Back to EveryPatent.com
United States Patent |
6,150,163
|
McPherson
,   et al.
|
November 21, 2000
|
Chondrocyte media formulations and culture procedures
Abstract
One object of the present invention is based upon the development and use
of a serum-free defined cell culture medium comprising a supplement
mixture, a component mixture, a vitamin mixture, an inorganic salt mixture
and amino acid mixture that avoids the problems inherent in the use of
serum. In particular, the defined medium is useful in culturing
fibroblasts, especially chondrocytes. Another object of the present
invention is to claim a method of enhancing the differentiation of
chondrocytes and enhancing the synthesis of a cartilage specific matrix
using tumor growth factor beta (TGF-.beta.). Another object of the present
invention is to claim a method of enhancing the differentiation of
chondrocytes using the combination of TGF-.beta.and IGF.
Inventors:
|
McPherson; John M. (Hopkinton, MA);
Yaeger; Peter C. (Natick, MA);
Brown; Marie E. (West Newton, MA);
Hanlon; James G. (Camarillo, CA);
Binette; Francois (Belmont, CA)
|
Assignee:
|
Genzyme Corporation (Cambridge, MA)
|
Appl. No.:
|
229430 |
Filed:
|
January 13, 1999 |
Current U.S. Class: |
435/384; 435/383; 435/404; 435/405; 435/406 |
Intern'l Class: |
C12N 005/00 |
Field of Search: |
435/384,383,405,406,404
|
References Cited
U.S. Patent Documents
Re34090 | Oct., 1992 | Seyedin et al.
| |
Re35694 | Dec., 1997 | Seyedin et al.
| |
4774228 | Sep., 1988 | Seyedin et al.
| |
4774322 | Sep., 1988 | Seyedin et al.
| |
4843063 | Jun., 1989 | Seyedin et al.
| |
4983581 | Jan., 1991 | Antoniades et al.
| |
5118667 | Jun., 1992 | Adams et al.
| |
5206023 | Apr., 1993 | Hunziker.
| |
5256644 | Oct., 1993 | Antoniades et al.
| |
5270300 | Dec., 1993 | Hunziker.
| |
5328844 | Jul., 1994 | Moore.
| |
5420243 | May., 1995 | Ogawa et al.
| |
5842477 | Dec., 1998 | Naughton et al.
| |
5908784 | Jun., 1999 | Johnstone et al.
| |
Foreign Patent Documents |
0 295 605 | Jun., 1988 | EP.
| |
0 343 635 | May., 1989 | EP.
| |
95/00632 | Jan., 1995 | WO.
| |
96/12793 | May., 1996 | WO.
| |
Other References
International Search Report dated Nov. 13, 1997for corresponding PCT
application PCT/US97/13140.
Adolphe, et al. "Cell Multiplication and Type II Collagen Production by
Rabbit Articular Chondrocytes Cultivated in a Defined Medium,"
Experimental CEll Research 155: 527-536 (1984).
Jennings, Susan D. and Ham, Richard G., "Clonal Growth of Primary Cultures
of Rabbit Ear Chondrocytes in a Lipid-supplemental Defined Medium,"
Experimental Cell Research, 145: 415-423 (1983).
Kato, et al., "A Serum-Free Medium Supplemented With
Multiplication-Stimulating Activity (MSA) Supports Both Proliferation and
Differentiation of Chondrocytes in Primary Culture," Experimental Cell
Research, 125: 167-174 (1980).
Madsen, et al., "Growth Hormone Stimulates the Proliferation of Cultured
Chondrocytes from Rabbit Ear and Rat Rib Growth Cartilage," Nature, 304:
545-547 (1983).
Quarto, et al., "Proliferation and Differentiation of Chondrocytes in
Defined Culture Medium Effects of Systematic Factors," Bone, 17: 558/117
(1995).
Boumediene, et al., "Modulation of Rabbit Articular Chondrocyte (RAC)
Proliferation by TGF-Beta Isoforms," Cell Prolif., 28: 221-234 (1995).
Trippel, Stephen, B., "Growth Factor Actions on Articular Cartilage,"
Journal of Rheumatology, 21: 129-132 (1995).
Burton-Wurster, Nancy and Lust, George, "Fibronectin and Proteoglycan
Synthesis in Long TermCultures ofCartilage Explants in Ham's F12
Supplemented witih Insulin and Calcium: Effects of the Addiction of
TGF-Beta," Archives of Biochemistry and Biophysics, 283: 27-33 (1990).
Binette, et al., "Expression of a Stable Articular Cartilage Phenotype
without Evidence of Hypertrophy by Adult Human Articular Chondrocytes In
Vitro," The Journal of Orhopaedic Research, 16: 207-216 (1998).
Jennings, Susan, D. and Ham, Richard, G., "Clonal Growth of Primary
Cultures of Human Hyaline Chondrocytes in a Defined Medium," Cell Biology
International Reports, 7: 149-159 (1983).
Adolphe, et al., "Cell Multiplication and Type II Collagen Production by
Rabbit Articular Chondrocytes Cultivated in a Defined Medium,"
Experimental Cell Research, 155: 527-536 (1984).
Yeager, et al., "Synergistic Action of Transforming Growth Factor-Beta and
Insulin-like Growth Factor-Beta Induces Expression of Type II Collagen and
Aggrecan Genes in Adult Human Articular Chondrocytes," Experimental Cell
Research, 237: 318-325 (1997).
Livne, "In Vitro Response of Articular Cartilage From Magure Mice to Human
Transforming Growth Factor Beta," Acta Anat., 149: 185-194 (1994).
Morales, Teresa I., "Transforming Growth Factor-Beta and Insulin-like
Growth Factor-1 Restore Proteoglycan Metabolism of Bovine Articular
Cartilage After Depletion by Retinoic Acid," Archives of Biochemistry and
Biophysics, 315: 190-198 (1994).
Tsukazaki, et al., "Effect of Tranforming Growth Factor-Beta on the
Insulin-like Growth Factor-1 Autocrine/Paracrine Axis in Cultured Rat
Articular Chondrocytes," Experimental Cell Research, 215: 9-16 (1994).
Inoue, et al., "Stimulation of Cartilage-Matrix Proteoglycan Synthesis by
Morphologically Transformed Chondrocytes Grown in the Presence of
Fibroblast Growth Factor and Transforming Growth Factor-Beta," Journal of
Cellular Physiology, 138: 329-337 (1989).
Galera, et al., Effect of Tranforming Growth Factor-Beta1 (TGF-Beta1) on
Matrix Synthesis by Monolayer Cultures of Rabbit Articular Chondrocytes
during the Dedifferentiation Process, Experimental Cell Research, 200:
379-392 (1992).
Harrison, et al, "Transforming Growth Factor-Beta: Its Effect on Phenotype
Reexpression by Dedifferentiated Chondrocytes on the Presence and Absence
of Osteogenin," In Vitro Cell. Dev. Biol., 28A: 445-448 (1992).
Luyten, et al., "Insulin-like Growth Factors Maintain Steady-State
Metabolism of Proteoglycans in Bovine Articular Cartilage Explants,"
Achives of Biochemistry and Biophysics, 267: 416-425 (1988).
Sah, et al., "Differential Effects of bFGF and IGF-1 on Matrix Metabolism
in Calf and Adult Bovine Cartilage Explants," Archives of Biochemistry and
Biophysics, 308: 137-147 (1994).
Sah, et al., "Differential Effects of Serum, Insulin-like Growth Factor-I,
and Firboblast Growth Factor-2 on the Maintenance of Cartilage Physical
Properties During Long Term Culture," Journal of Orthopaedic Research, 14:
44-52 (1996).
Verbruggen, et al., "Standardization of Nutrient Media for Isolated Human
Articular Chondrocytes in Gelified Agarose Suspension Culture,"
Osteoarthritis and Cartilage, 3: 249-259 (1995).
Massague, et al., "Stimulation by Insulin-like Growth Factors is Required
for Cellular Transformation by Type Beta Transforming Growth Factor," The
Journal of Biological Chemistry, 260: 4551-4554, (1985).
Rosselot, et al., "Effect of Growth Hormone, Insulin-like Growth Factor I,
Basic Fibroblast Growth Factor, and Transforming Growth Factor Beta on
Cell Proliferation and Proteoglycan Synthesis by Avian Postembryonic
Growth Plate Chondrocytes," Journal of Bone and Mineral Research, 9:
431-439 (1994).
Qingqing, Gong and Pitas, Robert E., "Synertistic Effects of Growth Factors
on the Regulation of Smooth Muscle Cell Scavenger Receptor Activity," The
Journal of Biological Chemistry, 270: 21672-21678 (1995).
Frazer, et al., "Studies on Type II Collagen and Aggrecan Production in
Human Articular Chondrocytes In Vitro and Effects of Transforming Growth
Factor-Beta and Interleukin-1Beta," Osteoarthritis and Cartilage, 2:
235-245 (1994).
