleavage, is called "polymerization-independent cleavage."
Alternatively, if the two oligonucleotides anneal to more distantly spaced
regions of the template nucleic acid target, polymerization must occur
before the nucleic acid polymerase encounters the 5' end of the downstream
oligonucleotide. As the polymerization continues, the polymerase
progressively cleaves mononucleotides or small oligonucleotides from the
5' end of the downstream oligonucleotide. This cleaving continues until
the remainder of the downstream oligonucleotide has been destabilized to
the extent that it dissociates from the template molecule. This process is
called "polymerization-dependent cleavage."
In the present invention, a label is attached to the downstream
oligonucleotide. Thus, the cleaved mononucleotides or small
oligonucleotides which are cleaved by the 5'-3' nuclease activity of the
polymerase can be detected.
Subsequently, any of several strategies may be employed to distinguish the
uncleaved labeled oligonucleotide from the cleaved fragments thereof. In
this manner, the present invention permits identification of those nucleic
acid samples which contain sequences complementary to the upstream and
downstream oligonucleotides.
The present invention exploits this 5' to 3' nuclease activity of the
polymerase when used in conjunction with PCR. This differs from previously
described PCR amplification wherein the post-PCR amplified target
oligonucleotides are detected, for example, by hybridization with a probe
which forms a stable duplex with that of the target sequence under
stringent to moderately stringent hybridization and wash conditions. In
contrast to those known detection methods used in post-PCR amplifications,
the present invention permits the detection of the target nucleic acid
sequences during amplification of this target nucleic acid. In the present
invention, a labeled oligonucleotide is added concomitantly with the
primer at the start of PCR, and the signal generated from hydrolysis of
the labeled nucleotide(s) of the probe provides a means for detection of
the target sequence during its amplification.
The present invention is compatible, however, with other amplification
systems, such as the transcription amplification system, in which one of
the PCR primers encodes a promoter that is used to make RNA copies of the
target sequence. In similar fashion, the present invention can be used in
a self-sustained sequence replication (3SR) system, in which a variety of
enzymes are used to make RNA transcripts that are then used to make DNA
copies, all at a single temperature. By incorporating a polymerase with
5'.fwdarw.3' exonuclease activity into a ligase chain reaction (LCR)
system, together with appropriate oligonucleotides, one can also employ
the present invention to detect LCR products.
Of course, the present invention can be applied to systems that do not
involve amplification. In fact, the present invention does not even
require that polymerization occur. One advantage of the
polymerization-independent process lies in the elimination of the need for
amplification of the target sequence. In the absence of primer extension,
the target nucleic acid is substantially single-stranded. Provided the
primer and labeled oligonucleotide are adjacently bound to the target
nucleic acid, sequential rounds of oligonucleotide annealing and cleavage
of labeled fragments can occur. Thus, a sufficient amount of labeled
fragments can be generated, making detection possible in the absence of
polymerization. As would be appreciated by those skilled in the art, the
signal generated during PCR amplification could be augmented by this
polymerization-independent activity.
In either process described herein, a sample is provided which is suspected
of containing the particular oligonucleotide sequence of interest, the
"target nucleic acid". The target nucleic acid contained in the sample may
be first reverse transcribed into cDNA, if necessary, and then denatured,
using any suitable denaturing method, including physical, chemical, or
enzymatic means, which are known to those of skill in the art. A preferred
physical means for strand separation involves heating the nucleic acid
until it is completely (>99%) denatured. Typical heat denaturation
involves temperatures ranging from about 80.degree. C. to about
105.degree. C., for times ranging from a few seconds to minutes. As an
alternative to denaturation, the target nucleic acid may exist in a
single-stranded form in the sample, such as, for example, single-stranded
RNA or DNA viruses.
The denatured nucleic acid strands are then incubated with preselected
oligonucleotide primers and labeled oligonucleotide (also referred to
herein as "probe") under hybridization conditions, conditions which enable
the binding of the primers and probes to the single nucleic acid strands.
As known in the art, the primers are selected so that their relative
positions along a duplex sequence are such that an extension product
synthesized from one primer, when the extension product is separated from
its template (complement), serves as a template for the extension of the
other primer to yield a replicate chain of defined length.
Because the complementary strands are longer than either the probe or
primer, the strands have more points of contact and thus a greater chance
of finding each other over any given period of time. A high molar excess
of probe, plus the primer, helps tip the balance toward primer and probe
annealing rather than template reannealing.
The primer must be sufficiently long to prime the synthesis of extension
products in the presence of the agent for polymerization. The exact length
and composition of the primer will depend on many factors, including
temperature of the annealing reaction, source and composition of the
primer, proximity of the probe annealing site to the primer annealing
site, and ratio of primer:probe concentration. For example, depending on
the complexity of the target sequence, the oligonucleotide primer
typically contains about 15-30 nucleotides, although a primer may contain
more or fewer nucleotides. The primers must be sufficiently complementary
to anneal to their respective strands selectively and form stable
duplexes.
The primers used herein are selected to be "substantially" complementary to
the different strands of each specific sequence to be amplified. The
primers need not reflect the exact sequence of the template, but must be
sufficiently complementary to hybridize selectively to their respective
strands. Non-complementary bases or longer sequences can be interspersed
into the primer or located at the ends of the primer, provided the primer
retains sufficient complementarity with a template strand to form a stable
duplex therewith. The non-complementary nucleotide sequences of the
primers may include restriction enzyme sites.
In the practice of the invention, the labeled oligonucleotide probe must be
first annealed to a complementary nucleic acid before the nucleic acid
polymerase encounters this duplex region, thereby permitting the 5' to 3'
nuclease activity to cleave and release labeled oligonucleotide fragments.
To enhance the likelihood that the labeled oligonucleotide will have
annealed to a complementary nucleic acid before primer extension
polymerization reaches this duplex region, or before the polymerase
attaches to the upstream oligonucleotide in the polymerization-independent
process, a variety of techniques may be employed. For the
polymerization-dependent process, one can position the probe so that the
5'-end of the probe is relatively far from the 3'-end of the primer,
thereby giving the probe more time to anneal before primer extension
blocks the probe binding site. Short primer molecules generally require
lower temperatures to form sufficiently stable hybrid ,complexes with the
target nucleic acid. Therefore, the labeled oligonucleotide can be
designed to be longer than the primer so that the labeled oligonucleotide
anneals preferentially to the target at higher temperatures relative to
primer annealing.
One can also use primers and labeled oligonucleotides having differential
thermal stability. For example, the nucleotide composition of the labeled
oligonucleotide can be chosen to have greater G/C content and,
consequently, greater thermal stability than the primer. In similar
fashion, one can incorporate modified nucleotides into the probe, which
modified nucleotides contain base analogs that form more stable base pairs
than the bases that are typically present in naturally occurring nucleic
acids.
Modifications of the probe that may facilitate probe binding prior to
primer binding to maximize the efficiency of the present assay include the
incorporation of positively charged or neutral phosphodiester linkages in
the probe to decrease the repulsion of the polyanionic backbones of the
probe and target (see Letsinger et al., 1988, J. Amer. Chem. Sm.
110:4470); the incorporation of alkylated or halogenated bases, such as
5-bromouridine, in the probe to increase base stacking; the incorporation
of ribonucleotides into the probe to force the probe:target duplex into an
"A" structure, which has increased base stacking; and the substitution of
2,6-diaminopurine (amino adenosine) for some or all of the adenosines in
the probe. In preparing such modified probes of the invention, one should
recognize that the rate limiting step of duplex formation is "nucleation,"
the formation of a single base pair, and therefore, altering the
biophysical characteristic of a portion of the probe, for instance, only
the 3' or 5' terminal portion, can suffice to achieve the desired result.
In addition, because the 3' terminal portion of the probe (the 3' terminal
8 to 12 nucleotides) dissociates following exonuclease degradation of the
5' terminus by the polymerase, modifications of the 3' terminus can be
made without concern about interference with polymerase/nuclease activity.
The thermocycling parameters can also be varied to take advantage of the
differential thermal stability of the labeled oligonucleotide and primer.
For example, following the denaturation step in thermocycling, an
intermediate temperature may be introduced which is permissible for
labeled oligonucleotide binding but not primer binding, and then the
temperature is further reduced to permit primer annealing and extension.
One should note, however, that probe cleavage need only occur in later
cycles of the PCR process for suitable results. Thus, one could set up the
reaction mixture so that even though primers initially bind preferentially
to probes, primer concentration is reduced through primer extension so
that, in later cycles, probes bind preferentially to primers.
To favor binding of the labeled oligonucleotide before the primer, a high
molar excess of labeled oligonucleotide to primer concentration can also
be used. In this embodiment, labeled oligonucleotide concentrations are
typically in the range of about 2 to 20 times higher than the respective
primer concentration, which is generally 0.5-5.times.10.sup.-7 M. Those of
skill recognize that oligonucleotide concentration, length, and base
composition are each important factors that affect the T.sub.m of any
particular oligonucleotide in a reaction mixture. Each of these factors
can be manipulated to create a thermodynamic bias to favor probe annealing
over primer annealing.
The oligonucleotide primers and labeled oligonucleotides may be prepared by
any suitable method. Methods for preparing oligonucleotides of specific
sequence are known in the art, and include, for example, cloning and
restriction of appropriate sequences and direct chemical synthesis.
Chemical synthesis methods may include, for example, the phosphotriester
method described by Narang et al., 1979, Methods in Enzymology 68:90, the
phosphodiester method disclosed by Brown et al., 1979, Methods in
Enzymology 68: 109, the diethylphosphoramidate method disclosed in
Beaucage et al., 1981, Tetrahedron Letters 22:1859, and the solid support
method disclosed in U.S. Pat. No. 4,458,066.
The composition of the labeled oligonucleotide can be designed to favor
nuclease activity over strand displacement (mono and dinucleotide
fragments over oligonucleotides) by means of choice of sequences that are
GC-rich or that avoid sequential A's and T's and by choice of label
position in the probe. In the presence of AT-rich sequences in the 5'
complementary probe region, cleavage occurs after the approximately
fourth, fifth or sixth nucleotide. However, in a GC-rich 5' complementary
probe region, cleavage generally occurs after the first or second
nucleotide. Alternatively, the incorporation of modified phosphodiester
linkages (e.g., phosphorothioate or methylphosphonates) in the labeled
probe during chemical synthesis (Noble et al., 1984, Nuc Acids Res
12:3387-3403; Iyer et al., 1990, J. Am. Chem. Soc. 112:1253-1254) may be
used to prevent cleavage at a selected site. Depending on the length of
the probe, the composition of the 5' complementary region of the probe,
and the position of the label, one can design a probe to favor
preferentially the generation of short or long labeled probe fragments for
use in the practice of the invention.
The oligonucleotide is labeled, as described below, by incorporating
moieties detectable by spectroscopic, photochemical, biochemical,
immunochemical, or chemical means. The method of linking or conjugating
the label to the oligonucleotide probe depends, of course, on the type of
label(s) used and the position of the label on the probe.