Galera, et al., "Transforming Growth Factor-Beta1 (TGF-Beta1) Up-Regulation
of Collagen Type II Primary Cultures of Rabbit Articular Chondrocytes
(RAC) Involves Increased mRNA Levels Without Affecting mRNA Stability and
Procollagen Processing," Journal of Cellular Physiology, 153: 598-606
(1992).
Butterwith, S.C. and Goddard, C., "Regulation of DNA Synthesis in Chicken
Adipocyte Precursor Cells by Insulin-Like Growth Factors, Platelet-Derived
Growth Factor and Transforming Growth Factor-Beta," Journal of
Endocrinology, 131: 203-209 (1991).
Zimber, et al., "TGF-Beta Promotes the Growth of Bovine Chondrocytes in
Monolayer Culture and the Formation of Cartilage Tissue on
Three-Dimensional Scaffolds," Tissue Engineering, 1: 289-300 (1995).
van der Kraan, et al., "Differential Effect of Transforming Growth Factor
Beta on Freshly Isolated and Cultured Articular Chondrocytes," The Journal
of Rheumatology, 19: 140-145 (1992).
Tesch, G.H., et al, "Effects of Free and Bound Insulin-Like Growth Factors
on Proteoglycan Metabolism in Articular Cartilage Explants," J. Orthop.
Res., 10: 14-22 (1992).
Freshney, "Serum Free Media," Culture of Animal Cells, John Wiley & Sons,
New York, 91-99 (1994).
|
Primary Examiner: Lankford, Jr.; Leon B.
Parent Case Text
CROSS-REFERENCE TO RELATED APPLICATIONS
This application is related to and claims the benefit of provisional
application Ser. No. 60/022,810, filed Jul. 25, 1996, provisional
application Ser. No. 60/022,711, filed Jul. 26, 1996, and provisional
application Ser. No. 60/022,801, filed Jul. 25, 1996.
Claims
The invention claimed is:
1. A method for enhancing the rate of re-differentiation of passaged,
de-differentiated, human articular chondrocytes, comprising the step of
culturing said passaged, de-differentiated chondrocytes in a medium
supplemented with TGF-.beta. and a growth factor selected from the group
consisting of: IGF and insulin.
2. The method of claim 1, wherein the TGF-.beta. is TGF-.beta.1.
3. The method of claim 1, wherein the TGF-.beta. is TGF-.beta.2.
4. The method of claim 1, wherein the TGF-.beta. is present at 0.2 to 5.0
ng/ml.
5. The method of claim 1, wherein the growth factor is insulin.
6. The method of claim 1, wherein the growth factor is IGF.
7. The method of any one of claims 1-6, wherein the medium is defined.
8. The method of claim 5, wherein the insulin is supplied by ITS.
9. The method of claim 7, wherein the defined medium further comprises
human serum albumin.
10. The method of claim 5, wherein the medium is defined and comprises DME,
human serum albumin, insulin and TGF-.beta..
11. A composition comprising passaged, de-differentiated human articular
chondrocytes in a medium supplemented with TGF-.beta. and a growth factor
selected from the group consisting of: IGF and insulin.
12. The composition of claim 11, wherein the TGF-.beta. is TGF-.beta.1.
13. The composition of claim 12, wherein the TGF-.beta. is TGF-.beta.2.
14. The composition of claim 12, wherein the TGF-.beta. is present at 0.2
to 5.0 ng/ml.
15. The composition of claim 11, wherein the growth factor is insulin.
16. The composition of claim 11, wherein the growth factor is IGF.
17. The composition of any one of claims 11-16, wherein the medium is
defined.
18. The composition of claim 14, wherein the insulin is supplied by ITS.
19. The composition of claim 16, wherein the defined medium further
comprises human serum albumin.
20. The composition of claim 15, wherein the medium is defined and
comprises DME, human serum albumin, insulin and TGF-.beta..
Description
BACKGROUND OF THE INVENTION
Initially, the successful culture of mammalian cells in vitro required
supplementation of growth medium with serum which provides hormones and
growth factors necessary for cell attachment and proliferation. Although
serum is still widely used for mammalian cell culture, there are several
problems associated with its use (Freshney, Serum-free media. In Culture
of Animal Cells, John Wiley & Sons, New York, 91-99, 1994): 1) serum
contains many unidentified or non-quantified components and therefore is
not "defined"; 2) the composition of serum varies from lot to lot, making
standardization difficult for experimentation or other uses of cell
culture; 3) because many of these components affect cell attachment,
proliferation, and differentiation, controlling these parameters, or
studying the specific requirements of cells with respect to these
parameters, is precluded by the use of serum; 4) some components of serum
are inhibitory to the proliferation of specific cell types and to some
degree may counteract its proliferative effect, resulting in sub-optimal
growth; and 5) serum may contain viruses which may affect the outcome of
experiments or provide a potential health hazard if the cultured cells are
intended for implantation in humans.
Primarily for research purposes, there has been some effort to develop
biochemically defined media (DM). DM generally includes nutrients, growth
factors, hormones, attachment factors, and lipids. The precise composition
must be tailored for the specific cell type for which the DM is designed.
Successful growth in DM of some cell types, including fibroblasts,
keratinocytes, and epithelial cells has been achieved (reviewed by
Freshney,1994). However, attachment and proliferation of cells in DM is
often not optimal.
One potential application of defined medium is the expansion of
chondrocytes released from adult human articular cartilage for treatment
of cartilage defects with autologous chondrocyte transplantation
(Brittberg et al, New England Journal of Medicine, 331:889-895, 1994).
Because this procedure involves the implantation of expanded chondrocytes
into a patient, it may be desirable to avoid the use of serum or other
undefined components during culture of the chondrocytes. For this
application, the DM would need to sustain proliferation of adult human
articular chondrocytes seeded at low density until confluent cultures are
attained.
Several investigators have reported proliferation of high density
non-articular chondrocytes in DM (Kato et al, Exp. Cell Res., 125:167-174,
1980; Madsen et al, Nature, 304:545-547, 1983; Quarto et al, Bone, 17:588,
1995). Others have reported proliferation of rabbit and human articular
chondrocytes in DM (Boumedienne et al, Cell Prolif., 28:221-234, 1995;
Schwartz, J. Cin. Chem. Clin. Biochem. 24:930-933, 1986). However, in
these cases, chondrocytes were tested for growth in DM at high density
(.gtoreq.20,000 cells/cm.sup.2). Jennings and Ham (Cell Biology
International Reports, 7:149-159, 1983) developed a serum-free medium for
proliferation of chondrocytes isolated from costal cartilage of
prepubertal humans and seeded at low density. That medium required the use
of polylysine-coated plates and included a liposome mixture for which the
authors state that there are "inherent limitations in the degree of
chemical definition".
Attempts to culture articular chondrocytes at sub-confluent densities in DM
have not been successful. Adolphe et al (Exp. Cell Res., 155:527-536,1984)
have developed a DM (Ham's F12 supplemented with insulin, transferrin,
selenite, fibronectin, bovine serum albumin, brain growth factor,
fibroblast growth factor, hydrocortisone, and multiplication stimulating
activity--now known as Insulin-like growth factor II) which supports
proliferation of rabbit articular chondrocytes. However, they report that
serum-containing medium is necessary for the initial attachment of cells
to the tissue culture vessel after seeding.
It has been reported that chondrocytes produce and secrete factors that
promote their own attachment and proliferation (Shen et al, Endocrinology,
116:920-925, 1985). Examples include basic fibroblast growth factor (Hill
et al, Growth Factors, 6:277-294, 1992), insulin-like growth factors
(Froger-Gaillard et al, Endocrinology 124:2365-2372, 1989), transforming
growth factor-.beta. (Villiger, P.M. et al., J. Immunol., 151:3337-3344,
1993), vitronectin, and possibly some unidentified factors that promote
their attachment and proliferation. Because articular cartilage is a
non-vascularized tissue, and the chondrocytes embedded in cartilage have
limited access to systemic growth factors, autocrine stimulation may play
an important role in the maintenance and proliferative capacity of these
cells. To our knowledge, autocrine stimulation of chondrocytes has not
been utilized for the purpose of enhancing the proliferation of human
articular chondrocytes in DM.
During expansion in monolayer in vitro, articular chondrocytes
de-differentiate, decreasing synthesis of matrix molecules normally
produced by differentiated articular chondrocytes. It has been shown that
for cells expanded in serum-containing medium, this process can be
reversed by transferring cells to a suspension culture system in the
presence of serum (Benya and Shaffer, Cell, 30:215-224, 1982). If cells
expanded in DM in monolayer are intended for implantation for healing of
cartilage defects (Brittberg et al, 1994), it is important to demonstrate
they retain the potential to redifferentiate in suspension culture. A
standard procedure for testing for redifferentiation potential is to
suspend cells expanded in monolayer into agarose and test for deposition
of sulfated glycosaminoglycans by staining with safranin-.largecircle..
A need exists to standardize and control the proliferation and
differentiation of adult human articular chondrocytes (HAC) cultured for
any medical application, especially for application in humans.