A variety of labels that would be appropriate for use in the invention, as
well as methods for their inclusion in the probe, are known in the art and
include, but are not limited to, enzymes (e.g., alkaline phosphatase and
horseradish peroxidase) and enzyme substrates, radioactive atoms,
fluorescent dyes, chromophores, chemiluminescent labels,
electrochemiluminescent labels, such as Origen.TM. (Igen), ligands having
specific binding partners, or any other labels that may interact with each
other to enhance, alter, or diminish a signal. Of course, should the PCR
be practiced using a thermal cycler instrument, the label must be able to
survive the temperature cycling required in this automated process.
Among radioactive atoms, 32p is preferred. Methods for introducing .sup.32
P into nucleic acids are known in the art, and include, for example, 5'
labeling with a kinase, or random insertion by nick translation. Enzymes
are typically detected by their activity. "Specific binding partner"
refers to a protein capable of binding a ligand molecule with high
specificity, as for example in the case of an antigen and a monoclonal
antibody specific therefor. Other specific binding partners include biotin
and avidin or streptavidin, IgG and protein A, and the numerous
receptor-ligand couples known in the art. The above description is not
meant to categorize the various labels into distinct classes, as the same
label may serve in several different modes. For example, .sup.125 I may
serve as a radioactive label or as an electron-dense reagent. HRP may
serve as enzyme or as antigen for a monoclonal antibody. Further, one may
combine various labels for desired effect. For example, one might label a
probe with biotin, and detect the presence of the probe with avidin
labeled with 125I, or with an anti- biotin monoclonal antibody labeled
with HRP. Other permutations and possibilities will be readily apparent to
those of ordinary skill in the art and are considered as equivalents
within the scope of the instant invention.
Fluorophores for use as labels in constructing labeled probes of the
invention include rhodamine and derivatives, such as Texas Red,
fluorescein and derivatives, such as 5-bromomethyl fluorescein, Lucifer
Yellow, IAEDANS, 7-Me.sub.2 N-coumarin-4-acetate, 7-OH-4-CH.sub.3
-coumarin-3-acetate, 7-NH.sub.2 -4CH.sub.3 -coumarin-3-acetate (AMCA),
monobromobimane, pyrene trisulfonates, such as Cascade Blue, and
monobromotrimethyl-ammoniobimane. In general, fluorophores with wide
Stokes shifts are preferred, to allow using fluorimeters with filters
rather than a monochromometer and to increase the efficiency of detection.
In some situations, one can use two interactive labels on a single
oligonucleotide with due consideration given for maintaining an
appropriate spacing of the labels on the oligonucleotide to permit the
separation of the labels during oligonucleotide hydrolysis. Rhodamine and
crystal violet are preferred interactive labels.
In another embodiment of the invention, detection of the hydrolyzed labeled
probe can be accomplished using, for example, fluorescence polarization, a
technique to differentiate between large and small molecules based on
molecular tumbling. Large molecules (e.g., intact labeled probed) tumble
in solution much more slowly than small molecules. Upon linkage of a
fluorescent moiety to the molecule of interest (e.g., the 5' end of a
labeled probe), this fluorescent moiety can be measured (and
differentiated) based on molecular rumbling, thus differentiating between
intact and digested probe. Detection may be measured directly during PCR
or may be performed post PCR.
In yet another embodiment, two labelled oligonucleotides are used, each
complementary to separate regions of separate strands of a double-stranded
target region, but not to each other, so that an oligonucleotide anneals
downstream of each primer. For example, the presence of two probes can
potentially double the intensity of the signal generated from a single
label and may further serve to reduce product strand reannealing, as often
occurs during PCR amplification. The probes are selected so that the
probes bind at positions adjacent (downstream) to the positions at which
primers bind.
One can also use-multiple probes in the present invention to achieve other
benefits. For instance, one could test for any number of pathogens in a
sample simply by putting as many probes as desired into the reaction
mixture; the probes could each comprise a different label to facilitate
detection.
One can also achieve allele-specific or species-specific (i.e., specific
for the different species of Borrelia, the causative agent of Lyme
disease) discrimination using multiple probes in the present invention,
for instance, by using probes that have different T.sub.m s and conducting
the annealing/cleavage reaction at a temperature specific for only one
probe/allele duplex. For instance, one can choose a primer pair that
amplifies both HLVI and HTLVII and use two probes, each labeled uniquely
and specific for either HTLVI or HTLVII. One can also achieve allele
specific discrimination by using only a single probe and examining the
types of cleavage products generated. In this embodiment of the invention,
the probe is designed to be exactly complementary, at least in the 5'
terminal region, to one allele but not to the other allele(s). With
respect to the other allele(s), the probe will be mismatched in the 5'
terminal region of the probe so that a different cleavage product will be
generated as compared to the cleavage product generated when the probe is
hybridized to the exactly complementary allele.
Although probe sequence can be selected to achieve important benefits, one
can also realize important advantages by selection of probe label(s). The
labels may be attached to the oligonucleotide directly or indirectly by a
variety of techniques. Depending on the precise type of label used, the
label can be located at the 5' or 3' end of the probe, located internally
in the probe, or attached to spacer arms of various sizes and compositions
to facilitate signal interactions. Using commercially available
phosphoramidite reagents, one can produce oligomers containing functional
groups (e.g., thiols or primary amines) at either the 5' or the 3'
terminus via an appropriately protected phosphoramidite, and can label
them using protocols described in, for example, PCR Protocols: A Guide to
Methods and Applications (Innis et al., eds. Academic Press, Inc., 1990).
Methods for introducing oligonucleotide functionalizing reagents to
introduce one or more sulfhydryl, amino or hydroxyl moieties into the
oligonucleotide probe sequence, typically at the 5' terminus, are
described in U.S. Pat. No. 4,914,210. A 5' phosphate group can be
introduced as a radioisotope by using polynucleotide kinase and
gamma-.sup.32 P-ATP to provide a reporter group. Biotin can be added to
the 5' end by reacting an aminothymidine residue, or a 6amino hexyl
residue, introduced during synthesis, with an N-hydroxysuccinimide ester
of biotin. Labels at the 3' terminus may employ polynucleotide terminal
transferase to add the desired moiety, such as for example, cordycepin
.sup.35 S-dAfP, and biotinylated dUTP.
Oligonucleotide derivatives are also available labels. For example,
etheno-dA and etheno-A are known fluorescent adenine nucleotides that can
be incorporated into an oligonucleotide probe. Similarly, etheno-dC or
2-amino purine deoxyriboside is another analog that could be used in probe
synthesis. The probes containing such nucleotide derivatives may be
hydrolyzed to release much more strongly fluorescent mononucleotides by
the 5' to 3' nuclease activity as DNA polymerase extends a primer during
PCR.
Template-dependent extension of the oligonucleotide primer(s) is catalyzed
by a polymerizing agent in the presence of adequate amounts of the four
deoxyribonucleoside triphosphates (DATP, dGTP, dCIP, and dTTP) or analogs
as discussed above, in a reaction medium comprised of the appropriate
salts, metal cations, and pH buffering system. Suitable polymerizing
agents are enzymes known to catalyze primer- and template-dependent DNA
synthesis and possess the 5' to 3' nuclease activity. Known DNA
polymerases include, for example, E. coli DNA polymerase I, Thermus
thermophilus (Tth) DNA polymerase, Bacillus stearothermophilus DNA
polymerase, Thermococcus litoralis DNA polymerase, and Thermus aquaticus
(Tag) DNA polymerase. The reaction conditions for catalyzing DNA synthesis
with these DNA polymerases are well known in the art. To be useful in the
present invention, the polymerizing agent must efficiently cleave the
oligonucleotide and release labeled fragments so that the signal is
directly or indirectly generated.
The products of the synthesis are duplex molecules consisting of the
template strands and the primer extension strands, which include the
target sequence. Byproducts of this synthesis are labeled oligonucleotide
fragments that consist of a mixture of mono, di- and larger nucleotide
fragments. Repeated cycles of denaturation, labeled oligonucleotide and
primer annealing, and primer extension and cleavage of the labeled
oligonucleotide result in the exponential accumulation of the target
region defined by the primers and the exponential generation of labeled
fragments. Sufficient cycles are run to achieve a detectable species of
label, which can be several orders of magnitude greater than background
signal, although in common practice such high ratios of signal to noise
may not be achieved or desired.
In a preferred method, the PCR process is carried out as an automated
process that utilizes a thermostable enzyme. In this process the reaction
mixture is cycled through a denaturing step, a probe and primer annealing
step, and a synthesis step, whereby cleavage and displacement occurs
simultaneously with primer-dependent template extension. A DNA thermal
cycler, such as the commercially available machine from Perkin-Elmer Cetus
Instruments, which is specifically designed for use with a thermostable
enzyme, may be employed.
Temperature stable polymerases are preferred in this automated process,
because the preferred way of denaturing the double stranded extension
products is by exposing them to a high temperature (about 95.degree. C.)
during the PCR cycle. For example, U.S. Pat. No. 4,889,818 discloses a
representative thermostable enzyme isolated from Thermus aquaticus.
Additional representative temperature stable polymerases include, e.g.,
polymerases extracted from the thermostable bacteria Thermus flavus.
Thermus ruber. Thermus thermophilus, Bacillus stearothermophilus (which
has a somewhat lower temperature optimum than the others listed), Thermus
lacteus. Thermus rubens, Thermotoga maritima, Thermococcus litoralis, and
Methanothermus fervidus.
Detection or verification of the labeled oligonucleotide fragments may be
accomplished by a variety of methods and may be dependent on the source of
the label or labels employed. One convenient embodiment of the invention
is to subject the reaction products, including the cleaved labeled
fragments, to size analysis. Methods for determining the size of the
labeled nucleic acid fragments are known in the art, and include, for
example, gel electrophoresis, sedimentation in gradients, gel exclusion
chromatography and homochromatography.
During or after amplification, separation of the labeled fragments from the
PCR mixture can be accomplished by, for example, contacting the PCR
mixture with a solid phase extractant (SPE) For example, materials having
an ability to bind oligonucleotides on the basis of size, charge, or
interaction with the oligonucleotide bases can be added to the PCR
mixture, under conditions where labeled, uncleaved oligonucleotides are
bound and short, labeled fragments are not. Such SPE materials include ion
exchange resins or beads, such as the commercially available binding
particles Nensorb (DuPont Chemical Co.), Nucleogen (The Nest Group), PEI,
BakerBond.TM. PEI, Amicon PAE 1,000, Selectacel.TM. PEI, Boronate SPE with
a 3'-ribose probe, SPE containing sequences complementary to the 3'-end of
the probe, and hydroxylapatite. In a specific embodiment, if a dual
labeled oligonucleotide comprising a 3' biotin label separated from a 5'
label by a nuclease susceptible cleavage site is employed as the signal
means, the PCR amplified mixture can be contacted with materials
containing a specific binding partner such as avidin or streptavidin, or
an antibody or monoclonal antibody to biotin. Such materials can include
beads and particles coated with specific binding partners and can also
include magnetic particles.