SUMMARY OF THE INVENTION
One object of the present invention is based upon the development and use
of a defined cell culture medium (serum-free) comprising a supplement
mixture, a component mixture, a vitamin mixture, an inorganic salt mixture
and amino acid mixture that avoids the problems inherent in the use of
serum. In particular, the defined medium is useful in culturing
fibroblasts, especially chondrocytes.
Another object of the present invention is to claim a method for enhancing
the differentiation of chondrocytes and for enhancing the synthesis of a
cartilage specific matrix using tumor growth factor beta (TGF-.beta.).
Another object of the present invention is to claim a method for enhancing
the differentiation of chondrocytes using a combination of TGF-.beta. and
IGF.
DETAILED DESCRIPTION OF THE INVENTION
One aspect of the present invention is based upon the development of a
defined cell culture medium and culture method to standardize and control
the proliferation and differentiation of human articular chondrocytes
(HAC) cultured for implantation into humans for repair of articular
cartilage defects.
HAC were first cultured by plating the cells at 3000 cells per cm.sup.2 and
allowing them to attach for one day in Dulbeccos Modified Eagles Medium
(DMEM) supplemented 10% serum, then removing the serum-containing medium
and refeeding with DMEM basal medium in combination with a broad array of
concentrations of the supplements described in Table 1. Every two to three
days thereafter, cells were refed by completely replacing DM with fresh
DM. Unable to induce cells to proliferate under these conditions,
different basal media were tried and found that a 1:1:1 ratio of DMEM:RPMI
1640:Ham's F12 (DRF) when combined with the supplements was effective in
promoting cell proliferation after plating as above. HAC cultured in
DRF+supplements (complete DRF or cDRF) attained a terminal density equal
or greater to the terminal density attained during culture in
serum-supplemented medium. However, during the first several population
doublings when the cell density was low, the proliferation rate was slow
relative to the rate in 10% serum. We demonstrated cell proliferation
without providing the cells with serum for one day prior to addition of
cDRF. However, the initial growth of these cultures was slow and variable.
Further experiments testing alternative supplements and different
concentrations of the supplements failed to produce a cell culture system
that consistently supported vigorous growth of HAC plated directly into DM
without including serum at any step.
We had the idea that if we exchanged only half of the cDRF at refeeding,
instead of completely exchanging the medium, factors secreted by the
chondrocytes would boost their own proliferation. If the HAC secrete
factor(s) required for growth in cDRF, when the cell density is sparse,
the quantity of the secreted factor may be close to the threshold
requirement. This would explain the slow growth in early cultures and the
variable results observed in the above experiments. Using the cDRF medium
combined with the approach of partial refeeding (described below), we
obtained unexpectedly high yields of HAC in the complete absence of serum
or any other undefined component after a brief time in culture. In the
examples shown below, the volume of cDRF used was reduced relative to the
volume of serum-rich medium because presumably this would increase the
concentration of secreted factors in the media and further promote
proliferation. Later experiments indicate that reducing the volume is not
necessary and more optimal results may be achieved by using the larger
volume while maintaining the practice of partial refeeding.
We have demonstrated that HAC cultured in suspension after expansion in
cDRF generate colonies which stain positive with safranin-.largecircle..
This indicates that, during expansion in DM, the cells have not lost their
capacity to produce sulfated glycosaminoglycans, markers of chondrocyte
differentiation. Because they retain their capacity to redifferentiate,
chondrocytes expanded in cDRF may be suitable for autologous implantation
for the purpose of healing cartilage defects.
Composition of cDRF
The culture medium, named cDRF, is composed entirely of commercially
available and chemically defined basal media and growth supplements. cDRF
is a modification of the DM developed by Adolphe et al (1984). As
supplements to the basal media, we have discovered that insulin transferin
selenium (ITS) purchased from Collaborative Biomedical Products ((CBP)
Bedford, Mass.), hydrocortisone purchased from Sigma (St. Louis, Mo.),
basic fibroblast growth factor (FGF), fibronectin purchased from CBP and
insulin growth factor (IGF), both available from Genzyme Corporation
(Cambridge, Mass.), are particularly useful in achieving the objectives of
the medium described in this disclosure.
TABLE 1
______________________________________
Composition of cDRF
______________________________________
DMEM 33%
RPMI 33%
HAM'S F-12 33%
Supplements:
ITS 1%
Penicillin & 100 U/ml
Streptomycin 100 ug/ml
Hydrocortisone 40 ng/ml
Basic FGF, human 10 ng/ml
IGF-I, human 1 ng/ml
Fibronectin, human 5 ug/ml
______________________________________
Method of preparation of cDRF
All materials are reconstituted, diluted, and stored as recommended by
supplier. The three basal media, DMEM purchased from Gibco BRL, Grand
Island, N.Y., Cat# 11965-084 (Table 2), RPMI DMEM purchased from Gibco
BRL, Cat# 11875-051 (Table 2) and Ham's F12 purchased from Gibco BRL,
Cat#11765-021 (Table 2), are combined in a 1:1:1 ratio referred to
hereinafter as DRF (Table 3). ITS, penicillin/streptomycin purchased from
BioWhit-taker, and hydrocortisone are diluted into DRF and this medium is
stored up to 2 weeks at 2-8.degree. C. Basic FGF, IGF, and Fibronectin are
diluted into the complete DRF medium (cDRF) on the day of use for cell
culture.
TABLE 2
______________________________________
Commercial Mediums
DMEM RPMI HAM'S F-12
1X Liquid 1X Liquid 1X Liquid
mg/L mg/L mg/L
______________________________________
Inorganic Salts:
CaCl.sub.2 (anhyd.) 200.00 33.22
Ca(NO.sub.3).sub.2.4H.sub.2 O 100.00
CuSO.sub.4.5H.sub.2 O 0.0024
Fe(NO.sub.3).9H.sub.2 O 0.10
FeSO.sub.4.7H.sub.2 O 0.83
KCl 400.00 400.00 223.60
MgSO.sub.4 (anhyd.) 97.67 48.84
MgCl.sub.2 (anhyd.) 57.22
NaCl 6400.00 6000.00 7599.00
NaHCO.sub.3 3700.00 2000.00 1176.00
NaH.sub.2 PO.sub.4.H.sub.2 O.sup.a 125.00
Na.sub.2 HPO.sub.4 (anhyd.) 800.00 142.00
ZnSO.sub.4.7H.sub.2 O 0.86
Other Components
D-Glucose 4500.00 2000.00 1802.00
Glutathione (reduced) 1.00
Hypoxanthine.Na 4.77
Linoleic Acid 0.084
Lipoic Acid 0.21
Phenol Red 15.00 5.00 1.20
Putrescine 2HCl 0.161
Sodium Pyruvate 110.00
Thymidine 0.70
Amino Acids:
L-Alanine 8.90
L-Arginine 200.00
L-Arginine.HCl 84.00 211.00
L-Asparagine.H.sub.2 O 15.01
L-Asparagine (free base) 50.00
L-Aspartic Acid 20.00 13.30
L-Cystine.2HCl 63.00 65.00
L-CysteineHCl.H.sub.2 O 35.12
L-Glutamic Acid 20.00 14.70
L-Glutamine 584.00 300.00 146.00
Glycine 30.00 10.00 7.50
L-Histidine.HCl.H.sub.2 O 42.00 21.00
L-Histidine (free base) 15.00
L-Hydroxyproline 20.00
L-Isoleucine 105.00 50.00 4.00
L-Leucine 105.00 50.00 13.10
L-Lysine.HCl 146.00 40.00 36.50
L-Methionine 30.00 15.00 4.50
L-Phenylalanine 66.00 15.00 5.00
L-Proline 20.00 34.50
L-Serine 42.00 30.00 10.50
L-Threonine 95.00 20.00 11.90
L-Tryptophan 16.00 5.00 2.00
L-Tyrosine.2Na.2H.sub.2 O 104.00 29.00 7.81
L-Valine 94.00 20.00 11.70
Vitamins:
Biotin 0.20 0.0073
D-Ca pantothenate 4.00 0.25 .50
Choline Chloride 4.00 3.00 14.00
Folic Acid 4.00 1.00 1.30
i-Inositol 7.20 35.00 18.00
Niacinamide 4.00 1.00 0.036
Para-aminobenzoic Acid 1.00
Pyridoxine HCL 1.00 0.06
Pyridoxal HCl 4.00
Riboflavin 0.40 0.20 0.037
Thiamine HCl 4.00 1.00 0.30
Vitamin B.sub.12 0.005 1.40
______________________________________
TABLE 3
______________________________________
DRF
______________________________________
Inorganic Salts:
CaCl.sub.2 (anhyd.) 233.22
Ca(NO.sub.3).sub.2.4H.sub.2 O 100.00
CuSO.sub.4.5H.sub.2 O 0.0024
Fe(NO.sub.3).9H.sub.2 O 0.10
FeSO.sub.4.7H.sub.2 O 0.83
KCl 1023.60
MgSO.sub.4 (anhyd.) 146.51
MgCl.sub.2 (anhyd.) 57.22
NaCl 19999.00
NaHCO.sub.3 6876.00
NaH.sub.2 PO.sub.4.H.sub.2 O.sup.a 125.00
Na.sub.2 HPO.sub.4 (anhyd.) 942.00
ZnSO.sub.4.7H.sub.2 O 0.86
Other Components
D-Glucose 8302.00
Glutathione (reduced) 1.00
Hypoxanthine.Na 4.77
Linoleic Acid 0.084
Lipoic Acid 0.21
Phenol Red 21.20
Putrescine 2HCl 0.161
Sodium Pyruvate 110.00
Thymidine 0.70
Amino Acids:
L-Alanine 8.90
L-Arginine 200.00
L-Arginine.HCl 295.00
L-Asparagine.H.sub.2 O 15.01
L-Asparagine (free base) 50.00
L-Aspartic Acid 33.30
L-Cystine.2HCl 128.00
L-Cysteine HCl.H.sub.2 O 35.12
L-Glutamic Acid 34.70
L-Glutamine 1030.00
Glycine 47.50
L-Histidine.HCl.H.sub.2 O 63.00
L-Histidine (free base) 15.00
L-Hydroxyproline 20.00
L-Isoleucine 159.00
L-Leucine 168.10
L-Lysine.HCl 222.50
L-Methionine 49.50
L-Phenylalanine 86.00
L-Proline 54.50
L-Serine 82.50
L-Threonine 126.90
L-Tryptophan 23.00
L-Tyrosine.2Na.2H.sub.2 O 140.81
L-Valine 125.70
Vitamins:
Biotin .2073
D-Ca pantothenate 4.75
Choline Chloride 21.00
Folic Acid 6.30
i-Inositol 60.20
Niacinamide 5.036
Para-aminobenzoic Acid 1.00
Pyridoxine HCL 1.06
Pyridoxal HCl 4.00
Riboflavin 0.637
Thiamine HCl 5.30
Vitamin B.sub.12 1.405
______________________________________
Articular cartilage was harvested from femoral condyles of recently
deceased human donors (age range: 29 to 53) within 24 hours of death and
stored in isotonic media for up to 4 days at 2-8.degree. C. Chondrocytes
(HAC) were released from the cartilage by overnight digestion in 0.1%
collagenase/DMEM. Remaining cartilage was further digested for 4 hours in
0.1% collagenase/0.25% trypsin/DMEM. The released cells were expanded as
primaries in DMEM supplemented with 10% Fetal Bovine Serum, 100 U/ml
Penicillin, and 100 ug/ml Streptomycin (serum-rich medium). At near
confluence, cells were frozen in 10%DMSO/40% serum/50%DMEM.