Following the step in which the PCR mixture has been contacted with an SPE,
the SPE material can be removed by filtration, sedimentation, or magnetic
attraction, leaving the labeled fragments free of uncleaved labeled
oligonucleotides and available for detection.
Reagents employed in the methods of the invention can be packaged into
diagnostic kits. Diagnostic kits include the labeled oligonucleotides and
the primers in separate containers. If the oligonucleotide is unlabeled,
the specific labeling reagents may also be included in the kit. The kit
may also contain other suitably packaged reagents and materials needed for
amplification, for example, buffers, dNTPs, and/or polymerizing means, and
for detection analysis, for example, enzymes and solid phase extractants,
as well as instructions for conducting the assay.
The examples presented below are intended to be illustrative of the various
methods and compounds of the invention.
EXAMPLE 1
PCR Probe Label Release
A PCR amplification was performed which liberated the 5' .sup.32 P-labeled
end of a complementary probe when specific intended product was
synthesized.
A. Labeling of probe with gamma .sup.32 P-ATP and polynucleotide kinase
Ten pmol of each probe (BW3 1, BW33, BW35, sequences provided below) were
individually mixed with fifteen units of T4 polynucleotide kinase (New
England Biolabs) and 15.3 pmol of gamma-.sup.32 P-ATP (New England
Nuclear, 3000 Ci/mmol) in a 50 .mu.l reaction volume containing 50 mM
Tris-HCl, pH 7.5, 10 mM MgCl.sub.2, 5 mM dithiothreitol, 0.1 mM spernidine
and 0.1 mM EDTA for 60 minutes at 37.degree. C. The total volume was then
phenol/chloroform extracted, and ethanol precipitated as described by
Sambrook et al., Molecular Cloning, Second Edition (1989). Probes were
resuspended in 100 .mu.l of TE buffer and run over a Sephadex G-50 spin
dialysis column to remove unincorporated gamma-.sup.32 P-ArP as taught in
Sambrook et al, supra. TCA precipitation of the reaction products
indicated the following specific activities:
BW31: 1.98.times.10.sup.6 cpm/pmol
BW33: 2.54.times.10.sup.6 cpm/pmol
BW35: 1.77.times.10.sup.6 cpm/pmol
Final concentration of all three probes was 0.10 pmol/.mu.l.
B. Amplification
The amplified region was a 350 base pair product from the bacteriophage
M13mp10w directed by primers BW36 and BW42. The region of each numbered
primer sequence designated herein, follows standard M13 nucleotide
sequence usage.
SEQ ID NO: 1 BW36 = 5' 5241-5268 3'
5'-CCGATAGTTTGAGTTCTTCTACTCAGGC-3'
SEQ ID NO: 2 BW42 = 5' 5591-5562 3'
5'-GAAGAAAGCGAAAGGAGCGGGCGCTAGGGC-3'
Three different probes were used; each contained the 30 base exactly
complementary sequence to M13mp10w but differed in the lengths of
non-complementary 5' tail regions. Probes were synthesized to have a
3'-PO.sub.4 instead of a 3'-OH to block any extension by Taq polymerase.
SEQ ID NO: 3 BW31 = 5' 5541-5512 3'
5'-*CGCTGCGCGTAACCACCACACCCGCCGCGCX-3'
SEQ ID NO: 4 BW33 = 5' 5541-5512 3'
5'-*gatCGCTGCGCGTAACCACCACACCCGCCGCCGCGCX-3'
SEQ ID NO: 5 BW35 = 5' 5541-5512 3'
5'-*cgtcaccgatCGCTGCGCGTAACCACCACACCCGCCGCGCX-3'
X = 3'-phosphate
a,t,g,c, = bases non-complementary to template strand
* = gamma .sup.32 P-ATP label
For amplification of the 350 bp fragment, 10.sup.-3 pmol of target M13mp10w
sequence were added to a 50 .mu.l reaction volume containing 50 mM KCl, 10
mM Tris-HCl, pH 8.3, 3 mM MgCl.sub.2, 10 pmol each of primers BW36 and
BW42, 200 .mu.M each of the four deoxyribonucleoside triphosphates, 1.25
units Taq DNA polymerase, and either 1, 10 or 20 pmol of isotopically
diluted probe BW31, BW33 or BW35. The amount of radiolabeled probe was
held constant at 0.4 pmol per reaction and diluted to 1, 10 or 20 pmol
with nonradioactive probe. Taq, polymerase was added at 4 .mu.l per
reaction at 0.3125 U/.mu.l and diluted in 10 mM Tris-HCl, pH 8.0,50 mM
KCl, 0.1 mM EDTA, 0.5% NP40,0.5% Tween 20, and 500 .mu.g/ml gelatin.
A master reaction mix was made containing appropriate amounts of reaction
buffer, nucleoside triphosphates, both primers and enzyme. From this
master mix aliquots were taken and to them were added template and
various-concentrations of each probe. Control reactions consisted of
adding all reaction components except template, and all reaction
components except probe. Each reaction mixture was overlayed with 50 .mu.l
of mineral oil to prevent evaporation, microcentrifuged for 45 seconds,
and then placed into a thermal cycler. Reaction mixtures were subjected to
the following amplification scheme:
Fifteen cycles: 96.degree. C. denaturation, 1 min
60.degree. C. anneal/extension, 1.5 min
One cycle: 96.degree. C. denaturation, 1 min
60.degree. C. anneal/extension, 5.5 min
After cycling, the mineral oil was extracted with 50 .mu.i of chloroform,
the mixtures were stored at 4.degree. C., and the following tests were
performed.
C. Analysis
For acrylamide gel analysis, 4 .mu.l of each amplification reaction were
mixed with 3 .mu.l of 5X gel loading mix (0.125% bromophenol blue, 12.5%
Ficoll 400 in H.sub.2 O) and loaded onto a 4% acrylamide gel (10 ml of 10X
TBE buffer, 1 ml of 10% ammonium persulfate, 10 ml of 40% Bis Acrylamide
19:1, 50 .mu.l of ThMED, and 79 ml of H.sub.2 O) in 1X TBE buffer (0.089 M
Tris, 0.089 M boric acid, and 2 mM EDTA) and electrophoresed for 90
minutes at 200 volts. After staining with ethidium bromide, DNA was
visualized by UV fluorescence
The results showed that the presence of each of these three probes at the
various concentrations had no effect on the amount of amplified product
generated. Sample lanes containing no probe showed discrete high intensity
350 base pair bands corresponding to the desired sequence. All lanes
containing probe showed the same, as well as a few faint bands at slightly
higher molecular weight. Control lanes without template added showed no
bands whatsoever at 350 bases, only lower intensity bands representing
primer at 30-40 bases.
After photographing, the gel was transferred onto Whatman paper, covered
with Saran Wrap and autoradiographed. An overnight exposure revealed that
90-95% of the radiolabel was near the bottom of the gel, where probe or
partially degraded probe would run.
For the denaturing gel analysis, 2 .mu.l of each amplification reaction
were mixed with 2 .mu.l of formamide loading buffer (0.2 ml of 0.5 M EDTA
pH 8, 10 mg of bromophenol blue, 10 mg of xylene cyanol, and 10 ml of
formamide), then heated to 96.degree. C. for 3-5 min and placed on ice.
Samples were loaded onto a 6.2% denaturing gradient polyacrylamide gel (7
M urea with both a sucrose and a buffer gradient) according to the
procedure of Sambrook et al., supra. The gel was electrophoresed for 90
minutes at 2000 V, 45 W, then transferred onto Whatman paper and
autoradiographed.
Results from the denaturing gel indicated that about 50% of each probe was
degraded into smaller labeled fragments. Approximately 50%-60% of the
counts lie in the 30-40 base range, corresponding to undergraded probe. A
very faint band is visible at 300 bases for all the amplification
reactions, suggesting that a very small percentage of the probes have
lost,.or never had, a 3'-PO.sub.4 group and have been extended. The
remainder of the counts are in the range of zero to fifteen bases. The
resolution on such a gel does not reveal the exact size of products, which
can be better determined by homochromatography analysis.
For a homochromatography analysis, 1 .mu.l of each sample was spotted 1.2
cm apart onto a Polygram CEL 300 DEAE 20.times.20 cm cellulose thin layer
plate, which was pre-spotted with 5 .mu.l of sheared herring sperm DNA
(150 .mu.g/ml) and allowed to dry. After the sample was dried, the plate
was placed in a trough with distilled H.sub.2 O, and the water allowed to
migrate just above the sample loading area. The plate was then placed in a
glass development tank containing filtered Homo-mix III (Jay et al., 1979,
Nuc. Acid Res. 1(3):331-353), a solution of partially hydrolized RNA
containing 7 M urea, in a 70.degree. C. oven. The Homo-Mix was allowed to
migrate by capillary action to the top of the plate, at which time the
plate was removed, allowed to dry, covered with Saran Wrap, and then
autoradiographed.
An overnight exposure of the homochromatography plate also indicated that
about 40% of the probes were degraded into smaller fragments. These
fragments were very specific in size, depending upon the length of the 5'
non-complementary tail of each probe. FIG. 1 shows an autoradiograph of
the TLC plate. Probe BW31 (Lanes 1-3), which was fully complementary to
the M13mp10w template, generated labeled fragments predominantly one to
two bases long. Probe BW33, (Lanes 4-6), containing a 5' 3 base
non-complementary region, released products predominantly four to six
bases long. BW35 (Lanes 7-9) had a 5' 10 base non-complementary tail and
released products predominantly 12 to 13 bases in length. Lanes 10-12 are
control reactions containing either BW31, BW33 or BW35 and all PCR
components except template after 15 cycles. During DNA synthesis, the
enzyme displaced the first one or two paired bases encountered and then
cut at that site, indicative of an endonuclease-like activity. The results
show specific probe release coordinately with product accumulation in PCR.
EXAMPLE 2
Specificity of Probe Label Release
The specificity of labeled probe release was examined by performing a PCR
amplification using bacteriophage lambda DNA and primers, and a series of
non-complementary kinased probes.
The region to be amplified was a 500 nucleotide region on bacteriophage
lambda DNA from the GeneAmp.RTM. DNA Amplification Reagent kit
(Perkin-Elmer Cetus), flanked by primers PCRO1 and PCRO2, also from the
GeneAmp.RTM. DNA kit.
SEQ ID NO: 6 PCRO1 = 5' 7131-7155 3'
5'GATGAGTTCGTGTCCGTACAACTGG-3'
SEQ ID NO: 7 PCRO2 = 5' 7630-7606 3';
5'GGTTATCGAAATCAGCCACAGCGCC-3'
Aliquots of the same three labeled probes BW31, BW33 and BW35 identified in
Example I, were used, all of which were entirely non-complementary to the
target sequence.