For experiments performed with 2nd passage cells, ampules of frozen
primaries were thawed, rinsed in media indicated below for initial
seeding. For experiments performed in 3rd passage, cells were expanded
through 2nd passage in serum-rich media, harvested by trypsinization, and
washed in seeding media as indicated.
The following disclosure describes the use of collagen matrices and the
cytokine TGF-.beta. to enhance the redifferentiation and cartilage matrix
formation process for dedifferentiated human articular chondrocytes. These
findings are novel in that the application demonstrates how the cytokine
augments the re-expression of the differentiated chondrocyte phenotype for
passaged and dedifferentiated human cells in a matrix rather than simply
supporting the differentiated phenotype for chondrocytes freshly released
from cartilage tissue (primary cells) as others have shown (1,2). For
those that have looked at the cytokine and its effect on re-expression,
none have used it in a collagen matrix. The re-expression work centered on
either rabbit cells in an agarose matrix (3,4) or else the factors effect
on human chondrocyte proliferation (5) and not differentiation
specifically. This disclosure is a first demonstration that the use of the
cytokine can augment the redifferentation of the cells and enhance the
rate at which new cartilage specific matrix is synthesized in the collagen
sponge environment. This should enhance the ability of this system to
regenerate new tissue, support increased mechanical loads and reform the
articular surface.
This disclosure describes a completely defined medium which will permit the
re-expression of CII, a marker for chondrocyte differentiation, in a
suspension of normal adult human articular chondrocytes that have
de-differentiated as a consequence of expansion in monolayer in vitro. It
has been discovered that TGF-.beta.1 or .beta.2 and IGF-I satisfy the
growth factor requirement for this differentiation process. This
combination of growth factors in defined medium is potentially applicable
to improvements in the procedure of chondrocyte autologous transplantation
(Bittberg et al, 1994). It may be used to prime chondrocytes for
differentiation prior to implantation. Alternatively, it may be included
as a supplement at the time of implantation of the chondrocytes. This
growth factor combination may also be used as a
differentiation-stimulating supplement to chondrocytes embedded in a
matrix intended for implantation into cartilage defects.
EXAMPLE 1
To test the concept of partial refeeding with cDRF, we compared chondrocyte
growth by this new method with growth in culture conditions which we were
familiar with: culture in Fetal Bovine Serum (FBS) or culture in cDRF
after one day in FBS with complete refeeding. Human chondrocytes from a 31
year old donor (HC31 cells) at 3rd passage were cultured under the
conditions 1,2 & 3 described below.
Culture Condition 1 (FBS/complete refeeding)
Chondrocytes prepared as described above were seeded in triplicate into 10
cm.sup.2 tissue culture wells at a density of 3,000 cells per cm.sup.2 in
5 ml 10% FBS/DMEM and refed with 5 ml 10% FBS/DMEM one day after seeding
and every 2-3 days thereafter. At each refeeding, all media was removed
and replaced with 5 ml of fresh medium.
Culture Condition 2 (FBScDRF/complete refeeding)
Chondrocytes were cultured as for condition 1 except that after one day in
10% FBS/DMEM, all refeedings were done with cDRF.
Culture Condition 3 (FBS-cDRF/partial refeeding)
Chondrocytes were cultured as for condition 1, except that after one day in
10% FBS/DMEM, all medium was removed and replaced with 3 ml cDRF. At each
refeeding thereafter, partial refeeding was achieved by removing 1.5 ml of
used cDRF and replacing with 1.5 ml of fresh cDRF.
Cells were harvested at 7 and 13 days after seeding and samples were
counted on a hemacytometer. The results in Table 4 show a marked
enhancement of cell yield at 7 days and at 13 days in conditions of
partial refeeding with cDRF compared to that of complete refeeding.
TABLE 4
______________________________________
Example 1 results
Strain HC31, 3rd
passage Cell density
at harvest
Exp 1 Culture conditions (1000's of
Day cells/cm.sup.2 +/- sem)
# 0-1 Days 2-13 Day 7 Day 13
______________________________________
1 10% 10% FBS 77 +/- 7
109 +/- 10
FBS Complete
refeed
2 10% cDRF 29 +/- 1 72 +/- 13
FBS Complete
refeed
3 10% cDRF 103 +/- 9 157 +/- 7
FBS Partial
refeed
______________________________________
EXAMPLE 2
We repeated example 1 but added in one more condition to determine whether
we could eliminate the use of serum during the first day after seeding:
Culture Condition 4 (cDRF/partial refeeding)
Chondrocytes were cultured as for condition 1, except that they were seeded
in 3 ml cDRF instead of 5 ml serum-rich media. At each refeeding, 1.5 ml
of used cDRF was replaced with 1.5 ml of fresh cDRF.
Cells were harvested at 7 days after seeding. The results in Table 5 are
generally similar to the results of example 1 for the three culture
conditions that were repeated. Interestingly, the additional culture
condition, in which direct plating of cells into cDRF was combined with
partial refeeding, yielded a yet higher quantity of cells.
TABLE 5
______________________________________
Example 2 results
Ex 2 Culture
conditions Strain HC31, 3rd passage
Day Days 2- Cell density at Day 7
# 0-1 7 (1000's of cells/cm.sup.2 +/- sem)
______________________________________
1 10% 10% 82 +/- 4
FBS FBS
Complete
refeed
2 10% cDRF 29 +/- 3
FBS Complete
refeed
3 10% cDRF 73 +/- 2
FBS Partial
refeed
4 cDRF cDRF 126 +/- 2
Partial
refeed
______________________________________
EXAMPLE 3
We repeated example 2 with three additional human articular chondrocyte
strains. The results in Table 6 show that partial refeeding consistently
and substantially outperforms complete refeeding (condition 3 vs 2).
Unexpectedly, plating directly into defined medium consistently
outperforms attachment in serum, when partial refeeding is done in both
cases (condition 4 vs 3). With the exception of one strain, partial
refeeeding with defined medium outperforms culture in 10% FBS with
complete refeeding.
TABLE 6
______________________________________
Example 3 results
2nd passage, Cell density at Day 7
Exp 3 Culture conditions (1000's of cells/cm.sup.2 +/- sem)
Day Strain Strain Strain Strain
# 0-1 Days 2-7 HC31 HC53 HC29 HC34
______________________________________
1 10% 10% FBS 88 +/- 4
69 +/- 5
75 +/- 7
53 +/- 3
FBS Complete
refeed
2 10% cDRF 24 +/- 3 40 +/- 1 9 +/- 3 6 +/- 0
FBS Complete
refeed
3 10% cDRF 60 +/- 3 81 +/- 9 40 +/- 7 10 +/- 1
FBS Partial
refeed
4 cDRF cDRF 202 +/- 5 not 88 +/- 4 27 +/- 4
Partial done
refeed
______________________________________
Although there are only results for the 7 day timepoint in examples 2 & 3,
the three examples combined are a strong indication that we can
consistently attain cell densities of >100,000 cells/cm.sup.2 within two
weeks of culture by thawing frozen 1st passage cells, plating directly
into defined medium without serum, and refeeding with half volumes.
EXAMPLE 4
We repeated example 2 again. In addition, we added one other condition to
determine whether the partial refeeding method conferred an advantage to
chondrocytes cultured in FBS:
Culture Condition 5 (FBS/partial refeeding)
Chondrocytes were cultured as for condition 1 except that at each
refeeding, half the media was removed and replaced with fresh media.
The results in Table 7 are again consistent with previous examples showing
a clear advantage of partial refeeding over complete refeeding when cDRF
medium is used. In contrast, when serum-rich media is used, the partial
refeeding method does not increase and may decrease cell yields.
TABLE 7
______________________________________
Example 4 results
Strain HC31, 2nd
passage
Ex 4 Culture conditions Cell density at Day 7
Day (1000's of
# 0-1 Days 2-7 cells/cm.sup.2 +/- sem)
______________________________________
1 10% 10% FBS 77 +/- 2
FBS Complete
refeed
2 10% cDRF 26 +/- 5
FBS Complete
refeed
3 10% cDRF 67 +/- 11
FBS Partial refeed
4 cDRF cDRF 103 +/- 3
Partial refeed
5 10% 10% FBS 49 +/- 2
FBS Partial refeed
______________________________________
EXAMPLE 5
To assess the redifferentiation potential of chondrocytes after their
expansion in monolayer culture in cDRF by the partial refeeding method,
their capacity to form colonies in agarose which bind
safranin-.largecircle. (Saf-.largecircle. positive colonies) was assessed.
Strain HC31 chondrocytes prepared as described above were thawed and
seeded at 2nd passage into 225 cm.sup.2 tissue culture flasks (T225) at a
density of 2,200 cells per cm.sup.2 in 100 ml cDRF per T225. Cells in cDRF
were refed by removing 50 ml (one-half the total volume) and replacing
with 50 ml fresh cDRF. Refeeding was done one day after plating and every
2-3 days thereafter. As a positive control, parallel cultures were plated
in 60 ml 10% FBS/DMEM per T225. Cells in 10% FBS/DMEM were refed by
removing the full volume of used medium and replacing with 60 ml fresh 10%
FBS/DMEM. Four T225s were plated for each condition.
Cells were harvested by trypsinization from two T225's per culture
condition at 12 and 14 days after seeding. At harvest, the cells were
suspended at 2.5.times.10.sup.5 cells per ml in 10% FBS/DMEM and mixed 1:1
with 4% low-melt agarose. Four ml of the cell/agarose suspension were
plated onto a layer of 2 ml solidified high-melt agarose in 60 mm tissue
culture dishes (P60). Platings were done in duplicate or triplicate. After
solidification, the cultures were overlaid with 5 ml 10% FBS/DMEM. The
cultures were refed after 2-3 hours of equilibration and every 2-3 days
thereafter until fixation.
After 3 weeks in agarose culture, the cells were fixed in 10% formalin and
stained with safranin-.largecircle.. Saf-.largecircle. positive colonies
of .gtoreq.2 .mu.m diameter were counted using a microscope. For each
corresponding monolayer condition, a total of 10 grids of 4 mm.sup.2 each
were counted randomly from 2 P60s.
The results in Table 8 show that the capacity of HAC expanded in cDRF to
generate Safranin-.largecircle. colonies after suspension in agarose is
not statistically different than that of cells expanded in FBS. The
similarity is clearer in the results from the 14 day monolayer cultures
which have a smaller sampling error. The reduction in the number of
colonies generated after 14 days in monolayer, either FBS or cDRF, may be
the consequence of maintaining the cells in monolayer in a post-confluent
state.
TABLE 8
______________________________________
Differentiation of HAC in agarose
after expansion in cDRF or FBS
# of safranin-O colonies .gtoreq. 2 um
per 10 grids (40 mm.sup.2)
3 weeks after suspension in
agarose
Days in Growth (average of two cultures +/-
monolayer medium s.e.m.)
______________________________________
12 10% FBS 436 +/- 31
cDRF, partial 327 +/- 96
refeed
14 10% FBS 203 +/- 38
cDRF, partial 249 +/- 20
refeed
______________________________________
EXAMPLE 6
Primary chondrocytes were isolated from cartilage tissue from the femoral
head of a 31 year old male. The cells were subcultured in monolayer. At
third passage, the cells were seeded into a type-I collagen sponge matrix
(Instat, Johnson&Johnson) at 10.sup.7 cells/ml and cultured in DME media
supplemented with either 10% fetal bovine serum (serum control), 1%
ITS+media supplement (serum free control) or ITS+with TGF-.beta.1 at 1 or
5 ng/ml ("low dose" or "high dose", Collaborative Biomedical Products,
Bedford, Mass.). The DME media is standardly available, and may preferably
include high glucose without sodium pyruvate. Differentiation state of the
cells was determined by gene expression analysis with RNase protection
(Hybspeed RPA Kit, Austin Tex.) using 32P-labeled mRNA probes for type-I
and type-II collagen and the cartilage specific proteoglycan Aggrecan.
Matrix deposition was studied by use safranin-.largecircle./fast green
stain as well monoclonal antibody staining for collagen type-II and
chondroitin sulfate. mRNA analysis of monolayer cells demonstrates type-I
collagen expression with trace type-II and Aggrecan expression for the
chondrocytes at the time of seeding. Upregulation of type-II collagen with
concurrent downregulation of type-I collagen expression was consistently
observed for samples cultured in high dose TGF-.beta. supplemented and
serum control cultures. In serum free and low dose TGF-.beta. conditions
only modest type-I collagen downregulation is observed. This concurrent
expression behavior for type-I and type-II collagens is consistent with
re-expression of the differentiated chondrocyte phenotype. By 4-weeks, an
enhanced level of re-differentiation as shown by RNase protection, was
observed for samples cultured in high dose TGF-.beta. culture over the
other groups. 8-weeks there was extensive proteoglycan staining throughout
the thickness of the matrix for samples cultured in high dose TGF-.beta.
conditions demonstrated by both immuno- and histologic staining. For low
dose TGF-.beta. and for serum and serum free controls, new matrix staining
was relegated to the periphery or isolated pockets within the sponge
matrix. This study demonstrates that passaged human chondrocytes can
re-express their differentiated phenotype in the type-I collagen sponge
environment. The level of re-differentiation was demonstrated both at the
genetic expression and at the matrix deposition level. TGF-.beta.
modulated this process by enhancing the rate of redifferentiation and the
amount of new matrix deposition.
EXAMPLE 7
Confluent or near-confluent third passage adult human femoral condyle
chondrocytes were harvested by trypsinization and suspended in alginate
beads at a density of 10.sup.6 cells/ml. For each example described below,
cells in alginate were cultured at 37.degree. C., 9% CO.sub.2, in 25 mM
HEPES buffered DMEM supplemented with 100U/ml penicillin, 100 .mu.g/ml
streptomycin (basal medium), and additional supplements as indicated.
Storage and dilution of supplements were performed as recommended by
suppliers. For each culture, 8 ml of alginate beads (8 million cells) were
incubated in a 150 cm.sup.2 flask in 40 ml of the indicated media.
Cultures were re-fed every 2-3 days. At timepoints indicated, cells were
released from alginate, pelleted, frozen and stored. RNA was isolated from
the cell pellets and quantitated. The effect of the different culture
conditions on the abundance of for collagen type I (CI) , collagen type II
(CII), aggrecan (Agg) mRNAs was determined by the Rnase protection assay,
using 18 S rRNA (18 S) detection as an internal standard. The RNA probes
used in the Rnase protection assay were transcribed from templates
containing cDNA segments of the human genes for CI, CII, Agg, and 18 S.
The culturing of cells in alginate was done according to Guo, et al.,
Connective Tissue Research, 19: 277-297, 1989. The isolation of RNA was
done according to manufacturer's instructions using the Qiashredder.TM.
and RNeasy.TM. kits purchased from Qiagen (Chatworth, Calif.). Rnase
Protection assays were performed according to manufacturers instructions
using Hybspeed.TM. RPA kit purchased from Ambion (Austin, Tex.).