For amplification of the 500 base pair region, 0.5 ng of target lambda DNA
sequence (control Template, Lot #3269, 1 .mu.g/ml, dilute 1:10 in 10 mM
Tris-HCl pH 8.0, 1 mM EDTA, and 10 mM NaCl for stock) were added to a 50
.mu.l reaction volume containing 50 mM KCl, 10 mM Tris-HCl, pH 8.3, 3 mM
MgCl.sub.2, 1 .mu.M each of primers PCRO1 (Lot #3355) and PCRO2 (Lot
#3268), 200 .mu.M each of four deoxynucleoside triphosphates, 1.25 units
Taq DNA polymerase, and either 2, 10 or 20 pmol of isotopically diluted
probe BW31, BW33 or BW35. The amount of radiolabeled probe was held
constant to 0.4 pmol per reaction and diluted to 1, 10 or 20 pmol with
nonradioactive probe. Taq DNA polymerase was added at 4 .mu.l per reaction
at 0.3125 units/.mu.l and diluted in 10 mM Tris-HCl pH 8.0, 50 mM KCl, 0.1
mM EDTA, 0.5%.NP40, 0.5% Tween 20, and 500 .mu.g/ml gelatin.
The master reaction mix was made as previously taught, along with the
control reactions minus probe or minus enzyme. The reaction mixtures were
amplified following the cycling conditions set forth in Example 1B and
then analyzed as follows. For acrylamide gel analysis, 4 .mu.l of each
amplification reaction mixed with 3 .mu.l of 5X loading mix were loaded
onto a 4% acrylamide gel in 1X ABE buffer and electrophoresed for 90
minutes at 200 volts. After staining with ethidium bromide, DNA was
visualized by UV fluorescence.
The results show that the presence of any probe at any concentration has no
effect on the amount of amplified product generated. Sample control lanes
containing no probe, and all lanes containing probe, showed a discrete
high intensity 500 base pair band corresponding to the desired sequence.
Control lanes with no enzyme added did not show any product bands but only
low intensity bands representing primer and probe of approximately 30-40
nucleotides.
The homochromatography analysis provided in FIG. 2 shows an overnight
exposure of the plate in which no degradation of the probes was observed.
All of the counts were located at the point of origin, showing no release
of labeled fragments. Lanes 1-3 are reactions containing probe BW31; Lanes
46 include probe BW33; Lanes 7-9 include probe BW35; and Lanes 10-12 are
control reactions without template. The results show that the probe is not
degraded unless specifically bound to target and is able to withstand the
PCR cycling conditions.
In the denaturing gel analysis, 2 .mu.l of each amplification reaction were
mixed with 2 .mu.l of formamide loading buffer (described in Example I)
and placed on a heat block at 96.degree. C. for 3-5 min. Samples were
immediately placed on ice and loaded onto a 6.2% denaturing gradient
acrylamide gel, and electrophoresed for 90 minutes at 2000 volts. After
electrophoresis, the gel was transferred onto Whatman paper, covered with
Saran Wrap, and autoradiographed.
An overnight exposure revealed all of the counts in the 30-40 base pair
range, corresponding to the sizes of the probes. Once again, there was no
probe degradation apparent, further confirming that probe must be
specifically bound to template before any degradation can occur.
EXAMPLE 3
Specificity of Probe Label Release in the Presence of Genomic DNA
In this example, the specificity of probe label release was examined by
performing a PCR amplification in the presence of degraded or non-degraded
human genomic DNA.
The BW33 kinased probe used in this experiment had a specific activity of
5.28.times.10.sup.6 cpm/pmol determined by TCA precipitation following the
kinasing reaction. The region amplified was the 350 base pair region of
Ml3mp10w, flanked by primers BW36 and BW42. Primer sequences and locations
are listed in Example 1. Human genomic DNA was from cell line HL60 and was
used undegraded or degraded by shearing in a french press to an average
size of 800 base pairs.
Each 50 .mu.l amplification reaction consisted of 10.sup.-2 or 10.sup.-3
pmol of M13mp10w target sequence, 1 .mu.g of either degraded or
non-degraded HL60 genomic DNA added to a mixture containing 50 mM KCl, 10
mM Tris HCl, pH 8.3, 3 MM MgCl.sub.2, 10 pmol each of primers BW36 and
BW42, 200 .mu.M each of four deoxyribonucleoside triphosphates, 1:25 units
Taq DNA polymerase and 10 pmol of isotopically diluted probe BW33.
A master reaction mix was made containing appropriate amounts of reaction
buffer, nucleoside triphosphates, primers, probe, and enzyme. Aliquots
were made and to them was added M13mp10w template and/or genomic DNA.
Control reactions included all reaction components except M13mp10w target
DNA or all reaction components except genomic DNA.
Each reaction mixture was overlayed with 50 .mu.l of mineral oil,
microcentrifuged, and placed into a thermal cycler. Reaction mixtures were
subjected to the following amplification scheme:
For 10, 15 or 20 cycles: 96.degree. C. denaturation, 1 min
60.degree. C. anneal/extension, 1.5 min
Final cycle: 96.degree. C. denaturation, 1 min
60.degree. C. anneal/extension, 5.5 min
After cycling, the mineral oil was extracted using 50 .mu.l of chloroform
and samples were stored at 4.degree. C. Samples were subsequently analyzed
by a 4% acrylamide gel electrophoresis, and homochromatography analysis.
For the acrylamide gel analysis, 4 .mu.l of each reaction mixture were
mixed with 3 .mu.l of 5X gel loading mix, loaded onto a 4% acrylamide gel
in 1X TBE buffer, and electrophoresed for 90 minutes at 220 volts. DNA was
visualized by UV fluorescence after staining with ethidium bromide.
In the lanes corresponding to control samples containing no M13mp10w target
DNA, there were no visible product bands, indicating the absence of any
crossover contamination of M13mp10w. All subsequent lanes showed a band at
350 bases corresponding to the expected sequence. The intensity of the
band was greater when 10.sup.-2 pmol M13mp10w target DNA was present over
10.sup.-3 pmol in the absence or presence of genomic DNA (degraded or
undegraded). The product band intensity increased with increasing number
of amplification cycles. Twenty cycles produced a band with twice the
intensity of that seen at ten cycles, and fifteen cycles generated a band
of intermediate intensity. The amount of PCR product present varied with
the amount of starting target template and the number of cycles, and the
presence of 1 .mu.g of human genomic DNA, whether degraded or undegraded,
showed no effect at all on this product formation.
In the homochromatography analysis, 1 .mu.l of each reaction mixture was
spotted onto a DEAE thin layer plate, and placed in a developing chamber
containing Homo-Mix III at 70.degree. C. After 90 minutes, the plate was
removed, allowed to dry, covered with Saran Wrap, and autoradiographed. An
overnight exposure is shown in FIG. 3; in FIG. 3A, Lanes 1 to 6 show PCR
reaction cycles in the absence of M13mp10w template DNA containing,
alternately, degraded and undegraded HL60 DNA at 10, 15, and 20 cycles;
and Lanes 7-12 are duplicate loading control reactions containing M13mp10w
template DNA without any human genomic DNA at 10, 15 and 20 cycles. In
FIG. 3B, reactions are amplified over increasing 5 cycle increments
starting at 10 cycles. The M13mp10w template DNA concentration in the
reactions shown in Lanes 1, 2, 5, 6, 9, and 10 is 10.sup.-2 pmol, while in
lanes 3, 4, 7, 8, 11, and 12 is 10.sup.-3 pmol. The reactions shown in the
odd numbered lanes from 1 through 11 contain degraded human genomic DNA,
and the even numbered lanes contain non-degraded human genomic DNA.
Labeled probe fragments were seen as two well-defined spots migrating at
approximately 4 and 5 bases in length on the thin layer plate. As the
starting template concentration increased and/or as the cycle number
increased, the amount of released labeled probe fragments also increased.
The presence or absence of degraded or non-degraded human genomic DNA did
not interfere with or enhance probe hybridization and degradation.
The results show that increased amounts of released small probe fragments
occur coordinately and simultaneously with specific product accumulation
during the course of a PCR assay. The presence or absence of either a
large amount of high complexity human genomic DNA or a large number of
random DNA "ends" has no effect on specific product accumulation or degree
of probe release. Finally, the presence of a large amount of high
complexity human genomic DNA does not lead to any detectable probe release
in the absence of specific product accumulation.
EXAMPLE 4
PCR with 3' Labeled Probe
A PCR amplification was performed which liberated a hybridized 3'
radiolabeled probe into smaller fragments when the probe was annealed to
template. The sequences of the probes were as follows:
SEQ ID NO: 8 DG46 = 5' 5541-5512-3'
5'-CGCTGCGCGTAACCACCACACCCGCCGCGC-3'
SEQ ID NO: 9 BW32 = 5' 5541-5512-3'
5'-gatCGCTGCGCGTAACCACCACACCCGCCGCGC-3'
SEQ ID NO: 10 BW34 = 5' 5541-5512-3'
5'-cgtcaccgatCGCTGCGCGTAACCACCACACCCGCCGCGC-3'
A. Labeling of Probes with .sup.32 P-cordycepin and terminal transferase
Five pmol of each probe (DG46, BW32, and BW34) were individually mixed with
17.4 units of terminal transferase (Stratagene) and 10 pmol of
[.alpha.-.sup.32 P]-cordycepin (cordycepin: 3'-deoxyadenosine-5'
triphosphate, New England Nuclear, 5000 Ci/mmol, diluted 3X with ddATP
[Pharmacia]) in a 17.5 .mu.l reaction volume containing 100 mM potassium
cacodylate, 25 mM Tris-HCl, pH 7.6, 1 mM CoCl.sub.2, and 0.2 mM
dithiothreitol for 60 minutes at 37.degree. C. The total volume was then
phenol/chloroform extracted and ethanol precipitated. Probes were
resuspended in 50 .mu.l of TE buffer and run over a Sephadex G-50 spin
dialysis column according to the procedure of Sambrook, et al., Molecular
Cloning, supra. The final concentration of probes was 0.1 pmol/.mu.l. TCA
precipitation of the reaction products indicated the following specific
activities:
DG46: 2.13.times.10.sup.6 cpm/pmol
BW32: 1.78.times.10.sup.6 cpm/pmol
BW34: 5.02.times.10.sup.6 cpm/pmol
Denaturing gradient gel analysis comparison of the 3' radiolabeled probes
to 5' kinased probes BW31, BW33 and BW35, show that the 3' radiolabeled
probes ran in a similar fashion to the 5' radiolabeled probes.
Once again, the region amplified was the 350 base region on M13mp10w
defined by primers BW36 and BW42. Primer sequences and locations are
listed in Example 1. Each amplification mixture was prepared adding
10.sup.-3 pmol of the target MI3mp10w DNA to a 50 .mu.l reaction volume
containing 50 mM KCl, 10 mM Tris HCl, pH 8.3, 3 mM MgCl.sub.2, 10 pmol
each of primers BW36 and BW42, 200 .mu.M each of four deoxynucleoside
triphosphates, 1.25 units of Taq DNA polymerase, and either 2, 10, or 20
pmol of isotopically diluted probe DG46, BW32, or BW34.
A master reaction mix was made containing appropriate amounts of reaction
buffer, nucleoside triphosphates, template, and enzyme. Aliquots were made
and to them was added the appropriate amount of primers and probes.
Control reactions included all reaction components except primers, and all
reaction components except probe.
Reaction mixtures were overlaid with 50 .mu.l of mineral oil,
microcentrifuged, and placed into a thermal cycler. The amplification
scheme was as follows:
Fifteen cycles: 96.degree. C. denaturation, 1 min
60.degree. C. anneal/extension, 1.5 min
Final cycle: 96.degree. C. denaturation, 1 min
60.degree. C. anneal/extension 5.5 min
After cycling, the mineral oil was extracted using 50 .mu.l of chloroform,
and samples were stored at 4.degree. C.
Samples were analyzed by a 4% acrylamide gel, an.8% denaturing gradient
acrylamide gel, and by homochromatography. For all three analyses,
handling of reaction mixtures was as previously described.
In the 4% acrylamide gel analysis, a sharp band corresponding to the
desired product at 350 bases was visible in all of the reaction mixtures
except control reactions minus primers. In all of the reaction mixtures
containing both primers and probe, a second band was visible at
approximately 300 bases. This second band became more intense with
increasing probe concentration, and probably corresponded to probe which
was either not efficiently 3' radiolabeled or lost the 3' label, allowing
probe extension and generating a product.
An overnight exposure of the 8% denaturing gradient acrylamide gel showed a
distribution of products ranging from full size probe down to less than 15
bases with all three probes being run. As would be expected, the 5'-3'
nuclease activity of Taq DNA polymerase degraded the probe to a point
where the degraded probe dissociated from the template.
The wide size distribution of products was illustrative of the continuously
changing concentrations of reactants and temperature changes during PCR
cycling. Such variations would lead to changes in annealing kinetics of
probe and enzyme, allowing for probe to dissociate in a variety of sizes
at different times in the cycling routine.
The homochromatography plate revealed the smallest product to be about 10
to 12 bases in length for all the probes examined. Since all three probes
had identical sequence except at the 5' tail region, this result shows
that for this particular probe sequence at an anneal/extend temperature of
60.degree. C., the probe was degraded to about 10 bases and then
dissociated from the template.
EXAMPLE 5
Polymerization Independent 5'-3' Nuclease Activity of Taq DNA Polymerase
Taq DNA polymerase was able to liberate the 5'.sup.32 P-labeled end of a
hybridized probe when positioned in proximity to that probe by an upstream
primer. A series of primers was designed to lie from zero to twenty bases
upstream of hybridized kinased probe BW33. These primers are shown below.
BW37 SEQ ID NO: 11 Delta-0 5' 5571-5542 3'
5'-GCGCTAGGGCGCTGGCAAGTGTAGCGGTCA-3'
BW38 SEQ ID NO: 12 Delta-1 5' 5572-5543 3'
5'-GGCGCTAGGGCGCTGGCAAGTGTAGCGGTC-3'
BW39 SEQ ID NO: 13 Delta-2 5' 5573-5544 3'
5'-GGGCGCTAGGGCGCTGGCAAGTGTAGCGGT-3'
BW40 SEQ ID NO: 14 Delta-5 5' 5576-5547 3'
5'-AGCGGGCGCTAGGGCGCTGGCAAGTGTAGC-3'
BW41 SEQ ID NO: 15 Delta-10 5' 5581-5552 3'
5'-AAAGGAGCGGGCGCTAGGGCGCTGGCAAGT-3'
BW42 SEQ ID NO: 16 Delta-20 5' 5591-5562 3'
5'-GAAGAAAGCGAAAGGAGCGGGCGCTAGGGC-3'
About 0.5 pmol of probe BW33 and 0.5 pmol of one of each of the primers
were annealed to 0.5 pmol M13mp10w in a 10.5 .mu.l reaction volume
containing 50 mM KCl, 10 mM Tris-HCl, pH 8.3, and 3 mM MgCl.sub.2. Control
reaction mixtures contained either 20 .mu.M or 200 .mu.M each of four
deoxynucleoside triphosphates. An additional primer, DG47, positioned 530
bases upstream from the probe was used.
DG47 SEQ ID NO: 17 Delta-530 5' 6041-6012 3'
5'-CGGCCAACGCGCGGGGAGAGGCGGTTTGCG-3'
Reaction mixtures were heated to 98.degree. C. for 1 min and annealed at
60.degree. C. for 30 min. Tubes were then microcentrifuged and placed in a
water bath at 70.degree. C. After ample time for reaction mixtures to
equilibrate to temperature, 10, 5, 2.5, 1.25, or 0.3125 units of Taq DNA
polymerase were added, and 4 .mu.l aliquots were removed at 2, 5, and 10
minutes. Enzyme was inactivated by adding 4 .mu.l of 10 mM EDTA to each
aliquot and placing at 4.degree. C. Reaction mixtures were examined by
homochromatography analysis.
In the homochromatography analysis, 1 .mu.l of each sample was spotted onto
DEAE cellulose thin layer plates and placed into a development chamber
containing Homo-Mix III ml at 70.degree. C. Homo-Mix was allowed to
migrate to the top of each plate, at which time the plates were removed,
dried, covered with Saran Wrap, and autoradiographed. FIG. 4 shows the
results of this experiment.
In FIG. 4, Lanes 1 through 3 contain radiolabeled oligonucleotide molecular
size markers of 6, 8, 9, 10, 11, 12, and 13 nucleotides. Lanes 4-10 show
reactions for primers BW37, BW38, BW39, BW40, BW41, BW42, and DG47,
respectively, in the absence of dNTFs. Lanes 11-24 show control reactions
for all primers in the presence of 20 mM or 200 mM dNTP.
In the absence of dNTPs, Taq DNA polymerase generated labeled probe
fragments using all of the primers with considerably less label being
released as the primer-probe spacing increased. This effect was seen at
all the enzyme concentrations examined (0.3125 U to 10 U/reaction) and all
timepoints. The sizes of fragments released were the same, about two and
three bases in length; however, the primary species varied depending upon
which primer was added. The majority species released by the delta zero
and delta two primers was one base smaller than that released by the delta
one, five, ten, and twenty primers. This nuclease activity was
polymerization-independent and proximity-dependent.
In the presence of nucleoside triphosphates, the sizes of labeled probe
fragments released, and the relative proportions of each, were identical
for all the primers examined. Also, the sizes of products were larger by
one to two bases when dNTPs were present. It may be that while the enzyme
was polymerizing, it had a "running start" and as it encountered
hybridized probe, was simultaneously displacing one to two bases and then
cutting, thus generating a larger fragment.
There was no detectable difference in amount of product released when dNTPs
were at 20 .mu.M or 200 .mu.M each and no significant differences were
seen due to extension times or enzyme concentrations in the presence of
dNTPs.
EXAMPLE 6
Example to Illustrate the Nature of Released Product Based on Probe
Sequence at the 5' End
The effect of strong or weak base pairing at the 5' complementary region of
a probe on the size of released product was assessed. Two probes, BW50 and
BW51, were designed to contain either a GC- or an AT-rich 5' complementary
region. BW50 and BW51 were compared to probe BW33 used in Example V.
SEQ ID NO: 18 BW50 = 5' 5521-5496 3'
5'-tatCCCGCCGCGCTTAATGCGCCGCTACA-3'
SEQ ID NO: 19 BW51 = 5' 5511-5481 3'
5'-gcaTTAATGCGCCGCTACAGGGCGCGTACTATGG-3'
a,t,g,c = bases which are non-complementary to template strand
BW50, BW51, and BW33 were labeled with .sup.32 P-ATP using polynucleotide
kinase and had the following specific activities:
BW50: 1.70.times.10.sup.6 cpm/pmol
BW51: 2.22.times.10.sup.6 cpm/pmol
BW33: 1.44.times.10.sup.6 cpm/pmol
The final concentration of all three probes was 0.10 pmol/.mu.l.
Individually, 0.5 pmol of either probe BW50, BW5 1, or BW33 and 0.5 pmol of
primer BW42 were annealed to 0.5 pmol of M13mp10w in a 10.5 .mu.l reaction
volume containing 50mM KCl, 10 mM Tris HCl, pH 8.3, 3 MM MgCl.sub.2, and
200 .mu.M each of four deoxynucleoside triphosphates. Control samples
contained all reaction components except template. For the annealing step,
reaction mixtures were heated to 98.degree. C. for 1 minute and annealed
at 60.degree. C. for 30 minutes. Tubes were then microcentrifuged and
placed in a water bath at 50.degree. C., 60.degree. C., or 70.degree. C.
After ample time for reaction mixtures to equilibrate to temperature,
0.3125 units of Taq DNA polymerase was added. Four .mu.l aliquots were
removed at 1, 2, and 5 minutes. Reactions were inactivated by adding 4
.mu.l of 10 mM EDTA to each aliquot and placing at 4.degree. C. Samples
were examined by homochromatography analysis and the results are shown in
FIGS. 5 and 6.
FIG. 5 shows the reactions containing the GC-rich probe BW50. Lanes 1-3
contain oligonucleotide molecular size markers of 6, 8, 9, 10, 11, 12, and
13 nucleotides. Lanes 4-6 show extension reactions performed at 50.degree.
C. for 1, 2, and 5 minutes. Lanes 7-9 show extension reactions at
60.degree. C. for 1, 2, and 5 minutes. Lanes 10-12 show reactions at
70.degree. C. for 1, 2, and 5 minutes. Lanes 13-15 are control reactions
containing all components except template, incubated at 70.degree. C. for
1, 2, and 5 minutes.
FIG. 6 shows the reactions containing the AT rich probe BW5 1. As in FIG.
5, Lanes 1-3 are oligonucleotide molecular size markers of 6, 8, 9, 10,
11, 12, and 13 nucleotides, Lanes 4-6 are extension reactions performed at
50.degree. C. for 1, 2 and 5 minutes. Lanes 7-9 are reactions at
60.degree. C. at 1, 2, and 5 minutes. Lanes 10-12 are reactions at
70.degree. C. at 1, 2, and 5 minutes. Lanes 13-15 are control reactions
containing all components except template, incubated at 70.degree. C. for
1, 2; and 5 minutes.
The results demonstrate that the nature of probe label release was
dependent on temperature and base composition at the 5' end. The more
stable GC-rich probe BW50 showed little label release at 50.degree. C.