Alginate culture and RNase protection assay protocols
OUTLINE
I. Expansion of chondrocytes in monolayer (1-2 weeks)
II. Culture of chondrocytes in alginate (1 week-6months)
A. Inoculation of cells into alginate beads
B. Refeeding
C. Harvesting cells from alginate beads
STOP POINT
III. Isolation, quantitation and aliquoting of cellular RNA (1-2 days; 1
day per set of RNA preps)
A. Isolation
B. Quantitation
C. Aliquoting
STOP POINT
D. Visualization of RNA samples on agarose gels (evaluation of RNA
degradation)
STOP POINT
IV. RNase protection assays (1-5 days)
A. Preparation of specific cDNA templates with T7 promoter in antisense
orientation (performed by FB)
Day 1
B. In vitro transcription from cDNA to prepare antisense radioactive RNA
probes from cDNAs, followed by Dnase treatment to remove cDNA template
(should be done within 3 days of Hybrization step, preferably the day
before)
C. Gel purification of radioactive probes
D. Co-precipitation of cellular RNA with antisense probes (should be done
the day before Hybrization step)
Day 2
E. Hybrization of cellular RNA with antisense probes and RNase treatment to
remove ssRNA
F. Electophoresis of protected RNA
G. Quantitation on phosphimager
For R& D studies of chondrocyte differentiation, we cultured chondrocytes
in alginate beads followed by detection of chondrospecific gene expression
using RNase protection assays. The procedures, written in detail below,
are derived from the following sources;
Alginate culture: Guo et al (1989) Connective Tissue Research 19:277-297
RNA isolation: Handbook from RNeasy Total RNA Kit (Qiagen, Cat # 74104)
In Vitro Transcription: Instruction Manual from MAXIscript T7 In Vitro
Transcription Kit (Ambion, Cat # 1314)
RNase Protection Assay: Instruction Manual from HybSpeed RPA kit
(Ambion,Cat # 1412)
DETAILED PROTOCOLS
I. Culture of chondrocytes in alginate (1 week-6 months)
A. Inoculation of cells into alginate beads
Materials
Monolayer cultures of chondrocytes, >8 million cells per 8 ml alginate
culture to be inoculated PBS, 20 mt/T150
Trypsin/EDTA (T/E), 20 ml per T150
DMEM 10% FBS for washing trypsinized cells, 30 ml per T150
0.15 M NaCl/25 mM HEPES, pH 7.4 (Isotonic Salt Solution),
.about.30 ml per T150 flask of monolayer cells+.about.200 ml per 8 ml
alginate culture 1.2% alginate/0.15% NACl/25 mM HEPES, pH 7.4,warmed to
RT, 8 ml per alginate culture
Recipe (per 100 ml):
Position a glass beaker containing 100 ml Isotonic Salt Solution under a
Polytron mixer. Insert the end of the Polytron in the solution and run at
high speed while very slowly adding 1.2 grams of alginate (Improved
Kelmar, from Kelco) and moving the beaker. After the alginate appears to
be complete dissolved (.about.10-15 minutes), add magnetic stirbar and
stir for .about.30 minutes. Autoclave 30 minutes, then run through 0.45
micron filter then 0.22 micron filter and store for up to six months in
the refrigerator.
0.1 M CaCl.sub.2 /25 mM HEPES, pH 7.4, 80 ml per 8 ml alginate culture
Medium for culture of chondrocytes in alginate, 40 ml per 8 ml alginate
culture
Note: the basal medium affects the stability of the alginate beads; if
using something other than DME as basal media, preliminary tests need to
be done to test bead stability. See Guo et al (1989) Connective Tissue
Res. 9:277
22 gauge needles and 10 ml syringes, one per alginate culture
25 mM HEPES -buffered DMEM, 120 ml per 8 ml alginate culture
T75 tissue culture flasks, one per alginate culture
Plastic bottle for suspension of cells in NaCl, one for each set of
alginate cultures, maximum of 6 alginate cultures per set (capacity of
.about.50-60 ml per monolayer T150 culture).
125 ml bottles, 1 per alginate culture
70 micron filters, 1 per alginate culture
Procedures
To avoid prolonged exposure of cells to 0.1 M Ca Cl.sub.2, prepare only
.about.6 alginate cultures (.about.48 million cells) at one time from
monolayer culture
1)Prepare all materials listed above and prewarm EXXXX and growth media
2)warm T/E, 20 ml per T150 to be harvested
3)Aspirate media from each T150 monolayer flask, add 20 ml PBS to each, and
aspirate
4)Add 20 ml T/E per T150, incubate .about.2 minutes, suspend cells, rinse
bottom of flask with 30 ml DMEM 10%FBS
5)Transfer to conical tube, pellet cells, resuspend each in 25 ml Isotonic
Salt Solution, and combine into one plastic bottle
6) Rise the empty tubes in series with 30 ml Isotonic Salt Solution and add
to cell suspension
Note total volume of cell suspension
7)Take .about.1 ml sample of cells to count on hemacytometer and fill four
hemacytometer wells
8)RECORD cell yield and density of monolayer cultures at time of harvest
9)distribute 8 million cells into each 50 ml conical tubes (one per
alginate culture or timepoint(and pellet 8 minutes at 1000 rpm
10)From one tube, aspirate sup, label T=0, immerse in liquid nitrogen, and
freeze cell pellet immediately at -80.degree. C. (for RNA sample of
monolayer culture)
11)add 8 ml 1.2% alginate solution to each remaining cell pellet and
resuspend by pipetting up and down about 30 times (do not introduce air
bubbles.)
12) For each cell/alginate suspensions:
(i) mix again by pipetting up and down five times and transfer the
suspension into a 10 ml syringe fitted with a 22 gauge needle, using a 10
ml pipette.
(ii) cover with plunger, invert, and remove air by depressing plunger and
tapping to remove bubbles
(iii) cover with plunger, invert, and remove air by depressing plunger and
tapping to remove bubbles
(iv) allow alginate beads to cure for 5-15 minutes at RT, no longer than
this.
(v) pour CaCl.sub.2 through 70 .mu.m filter into waste bucket, and wash
2.times. with 100 ml Isotonic Salt Solution, and 2X with 60 ml DMEM using
70 .mu.m filter and waste bucket
13) Resuspend each tube of beads into 20 ml of respective media and
transfer to labelled T162, then rinse remaining beads into flask with
another 20 ml. (.about.8 million cells per T162, or somewhat less as
.about.1 ml is lost during transfer into syringe)
14) place loosely capped flasks in incubator.
B. Refeeding, every 2-3 days
For each alginate culture:
1) Stand flask on end, and tilt to allow beads to settle in one corner of
flask.
2) With 50 ml pipet, remove media from above the beads (.about.25-30 ml)
3) Place 50 ml pipette tightly against bottom end of the flask, and slowly
lay flask flat on its end.
4)Withdraw all media from flask into pipet, maintaining contact between
pipet tip and bottom of flask to avoid drawing beads into pipet.
5) Lift pipet above surface of media and examine for beads settling to tip
of pipet. Dispel any beads that may be settled in pipet tip.
6) Discard media into bucket
7) Add 40 ml fresh prewarmed media to beads
8) Repeat for next culture. USE SEPARATE PIPET FOR EACH CULTURE
C. Harvesting cells from alginate beads and:
i) determine cell yields
ii) snap freeze cell pellets for RNase protection assay
iii) prepare cytospin slides for antibody staining
Materials, quantity per alginate culture
labelled 50 ml conical tubes, I
50 ml pipettes, 1
70 micron-pore filters, 1
0.15 M Na Cl/25 mM HEPES, p H 7.4-175 ml
55 mM Na Citrate/100 mM Na Cl/25 mM HEPES<p H 7.4.about.45 ml microfuge
tubes for samples for counting (labelled for each culture), 1
Trypsin/EDTA std working solution, 100 .mu.l
hemacytometers, 1
labelled 15 ml tubes for cytospin aliquots, 1
cytospin loading and slide assembly, labelled .gtoreq.6
4% paraformaldehye, 200 ml (use within one week, store tightly capped at
4.degree. C.)
Note: paraformaldehye is toxic
To prepare 200 ml:
i)in fume hood, warm 200 ml PBS+200 .mu.l 2N Na OH to 70-75.degree. C. on
hot stir plate; do not heat above 80.degree. C.
ii) Turn off heat, add 8 g paraformaldehyde and stir with magnetic stir bar
until solution becomes clear (less than one hour) Be sure to clean up any
paraformaldehyde dust.
iii) test pH; pH should be between 7 & 7.5
iv) filter through Whatman paper #1 in fume hood
70% EtOH, 200 ml
PBS, 200 ml
Holders for submerging cytospin slides
Holders for storing cytospin slides
Methods
1) photograph beads under microscope
2) transfer cells of each flask to separate 50 ml conical tube, using 30 ml
pipets
3) wash 3.times..sub.-- WITH 0.15 m nAcL/25 Mm HEPES
i)Drain liquid into waste bucket using 70 micron filter
ii)Add 0.15M NaCl/25 mM HEPES to 45 ml mark on conical tube by pouring
iii) Repeat draining and pouring 2 more times, and drain once more.
4)add 55 mM NaCitrate/100 mM NaCl/25 mM HEPES to 50 ml mark and repeatedly
invert gently for 5-8 minutes (for .about.one minute after beads become
undetectable by eye).