(FIG. 5, Lanes 4-6) and increasingly more at 60.degree. C. FIG. 5, Lanes
7-9) and 70.degree. C. (FIG. 5, Lanes 10-12). The major products released
were about 3-5 bases in length. BW51, which was AT-rich at the 5' end,
showed as much label release at 50.degree. C. (FIG. 6, Lanes 4-6) as was
observed at the higher temperatures. In addition, the AT-rich probe
generated larger-sized products than the GC-rich probe. The base
composition of the AT-rich probe may give the opportunity for a greater
"breathing" capacity, and thus allow for more probe displacement before
cutting, and at lower temperatures than the GC-rich probe.
EXAMPLE 7
HIV Capture Assay
The following is an example of the use of a dual labeled probe containing
biotin in a PCR to detect the presence of a target sequence. Two
oligonucleotides, BW73 and BW74, each complementary to a portion of the
HIV genome, were synthesized with a biotin molecule attached at the 3' end
of the oligonucleotide. The 5' end of each oligonucleotide was
additionally labeled with .sup.32 P using polynucleotide kinase and
gamma-.sup.32 P-ATP. The two oligonucleotides PH7 and PH8 are also
complimentary to the HIV genome, flank the region containing homology to
the two probe oligonucleotides, and can serve as PCR primers defining a
142 base product. The sequences of these oligonucleotides are shown below.
SEQ ID NO: 20 BW73=.sup.32 P-GAGACCATCAATGAGGAAGCTGCAGAATGGGAT-Y
SEQ ID NO: 21 BW74=.sup.32 P-gtgGAGACCATCAATGAGGAAGCFGCAGAATGGGAT-Y
SEQ ID NO: 22 PH7=AGTGGGGGGACATCAAGCAGCCATGCAAAT
SEQ ID NO: 23 PH8=TGCTATGTCAGTTCCCCTTGGTTCTCT
In the sequences, "Y" is a biotin, and lower case letters indicate bases
that are non-complementary to the template strand.
A set of 50 .mu.l polymerase chain reactions was constructed containing
either BW73 or BW74, each doubly labeled, as probe oligonucleotides at 2
nM. Additionally, HIV template in the form of a plasmid clone was added at
either 10.sup.2 or 10.sup.3 copies per reaction, and primer
oligonucleotides PH7 and PH8 were added at 0.4 .mu.M each. Taq polymerase
was added at 1.25 U per reaction and dNTPs at 200 .mu.M each. Each
reaction was overlayed with 50 .mu.l of oil, spun briefly in a
microcentrifuge to collect all liquids to the bottom of the tube, and
thermocycled between 95.degree. C. and 60.degree. C., pausing for 60
seconds at each temperature, for 30, 35, or 40 cycles. At the conclusion
of the thermocycling, each reaction was extracted with 50 .mu.l of
CHCl.sub.3 and the aqueous phase collected.
Each reaction was analyzed for amplification by loading 3 .mu.l onto a 5%
acrylamide electrophoresis gel and examined for the expected 142 base pair
product. Additionally, 1 .mu.l of each reaction was examined by TLC
homochromotography on DEAE cellulose plates. Finally, each reaction was
further analyzed by contacting the remaining volume with 25 .mu.l of a 10
mg/ml suspension of DYNABEADS M-280 streptavidin labeled,
superparamagnetic, polystyrene beads. After reacting with the beads, the
mixture was separated by filtration through a Costar Spin X centrifuge
filter, the filtrate collected and the presence of released radiolabel
determined.
FIG. 7 contains images of the two gels used and shows that 142 base pair
product occurs in all reactions, with and without probe, and increases in
amount both as starting template was increased from 10.sup.2 to 10.sup.3
copies and as thermocycling was continued from 30 to 35 and 40 cycles.
FIG. 8 is a composite of two autoradiographs of the TLC analysis of
aliquots of the PCRs and show that radiolabel release occurs and increases
in amount with both increase in starting template and with longer
thermocycling. In the first TLC of PCRs using BW73, lanes 1 and 3 contain
radiolabeled oligonucleotides 2 and 3 bases in length as size standards.
Lanes 4, 5, and 6 contain samples from PCRs with 10.sup.2 starting copies
of template and lanes 7,8, and 9 with 10.sup.3 starting copies. Samples in
lanes 4 and 7 were thermocycled for 30 cycles; in lanes 5 and 8 for 35
cycles; and in lanes 6 and 9 for 40 cycles. In the second TLC of PCRs
using BW74, lanes 1 and 2 are the radiolabeled 2 mer and 3 mer, lanes 4,5,
and 6 contain samples from PCRs with 10.sup.2 starting copies of template
thermocycled for 30, 35, and 40 cycles, respectively, and lanes 7, 8 and 9
with 10.sup.3 copies of starting template thermocycled for 30, 35 and 40
cycles, respectively. The size of the released label is smaller with BW73,
which has no 5' non-complementary bases, and larger with BW74, which has a
5' three base non-complementary extension.
Each chromatogram was additionally analyzed by two-dimensional radioisotope
imaging using an Ambis counter. The results of Ambis counting and bead
capture counting are shown in Table 1. The good agreement in the two
methods of measuring label release demonstrates the practicality of the
use of labeled biotinylated probes and avidinylated beads in PCRs to
determine product formation.
TABLE 1
Number % of Label Released
of Cycles Ambis Capture
BW73 30 6.9 10.8
l0.sup.2 copies 35 29.0 32.7
40 47.2 47.2
10.sup.3 copies 30 11.8 16.8
35 35.6 39.3
40 53.4 52.5
BW74 30 8.3 7.9
10.sup.2 copies 35 20.7 25.2
40 43.2 48.3
10.sup.3 copies 30 15.7 14.7
35 32 37.7
40 46 47.9
EXAMPLE 8
Probe Labeling and Solid Phase Extractant Methodology
In one embodiment of the present invention, a separation step is employed
after probe cleavage but prior to determination of the amount of cleaved
probe to separate cleaved probe products from uncleaved probe. Two
alternate separation methods are preferred: (1) the use of avidinylated or
streptavidinylated magnetic particles to bind probes labeled at the 3'-end
with biotin and at the 5'-end with a fluorophore; the magnetic particles
bind both uncleaved probe and the 3'-fragment that is the product of probe
cleavage; and (2) the use of magnetic ion exchange particles that bind
oligonucleotides but not mono- or dinucleotides that are typically labeled
at the 5'-end with a fluorophore or .sup.32 P. Various aspects of these
alternate strategies are discussed below.
A. Avidinylated Magnetic Particles
The separation system involving 3'-biotinylated probes and magnetic
avidinylated (or streptavidinylated) beads is carried out preferably with
beads such as Dynabeads.TM. from Dynal; these beads have a biotin binding
capacity of approximately 100 pmoles per 50 .mu.l of beads. Nonspecific
adsorption is minimized by first treating the beads with both Denhardt's
solution and carrier DNA.
The probe for streptavidin-biotin separation methods requires a biotin
moiety at the 3'-terminus and a fluorophore at the 5'-terminus. The
3'-biotin functions both as a ligand for separation by streptavidinylated
(or avidinylated) beads and as a block to prevent the extension of probe
during the amplification. Post-synthesis modifications can be simplified
by extending each end of the probe with a different nucleophile; for
instance, one can add an amine to the 3'-end for the addition of biotin
and a blocked thiol at the 5'-end for later addition of the fluorophore.
The 3'-biotinylated probes can be prepared in a variety of ways; some of
which are illustrated below.
An NHS-active ester derivative of biotin can be added to the 3'-amine of
the probe by the reaction mechanism shown in FIG. 9. The resulting linkage
creates a secondary hydroxyl gamma to the amide carbonyl, which may result
in instability during the repeated thermal cycling of a typical PCR. For
instance, thermal cycling for 40 cycles can render as much as 6% of the
initial probe added unable to bind to magnetic avidinylated particles.
When the bond between the probe and the attached biotin breaks down as a
result of thermal cycling, the probe can no longer be separated from the
cleaved products and contributes to the background. Although one can help
overcome this problem by attaching more than one biotin to the probe,
several alternate methods for attaching biotin to an oligonucleotide may
yield more stable products.
One can react biotin hydrazide with aldehydes generated from a 3'-ribose on
the probe to yield a biotinylated oligonucleotide. For this strategy, the
3'-nucleotide of the probe contains a ribose sugar in place of the
deoxyribose sugar. During synthesis, the 3'-ribose is attached to the
solid support by either its 2'- or 3'-OH. Following synthesis, the
completed oligonucleotide is released from the solid support, and the
vicinal diols of the ribose are oxidized by sodium periodate (NaIO.sub.4)
to aldehydes that are then reacted with the biotin hydrazide, as shown in
FIG. 10, and the product is reduced by sodium borohydride (NaBH.sub.4).
However, the resulting biotinylated probe does not bind efficiently to
avidinylated magnetic particles. The use of biotin long chain hydrazide, a
compound also shown in FIG. 10, can solve this problem.
One can attach the biotin to the probe during probe synthesis using a
soluble biotin phosphoramidite, as shown in FIG. 11. The synthesis begins
with a base attached to controlled porous glass (CPG), which is ultimately
discarded. A phosphoramidite, which allows the generation of a
3'-phosphate on ammonium hydroxide deprotection of the synthetic
oligonucleotide, is added. The biotin phosphoramidite is then added, and
the oligonucleotide synthesized is as shown in FIG. 11, which also shows
the final product. This method of attachment allows the use of 5'-amine
terminated oligonucleotides for the attachment of a fluorophore. The use
of a 3'-amine for the attachment of biotin limits the chemistry of
attachment of fluorophore to 5'-thiols. Utilization of biotin
phosphoramidite in which one of the biotin nitrogens is blocked may
improve the synthesis of the biotin labeled probe.
One can also use a commercial reagent that consists of biotin directly
attached to porous glass; the reagent is the starting substrate for probe
synthesis and is shown in FIG. 12. This method of attachment allows the
use of 5'-amine terminated oligonucleotides for the attachment of a
fluorophore. The use of a 3'-amine for the attachment of biotin limits the
chemistry of attachment of fluorophore to 5'-thiols. Enzymatic methods of
attachment of modified nucleotides to the 5'-ends of oligonucleotides are
also available, although limited in their generality and practicality.
B. Magnetic Ion Exchange Matrices
One can use commercially available polyethyleneimine (PEI) matrices
(cellulose-, silica-, and polyol polymer-based) particles to separate
cleaved from uncleaved probe. For instance, Hydrophase PEI, Selectacel.TM.
PEI, Bakerbond.TM. PEI, and Amicon PAE 300, 1000, and 1000L are all
commercially available PEI matrices that give separation of uncleaved
probe from cleaved probe products.