5) centrifuge 8 min at 1000 rpm in tabletop IEC (or Mistral) centrifuge
6) aspirate sup and resuspend in 20 ml 0.15 M NaCl/25 m M HEPES.
7) mix well, transfer 100 .mu.l into microfuge tube containing 100 .mu.l
T/E for counting (step 11) and place tubes in 37.degree. C. water bath
8) count cells (from step 7, two hemacytometer wells/sample)--cell samples
from cultures not to be put on cytospin can be counted after last step
RECORD CELL COUNTS
cell yield per culture+(counts/5 fields)
(20)(2)(10.sup.4)/5=(counts/5 fields)(80,000)
9) aliquot cells from each culture into 15 ml tubes for cytospin, enough
for 50,000 cells per slide, at least six slides per culture
10) add 30 ml 0.15 M Na Cl/25 mM HEPES to step 6 suspension
11) centrifugation at 1000 rpm for 8 minutes
12) aspirate sup and IMMEDIATELY freeze cell pellet at -80.degree. C.
Ideally, it is better to snap-freeze cells in liquid nitrogen or dry
ice/ethanol bath, and then move to -80.degree. C. for storage. Slow
freezing may lead to degradation of cellular RNA
13) dilute aliquots of cells for cytospin to 50,000 cells/500 .mu.l
14) load 500 .mu.l sample (50,000 cells) into each cytospin loading device
(at least six samples per cell culture)
15) Spin cyospin devices at 800 rpm for 5 minutes (Program #1)
16) Air dry for 1-2 minutes in tissue culture hood
17) Fix in 4% paraformaldehyde for 5 minutes
18) Drain slides and transfer to PBS for 2 minus
19) Drain slides and transfer to 70% EtOH for 3 minutes
20) Air dry in hood for 15 minutes or until completely dry.
21) Store at -80.degree. C. Upon thawing, fix in 4% formaldehyde for 2 min
and rinse with PBS.
STOP POINT: RNA within cell pellet stored at -80.degree. C. should be
stable "indefinitely"
III. Isolation, quantitation, aliquoting, and get electrophoresis of cellar
RNA (1-2 days; 1 day per set of RNA preps)
Materials for isolation, quantitating, and aliquoting quantity per RNA prep
Gloves
Autoclaved, labelled microfuge tubes, 1
RNeasy Total RNA Kit, Qiagen
Lysis buffer RLT: 600 .mu.l
2 ml collection tubes, labelled:1
spin columns in 2 ml collection tubes, 1
Wash buffer RW1: 700 .mu.l
Wash buffer RPE concentrate: 200 .mu.l (or 1 ml if already diluted with
ethanol)
1.5 ml collection tubes, labelled: 1
Beta mercaptoethanol (BME), 6 .mu.l
QIA shredder in 2 ml collection tube (Qiagen), 1 units
70% ethanol/30% DEPC-treated H.sub.2 O, 600 .mu.l
100% Ethanol, 800 .mu.l (for diluting RPE concentrate, unless RPE is
already diluted)
DEPC -treated dH.sub.2 0/0.1 mM EDTA, 50-200 .mu.l (depending on yield of
RNA)
Rnase-free pipet tips with aerosol barrier for P2, P20, P200 and P1000
650 .mu.l presiliconized, Rnase-free microfuge tubes (Sorenson), 5
Screw-cap microfuge tubes for storage: 1
Spectrophotometer and UV Silica Ultra Microcell (Beckman Cat# 514261)
Capillary UV "cuvettes", 0.5 mm pathlength (Beckman Cat# 514262)
Procedures
A. Isolation
1) Review notes p7 of RNeasy handbook (attached); This includes important
notes regarding prevention of RNA degradation, handling of kit components,
and limitations of the RNeasy kit
2) Label tubes/columns for tracking of RNA samples throughout procedure;
1.5 ml autoclaved microfuge tubes for initial transfer of cells/lysis
buffer suspension, 1 per RNA sample
QIA shredder columns in 2 ml collection tubes, 1 per RNA sample
RNeasy spin columns in 2 ml collection tubes, 1 per RNA sample
2 ml collection tubes from RNeasy kit, 1 per RNA sample
1.5 ml collection tubes from RNeasy kit, 1 per RNA sample
650 .mu.l Rnase free presiliconized tubes for storage of RNA aliquots in
dH.sub.2 0/EDTA, 5 per RNA sample
screw-cap microfuge tubes for storage of RNA in Et-OH, 1 per RNA sample
Label container for storage of samples at -80.degree. C.
3) Add 10 .mu.l BME per ml Lysis Buffer RLT from RNeasy kit Lysis Buffer
RLT may form precipitate upon storage. Warm to redissolve.
4) Lysis and homogenmization of cells: (RNeasy step 1b and 2) Remove cell
pellets from -80.degree. C. (See Harvesting cells from alginate beads)
Immediately add 600 .mu.l RLT buffer+BME (step 4) directly to each cell
pellet; allowing cells to thaw without first adding lysis buffer can lead
to RNA degradation.
Mix by pipetting and transfer to labelled 1.5 ml microfuge tubes Vortex
each tube 30 seconds at high speed
Spin in microfuge momentarily
Mix briefly with pipet and transfer to QIA shredder
Spin at full speed in microfuge for 1 minute. If insoluble materials is
visible in lysate (flowthru), microfuge lysate for 3 minutes at full speed
and use only the supernatent for remaining steps. This second
microfugation has not bee n necessary to date.
5) RNeasy step 3:
Add 1 volume (600 .mu.l) 70% ethanol/DEPC-dH.sub.2 0 per sample and mix by
pipetting. This lysate must not be centrifuged.
6) Application of cell lysate to spin column: (RNeasy step 4)
Transfer 600 .mu.l of lysate to RNeasy spin column. Microfuge 15 seconds at
10,000 rpm (.about.8,000.times.g). Discard flow-thru. Transfer remaining
lysate into the same column and microfuge as above.
7) Purification of RNA in Spin Column: (RNeasy step 5)
Add 700 .mu.l Wash Buffer RW1 into spin column, centrifuge as above and
discard flow-thru. According to the trouble-shooting guide (p 23 of Rneasy
manual), allowing the column to sit for 5 minutes after addition of RW1
and before centrifuging may reduce DNA contamination
8) Further purification of RNA in Spin Column: (RNeasy step 6 & 7):
Combine 1 volume of Wash Buffer RPE concentrate (RNeasy kit) with 4 volumes
of 100% ethanol (RT), unless RPE buffer has already been diluted with
ethanol
Transfer the spin column used above into a new 2 ml collection tube;
RNA is still in column. Add 500 .mu.l of Wash buffer RPE/Ethanol (1:4) to
spin column.
Microfuge as above
Discard flow through
Add 500 .mu.l Wash buffer RPE/Ethanol (1:4) again to same spin column
Microfuge 2 minutes at full speed
Discard flow thru and collect on tube. Inspect for ethanol on outside of
spin column and remove with kimwipe if necessary. Residual ethanol may
interfere with subsequent steps. Transfer the spin column used above to a
1.5 ml collection tube supplied with kit.
9) Elution of RNA from spin column: (RNeasy step 8)
Carefully add 30 .mu.l DEPC-treated water/0.1 mM EDTA per sample directly
to membrane of the spin column, without touching the membrane with the
pipet tip but making sure that the entire membrane is wetted
Microfuge for 60 seconds at 8.000.times.g
Repeat above elution, using 20 .mu.l DEPC-treated water/0.1 .mu.mM EDTA and
using the same spin column and collection tube, to yield an RNA eluate
totaling 50 .mu.l
Place all samples on ice during Quantitation and aliquoting.
B. Quantitation of RNA by UV absorbance at 260
1) Transfer 3 .mu.l each RNA sample 57 .mu.l DEPC-treated H.sub.2 0
(20-fold dilution)
(2) Read samples against DEPC-treated H.sub.2 0 blank in short (60 .mu.l
volume) 1 cm pathlength quartz cuvette (available on 4thflr. 1 MTN RD) at
260 and 280 nm.
RECORD readings
10.D unit @ 260 nm, 1 cm pathlength+40 ug/ml RNA, and translates to 800
.mu.ml after accounting for the 20-fold dilution.
This reading would correspond to a total yield of 40 .mu.pg for a 50 .mu.l
sample.
My yields have typically ranged from .about.8-80 .mu.g from 8 ml alginate
cultures, depending on the conditions of culture. However, since I have
done these preps, the methods for harvesting cells from alginate have been
modified with the intention of improving cell yield (specifically, the
g-force during centrifugation of cells after dissolving alginate beads has
been increased .about.5-fold).
A.sub.260 /A.sub.280 +1.7 to 2.0 indicates "highly pure" RNA, 2.0 is ideal.
Lower ratios indicate the presence of protein contamination. Typically,
the ratio is near 2.0. Readings at 320 nm indicate presence of
carbohydrate.