Commercially available activated cellulose magnetic particles, such as
Cortex MagaCell.TM. particles can be derivatized with PEIs of various
lengths, such as PEI600, PEI1800, and PEI10,000, and at different molar
ratios of PEI per gram of matrix. However, all sizes of oligonucleotides
and coumarin-labeled oligonucleotides bind to magnetic cellulose and
agarose beads whether or not they have been derivatized with PEI (the
specificity seen with oligonucleotides on commercially available PEI
matrices is lost when one labels the oligonucleotides with coumarin). The
addition of high concentrations of salt (2.0 M NaCl) or N-methyl
pyrrolidone (10 to 20%) partially increases the specificity, and other
cosolvents such as SDS, Brij 35, guanidine, and urea can also be used to
increase the specificity of binding. However, 8 M urea provides efficient
blocking of the nonspecific binding of coumarin labeled di- and
tri-nucleotides to both Bakerbond.TM. PEI and magnetic Cortex.TM. PEI
derivatized particles, although the use of N-substituted ureas may be more
preferred.
As noted above, Cortex Biochem sells a variety of activated cellulose
coated magnetic particles that can be linked to PEI. The most convenient
of these is the periodate activated matrix. The protocol recommended by
the manufacturer to attach amines to the periodate activated matrix,
however, has several problems: the reaction of an amine with an aldehyde
results in imines that are labile and can be hydrolyzed or reacted further
with amines; during the step to block remaining aldehydes by the addition
of excess ethanolamine, the PEI can be displaced by ethanolamine, thus
removing the PEI from the matrix; during the conjugation reaction under
basic conditions, aldol condensation can lead to reaction among the
aldehyde groups, thereby resulting in aggregation of the particles; and
reaction of aldehydes under basic conditions may result in free radicals
that can attack the cellulose, and participate in a variety of reactions.
To stabilize the imine, a reduction step (with NaBH.sub.4 and NaBH.sub.3
CN) can be included; however, this step can result in the production of
gas, a decrease in the mass of the particles, and particle agglutination.
These unwanted effects may result from the production of free radicals.
The complications resulting from conjugation to active aldehydes may be
avoided through the use of epoxide chemistry. The resulting
beta-hydroxyamines are stable and do not require reduction. In addition,
because oxygen may participate in the generation of free radicals, the
removal of oxygen from the system should minimize free radical formation,
especially during the reduction step. In one synthesis of PEI derivatized
cellulose coated magnetic particles, the ethanolamine blocking step was
eliminated and the preparation purged overnight with helium prior to and
during reduction with sodium cyanoborohydride. There was little
aggregation in the final preparation.
Polyacrolein magnetic particles can be derivatized with both PEI600 and
ethylene diamine, and the non-specific binding of coumarin labeled di- and
trinucleotides can be inhibited by high concentrations of NMP. The use of
longer chained PEI polymers may mask nonspecific backbone interaction with
small, coumarin labeled oligonucleotides.
One important factor in selecting a magnetic matrix for use in the present
method is the amount of background fluorescence contributed by the matrix.
One strategy to minimize this background fluorescence is to select
fluorophores with excitation and emission maxima that minimally overlap
the background fluorescence spectra of the buffer, matrix, and clinical
samples. In addition, the fluorescent background may result from the
presence of contaminants in the matrix that might be removed by extensive
pretreatment prior to binding.
C. Chemistry of Attachment of the Fluorophore to the Probe
As noted above, the preferred label for the probe, regardless of separation
strategy, is a fluorophore. There appears to be interaction between the
oligonucleotide probe and the attached fluorophore. This interaction may
be responsible for the reported quenching observed when fluorophores have
been attached to oligonucleotides. One should select fluorophores that
minimally interact with DNA when attached to the 5'-terminus of a nucleic
acid.
Three preferred fluorophores are
7-diethylamino-3-(4'-maleimidylphenyl)-4-methyl coumarin (CPM),
6-(bromomethyl)fluorescein (BMF), Lucifer Yellow iodoacetamide (LYIA), and
5-(and 6-)carboxy-X-rhodamine succinimidyl ester, with CPM preferred due
to several properties: large extinction coefficient, large quantum yield,
low bleaching, and large Stokes shift. The fluorophore can be attached
through a thiol attached to the 5'-phosphate group of the probe, but in
the case of CPP, this process yields an aryl maleimide, which can be
unstable under thermocycling conditions.
A number of commercial instruments are available for analysis of
fluorescently labeled materials. For instance, the ABI Gene Analyzer can
be used to analyze attomole quantities of DNA tagged with fluorophores
such as ROX (6carboxy-X-rhodamine), rhodamine-NHS, TAMRA
(5/6-carboxytetramethyl rhodamine NHS), and FAM (5'-carboxyfluorescein
NHS). These compounds are attached to the probe by an amide bond through a
5'-alkylamine on the probe. Other useful fluorophores include CNHS
(7-amino-4-methyl-coumarin-3-acetic acid, succinimidyl ester), which can
also be attached through an amide bond.
Modifications may be necessary in the labeling process to achieve efficient
attachment of a given fluorophore to a particular oligonucleotide probe.
For instance, the initial reaction between a 5'-amine terminated probe and
7-diethylaminocoumarin-3-carboxylate NHS ester was very inefficient. The
probe, which had been phosphorylated at the 3'-end to prevent extension of
the probe during amplification, had significant secondary structure, one
conformation of which placed-the 5'-amine and the 3'-phosphate in close
enough proximity to form a salt bridge. This structure may have prevented
the 5'-amine from being available for reacting with the NHS ester, thus
causing the low yield of product. Addition of 25% N-methylpyrrolidinone
(NMP) markedly improved the efficiency of the reaction.
One can also use both a fluorophore and quenching agent to label the probe.
When the probe is intact, the fluorescence of the fluorophore is quenched
by the quencher. During the present method, the probe is cleaved between
the fluorophore and the quencher, allowing full expression of the
fluorophore fluorescence. Quenching involves transfer of energy between
the fluorophore and the quencher, the emission spectrum of the fluorophore
and the absorption spectrum of the quencher must overlap. A preferred
combination for this aspect of the invention is the fluorophore rhodamine
590 and the quencher crystal violet.
One such probe is shown in FIG. 13. The synthesis of this construct
requires attachment of a rhodamine derivative through a 5'-thiol and the
attachment of the crystal violet through an amine extending from a
thymidine two bases away. The separation of the two moieties by two
phosphodiester bonds increases the chances for cleavage by the DNA
polymerase between them.
Initial attempts to attach the crystal violet by reaction between a lactone
and amine were unsuccessful. The crystal violet was modified to generate
an active acyl azide, shown in FIG. 14. This form of crystal violet was
reacted with amine-modified DNA, and the desired product was purified on
reverse phase HPLC.
Attempts to react the rhodamine-X-maleimide group with the 5'-thiol were
unsuccessful. This was also the case when the rhodamine-X-maleimide was
reacted prior to addition of the crystal violet. This may be because the
deblocked 5'-thiol reacts with the acrylamide double bond in the thyridine
spacer arm (see FIG. 13). An alternate method for the addition of an amine
to the thymidine is shown in FIG. 15.
This example provides general guidance for attaching a biotin to the 3'-end
of an oligonucleotide probe and a fluorophore to the 5'-end of an
oligonucleotide probe. Those of skill in the art will recognize that a
number of methods for such attachments are known in the art and that the
present invention is not limited by the particular method chosen to label
the probe.
EXAMPLE 9
Protocol for AmpliWax.TM. Mediated PCR with UNG and dUTP
The PCR process can be improved with respect to specificity of
amplification by processes and reagents described more fully in PCT patent
application Ser. No. 91/01039, filed Feb. 15, 1991; U.S. patent
application Ser. No. 481,501, filed Feb. 16, 1991; PCT patent application
Ser. No. PCT/US 91/05210, filed Jul. 23, 1991; U.S. patent application
Ser. No. 609,157, filed Nov. 2, 1990; and U.S. patent application Ser. No.
557,517, filed Jul. 24, 1990. The disclosures of these patent applications
are incorporated herein by reference, and the following protocol
demonstrates how these improved PCR methods can be used in conjunction
with the present method for superior results. All reagents can be
purchased from Perkin-Elmer Cetus Instruments (PECI, Norwalk, Conn.).
This protocol essentially involves three components: MicroAmp.TM. tubes
containing dNT'Ps, primers, magnesium, and Tris that have been covered
with wax; Premix B to which is added AmpliTaq.RTM. DNA Polymerase and UNG
(and is therefore called the Enzyme Mixture); and Premix C to which are
added the test sample and probe. The Enzyme Mixture and test sample with
probe are made and added above the wax layer. The tubes are then placed in
a TC9600 thermocycler and theomocycled. The protocol below assumes a 50 W
reaction, with test samples of no more than 27 .mu.l, and the target is
HIV.
The reagents are preferably supplied as follows. MicroAmp.TM. tubes
containing 12.5 .mu.l of Premix A and one 12 mg AmpliWax.TM. PCR pellet
per tube are prepared. Premix A contains 1 .mu.M SK145 primer and 1 .mu.M
SK431 primer (neither primer is biotinylated), 800 .mu.M DATP, 800 .mu.M
dGTP, 800 .mu.M dCTP, 800 .mu.M DUTP, 15 mM MgCl.sub.2, and 10 mM
Tris-HCl, pH 8.3. The AmpliWax.TM. pellet consists of a 55.degree. C.
melting paraffin (Aldrich Chemical Co.) containing 0.15% Tween 65, and the
wax pellet and Premix A bottom layer are added together in a DNA-free
room. The wax pellet is then melted to form a vapor barrier on top. This
barrier will retain its integrity when the tubes are stored at 4 to
25.degree. C., and the PCR reagents below the barrier are storage stable
for months at 4.degree. C. There is no mixing of material added above the
barrier until the wax is melted during the initial stages of thermal
cycling. Control tubes are identical but contain no primer.
Premix B buffer contains 10 mM Tris-HCl, pH 8.3, and 50 mM KCl and is used
for dilution of the enzymes AmpliTaq.RTM. DNA polymerase and UNG. About
2.6 .mu.l of Premix B buffer are used per reaction.
Premix C buffer is prepared as a 10X concentrate, which contains 105 mM
Tris-HCl, pH 8.3, and 715 mM KCl and is added to the test DNA sample so
that the final Tris and KCI concentrations in the final reaction are 10 mM
and 50 mM, respectively. The probe is also added in this layer, as well as
carrier DNA, if any. If plasmid controls are run, about 1 .mu.g of human
placental DNA (1 .mu.l in 10 mM Tris, pH 8, 1 mM EDTA, and 10 mM NaCl,
which has been sheared, phenol/chloroform extracted, chloroform extracted,
and ethanol precipitated) per reaction is usually added as carrier DNA.
About 3.3 .mu.l of the 10X stock of Premix C are added per reaction.
The probe is prepared as a5 5M stock and designated as LG101C. Probe LG101C
has a 3'-phosphate to prevent extension of the probe and a
7-diethylaminocoumarin-3-carboxylate attached to a 5'-amino aliphatic
group on the oligonucleotide by an amide bond The nucleotide sequence of
the probe is shown below:
SEQ ID NO: 24 LG101C: 5'-GAGACCATCAATGAGGAAGC7GCAGAATGGGAT
This probe should be stored at -20.degree. C. in the dark.
AmpliTaq.RTM. pNA polymerase is provided at a stock concentration of 5
U/.mu.l from PECI, and UNG is provided at a stock concentration of 1
U/.mu.l from the same vendor. One can also run plasmid calibration
samples, and for this purpose, the preparation of stock dilutions
(copies/ml) of 300, 1,000; 3,000; 10,000; 30,000; 100,000; and 1,000,000
with GeneAmplimer.TM. Positive Control DNA is helpful. This DNA consists
of the HIVZ6 genome rearranged to interrupt the pol region, and so block
infectivity, inserted into plasmid pBR322.
Each final reaction will consist of 12.5 .mu.l of Premix A; 2.6 .mu.l of
Premix B; 3.3 .mu.l of Premix C; 2 .mu.l of LG101C probe; 27 .mu.l of test
sample; 0.4 .mu.l of AmpliTaq.RTM. DNA polymerase; and 2 .mu.l of UNG
yielding a final volume of 49.8 .mu.l. This mixture comprises 250 nM of
each primer, 200 .mu.M of each DNTP; 3.75 mM MgCl.sub.2 ; 50 mm KCl, 10 mM
Tris-HCl, pH 8.3; 200 nM of probe; 2 units of UNG; and 2 units of
polymerase.
To run the reaction, one first prepares the Enzyme Mixture in a DNA-free
hood or room by mixing, per reaction, 2.6 .mu.l of Premix B buffer, 0.4
.mu.l of AmpliTaq.RTM. DNA polymerase, and 2 .mu.l of UNG For every 16
reactions that will be run, one should prepare enough Enzyme Mixture for
18 reactions to ensure enough material. The Enzyme Mixture is then added
to each MicroAmp.TM. tube containing wax-covered Premix A over the wax in
a DNA-free hood or room. A single sampler tip can suffice for all
transfers, and 5 .mu.l of Enzyme Mixture are added to each tube.
In the sample preparation area, the Sample Mixture is prepared by mixing,
per reaction, 3.3 .mu.l of 10X Premix C Buffer, 27 .mu.l of sample (for
quantification controls, add 10 .mu.l of stock dilution and 17 .mu.l of
water), and 2 .mu.l of probe (carrier DNA, if any, is mixed with sample).
Then, using a separate sampler tip for each transfer, add 32.3 .mu.l of
Sample Mixture to each tube; the volume imbalance between the Enzyme
Mixture and Sample Mixture assures complete mixing. One should also set up
two control tubes lacking primers to serve as a measure of probe cleavage
resulting from thermal cycling. This control typically contains 1,000
copies of control template. In addition, one should set up a dilution
series of plasmid to calibrate the assay. This calibration is typically in
the range of 3 to 10,000 copies of HIV target per sample. After the above
steps are completed, the tubes are capped and assembled into the TC9600
tray.
The thermal cycler profile is as follows: 1 cycle of 50.degree. C. for 2
minutes; 5 cycles of 95.degree. C. for 10 seconds, 55.degree. C. for 10
seconds, and 72.degree. C. for 10 seconds; and 35 cycles of 90.degree. C.
for 10 seconds, 60.degree. C. for 10 seconds, and 72.degree. C. for 10
seconds. When thermal cycling is complete, the tubes are removed from the
TC9600 and stored at -20.degree. C., if necessary. Prolonged soaking of
the tubes at above 70.degree. C. is not recommended, and alkaline
denaturation should not be employed.
A number of controls are useful, including a no-template control to
determine contamination of reaction mixtures as well as amplification of
nonspecific products that may result in probe cleavage and give
nonspecific signals; a no-primer control to prove a measure of
nonamplification related cleaveage of the probe that might contribute to
background (one might also include some clinical samples in the tests to
detect the presence of components that may result in probe cleavage); and
quantitation controls.
To remove PCR product from beneath the wax layer that will form after
amplification using the above protocol, one can withdraw sample after
poking a sampler tip through the center of the wax layer, advancing the
tip slowly with gentle pressure to minimize the chance that reaction
mixture will spurt past the tip and contaminate the lab. Steadying the
sampler with one finger of the hand holding the reaction tube greatly
increases control. Slim (gel-loading) sampler tips penetrate the wax
especially well. A slicing motion rather than a poking motion also
facilitates penetration and helps to assure that the tip will not be
clogged with wax. If the tip picks up a piece of wax, the wax can normally
be dislodged by gentle rubbing against the remaining wax.
One can also freeze the reaction tubes (e.g., in dry ice ethanol or
overnight in a freezer), thaw them, and spin briefly in a microfuge (angle
rotor). The wax layer will be heavily fractured, allowing sampler
insertion without any chance of clogging. Wax fragments can be wiped from
the sampler tip against the inner wall of the tube. This method is
especially convenient for positive displacement samplers, which often have
tips so thick that direct penetration of the intact wax layer is hard
Either of the above methods should exclude wax from the withdrawn sample
so completely that chloroform extraction is unnecessary.
Although the foregoing invention has been described in some detail for the
purpose of illustration, it will be obvious that changes and modifications
may be practiced within the scope of the appended claims by those of
ordinary skill in the art.
EXAMPLE 10
Solid Phase Extraction with Bakerbond.TM. PEI
This example provides a protocol for sampling a PCR mixture in which the
amplification was carried out in the presence of a fluorescently labeled
(a coumarin derivative) probe according to the method of the present
invention.
The preparation of certain stock reagents facilitates practice of this
protocol. One such reagent is Eppendorf tubes containing 50 mg of
pre-washed Bakerbond PEI matrix. The Bakerbond.TM. PEI can be obtained
from J. T. Baker (product No. 7264-00) and is a silica based, 40 .mu.m
particle size, 275 angstrom pore size. The matrix is prepared by washing
first with water, then ethanol; then water; and then a mixture of 10 mM
Tris, pH 8.3, 50 mM KCl, 1 mM EDTA, 2 M NaCl, and 8 M urea; and then
equilibrated in 10 mM Tris, pH 8.3,50 mM KCl, 1 mM EDTA, 500 mM NaCl, and
8 M urea. Following distribution, 15 .mu.l of water is added to each tube
to keep the matrix hydrated. The tubes should be stored at 4.degree. C.
Binding buffer can also be prepared as a stock solution, and the
composition is 10 mM Tris, pH 8, 500 mM NaCl, 50 mM KCl, 1 mM EDTA, and 8
M urea. The binding buffer should be stored at 4.degree. C., although urea
may precipitate at this temperature. The binding buffer can be warmed
briefly before use to resuspend the urea.
Certain equipment is useful in carrying out this protocol. During the
binding step, the tubes should be mixed to keep the matrix in suspension,
and a Vortex Genie 2 mixer (available from Fischer Scientific, Cat. No.
12-812, with the 60 microtube holder, Cat. No. 12-812-B) is useful for
this purpose. In addition, an Eppendorf microfuge, an Hitachi Model 2000
spectrofluorometer, and microfluorimeter quartz cuvettes with 2 mm
internal width and a 2.5 mm base path length (available from Starna Cells,
Inc., No. 18F Q 10 mm 5) are also useful in carrying out this protocol.
Appropriate controls should also be performed, and the binding step
requires three controls. The control for background fluorescence involves
the preparation of a sample that contains all components of the PCR
amplification except probe. The control sample should be processed
identically as the actual test samples in that 20 .mu.l will be added to
matrix and the fluorescence present in the supernatant measured. This
control provides a way to measure background fluorescence present in the
matrix, binding buffer, and any of the components in the PCR amplification
mixture and also provides a measurement of the amount of fluorescence
present in clinical samples.
The second control provides a measurement for inadvertent probe breakdown
and for the binding reaction and consists of a mock PCR amplification
mixture that contains all of the components including probe but is not
subjected to thermal cycling. The control sample should be processed
identically as the actual test samples in that 20 .mu.l will be added to
matrix and the fluorescence present in the supernatant measured. This
control provides a way to measure the presence of probe breakdown on
storage as well as the efficiency of the binding reaction. If no breakdown
occurred and if the binding reaction is complete, the fluorescence of the
supernatant following binding to the Bakerbond.TM. PEI should be similar
to the background measured in the first control.
The third control provides a way to measure the input amount of probe. The
sample prepared for the second control can be used for this measurement.
However, in this case, 20 .mu.l are added to a tube containing 290 .mu.l
of binding buffer without matrix. This control can be used to determine
the input amount of probe.
To begin the protocol, one first determines the number of binding tubes
required; this number is the sum of test samples and controls. The
controls are a no-template control, a no-primer control, calibration
controls, and the first and second controls discussed above. Controls can
be done in triplicate. To each tube, one adds 235 .mu.l of binding buffer.
One also prepares a tube to measure the input by adding to an empty
Eppendorf tube: 290 .mu.l of binding buffer, which is equivalent to the
volume in the tubes with matrix (235 .mu.l of binding buffer, 15 .mu.l of
water, and 40 .mu.l contributed by matrix volume). The input amount
determination can be done in triplicate.
To the tubes containing matrix (the test samples and first and second
controls), one adds 20 .mu.l of sample. To the tubes containing buffer
(the third control), one adds 20 .mu.l of mock PCR amplification mixture.
The tubes are then shaken on a Vortex Genie 2 mixer at a setting of 4 at
room temperature for 30 minutes. The tubes are then centrifuged in an
Eppendorf microfuge (16,000 X g) for 5 minutes at room temperature. The
upper 200 p of supernatant from each tube is removed without disturbing
the pellet or matrix present on the wall of the tube and placed in a clean
Eppendorf tube.
The fluorescence of the supernatant is measured on a Hitachi Model 2000 in
the cuvettes indicated above. For probes labeled with 7-diethylamino-3
(4'-maleimidophenyl)-4methyl-coumarin, the spectrofluorometer is set as
follows: PM voltage is 700 V; the excitation wavelength is 432 nm; the
emission wavelength is 480 nm; the excitation slit width is 10 nm; and the
emission slit width is 20 nm. One should minimize exposure of sample to
excitation light; if the sample is to remain in the spectrofluorometer for
a prolonged period, the shutter should be closed.
The number of pmoles of probe cleaved is the most convenient way of
assessing the amount of signal. To assess the amount of signal, then, one
first determines the input signal from the third control by the following
calculation:
##EQU1##
In this formula, the subtraction corrects for any background fluorescence
in the test sample; 310/20 is the dilution factor; and 10 pmoles is the
amount of probe added to the PCR amplifications.
##EQU2##
The above protocol can be modified according to the particular fluorophore
used to label the probe and is merely illustrative of the invention.
FIG. 16 shows typical results and relation of signal to input target number
for the present method using Bakerbond.TM. PEI solid phase extractant.
Top