C. Aliquoting
1) For RNA concentrations above 500 .mu.l/ml, dilute to 500 .mu.g/ml by
adding DEPC-dH.sub.2 0/0.1 mM EDTA. Record final concentration.
2) For each RNA sample, calculate the volume that is equivalent to 1.0
.mu.g.
3) Make 5 aliquots of 1.0 .mu.g each into 650 .mu.l presiliconized,
Rnase-free microfuge tubes.
4) Transfer remaining RNA, if any, to screwtop Rnase-free 1.5 ml microfuge
tubes, add 1/10th volume 1% SDS and .gtoreq.2.5 volumes 100%
Et-OH, vortex, and store at -80.degree. C.
5) Record all aliquot volumes and concentrations
6) Store all aliquots at -80.degree. C.
Notes
i) 1.0 .mu.g RNA aliquots in DEPC-dH20/0.1 mM EDTA: For visualization of
RNA on agarose gels or for Rnase Protection Assays, 1.0 .mu.g or less RNA
is adequate. Because of the volume of the aliquots may be small (as little
as 2 .mu.l) and because of possible dessication of samples in freezer, do
not subaliquot the 1.5 .mu.g aliquots stored in aqueous solution until
they have been diluted into larger volumes after thawing. Use the 1.0
.mu.g aliquots once and discard any unused RNA after thawing. According to
the RNeasy Handbook, RNA stored in water at -80.degree. C., or even
-20.degree. C., should be stable for at least a year.
ii) Remaining RNA stored in Ethanol: The samples stored in Ethanol should
allow longer-term stability. This RNA must be treated as a suspension, not
a solution. Before taking any sub-aliquots from these suspensions, they
must be thoroughly vortexed.
Ideally, it is better to precipitate the RNA, remove the ethanol,
redissolve in aqueous solution, and requantitate before using.
STOP POINT
D. Visualization of RNA samples on agarose gels (evaluation of RNA
degradation)
Materials
Agarose, Molecular Biology Grade (SeaKem GTG), 0.4 g per gel, 14 samples
per gel
37% formalin,
Autoclaved dH.sub.2 0, .about.250 ml per gel
10.times. MOPS,
Components
0.2M MOPS
50 mM sodiumacetate
10 mM EDTA
pH should be 7
autoclaved
Electrophoresis apparatus and tray (.about.30 ml gel capacity), combs (14
teeth, thick), power supply
RNA samples, one 1.0 .mu.l aliquot each stored at -80.degree. C., up to 13
samples per gel
RNA ladder, 0.24-9.5 Kb @ 1 .mu.g/.mu.l, 2 .mu.l per gel (.about.0.33 .mu.g
of each band)
If precipitation is necessary:
DEPC-H20/0.1 mM EDTA
DEPC-H20/0.1 mM EDTA, 3M NaAcetate, pH 5.2.about.50 .mu.l
100% Et-IH, RT
Vacuum dessicator
Heating block for 650 ul tubes, 65.degree. C. long-tipped pippetman tips
and pasteur pipet (for drying RNA pellets)
1.times. RNA loading buffer, up to 12 .mu.l per sample
Recipe
0.75 ml formamide (stored at -200.degree. C.)
0.15 ml 10.times. MOPS
0.24 ml 37% formaldehyde
0.1 ml dH20, Rnase free
0.1 ml glycerol
80 .mu.l 10% (w/v) bromophenol blue
1 mg/ml EtBr,
camera/polaroid film/UV box
Procedures
Agarose gel preparation
1) Prepare 40 ml 1% agarose/1.9% formaldahyde/1.times. MOPS gel:
Mix 34 ml autoclaved dH20+4 ml 10.times. MOPS+0.4 g of agarose
Microwave to dissolve agarose and cool to 50.degree. C.
In fume hood, add 2 ml 37% formaldehyde, gently mix, and pour into clean
tray with comb
Allow get to set for .about.30 minutes, adding running buffer as soon as
geling occurs
2) Prepare 250 ml Running buffer per gel: 1.times. MOPS/1.9% formaldehyde
212.5 ml dH20
25 ml 10 MOPS
12.5 ml 37% formaldehyde
Preparation of RNA samples for electrophoresis
3) For 1 .mu.g samples which are 8 .mu.l or less (>125 .mu.g/ml),
Combine 1 .mu.l Ethidium bromide per 18 .mu.l 1.times.RNA Loading Buffer,
and add 1.times.RNA Loading Buffer/EtBr mixture to a final volume of 24
.mu.l.
For all other samples, precipitate (see next step).
4) For 1 .mu.g samples that are more than 4 .mu.l, it is necessary to
concentrate samples by ethanol precipitation:
i) To each RNA sample, dilute to final volume of 18 .mu.l with DEPC-H20/0.1
mM EDTA
ii) Add 2 .mu.l 3 M Na Acetate, vortex, and add 50 .mu.l 100% Et-OH to each
sample.
iii) Vortex again and microfuge at full speed, RT, for 15 minutes. Be sure
to orient tube such that you know where the RNA pellet will be.
iv) Aspirate Sup with long pipet tip, avoiding pellet. Microfuge 30 seconds
full speed to collect residual ethanol, aspirate sup, and dry for 4' in
vacuum dessicator.
v) Combine 1 .mu.l Ethidium bromide per 23 .mu.l 1.times.RNA Loading
Buffer, and add 24 .mu.l to each pellet
5) RNA Ladder: Make one 2 .mu.l aliquot of RNA Ladder for each gel to be
run and add 10 .mu.l 1.times.RNA Loading Buffer
6) Heat all of the RNA samples, including RNA Ladder at 65.degree. C. for 1
minute in heating block, vortex at setting 4-5 for 20 seconds, microfuge
momentarily if sample splashes onto side of tube, heat at 65.degree. C.
for 15 minutes, and snap cool on ice.
Gel Electrophoresis
8) ufuge momentarily, and load 12 .mu.l of each sample per well, loading
RNA Ladder into one well per gel. The quantity loaded will be 0.5 .mu.g
per well except the RNA ladder which will be 2 .mu.g per well (.about.0.33
.mu.g/band). Freeze remainder of samples in case samples need to be rerun.
9) Run gel:
100 Volts, .about.85 mA
Run.about.1 hr (run until bromophenol blue runs.about.2/3 of gel distance)
10) Photo gel on UV box using photobox apparatus with shield (1/8 second,
f-stop=4.5)
Save photo for notebook. The 18S and 28S rRNAs should be clearly visible.
Obvious downward smearing of the rRNA bands is indicative of RNA
degradation. The intensity of the bands should be comparable among
samples, if quantitation and aliquoting were done properly.
STOP POINT
IV RNase protection assays (1-5 days)
A. Preparation of specific cDNAs templates with T7 promoter in antisense
orientation:
Prancois Binette, using PCR technology, has synthesized all the human cDNA
template used in these studies, with the exception of the 18S rRNA gene
which is supplied by Ambion. These cDNAs are linked to .about.20 bp of the
T7 phage promoter oriented to promote synthesis of radioactive RNA from
the human genes in the antisense orientation upon addition of T7 RNA
polymerase and radioactive nucleoside triphosphates. Francois' maps of the
human genes showing the probe positions and sizes are attached.
The human cDNA templates currently available for these experiments include
portions of the genes for:
Collagen Type I: chondrocyte dedifferentiation marker
Aggrecan, Collagen Types II & IX: chondrocyte differentiation markers
Collage Type X: chondrocyte hypertrophy marker
Day 1
B. In vitro transcription from cDNA to prepare antisense radioactive RNA
probes from cDNAs, followed by Dnase treatment to remove cDNA template.
should be done within 3 days of Hybridization step, preferably the day
before
See MAXIscript.TM. (Ambion) Instruction Manual for additional information
on background, kit components, additional procedures, and troubleshooting.
The Rnase Protection Assay can be done using several probes combined, as
long as the probes are different enough in size to allow separation during
electrophoresis. However, each probe must be transcribed in separate tubes
and gel purified from different lanes of the gel before combining for the
Rnase protection assay. In addition to preparing probes from the templates
listed above, the 18S rRNA template should also be transcribed for every
Rnase protection assay. Presumably, the quantity of 18S rRNA is equivalent
among cells, independent of growth conditions, and is therefore a standard
for comparing the amount of total cellular RNA used in the Rnase
Protection Assays. Size marker RNA should also be used in each RNase
Protection Assay. Unlike the other probes, these can be transcribed as
much as 2 months in advance of use and do not need to be gel-purified.
Materials, quantity per probe
From MAXIscript.TM. T7 (Ambion, Cat #1314) in vitro transcription kit (FOR
KITS RECEIVED AFTER Nov. 1, 1995):
10.times.transcription buffer, 2 .mu.l
ATP solution, 10 mM, 1 .mu.l
GTP solution, 10 mM, 1 .mu.l
UTP solution, 10 mM, 1 .mu.l
T7 RNA polymerase (5 U/.mu.l)+RNase Inhibitor (5 U/.mu.l), 2 .mu.l
DNase I (RNase free), 2 U/.mu.l, 1 .mu.l
2.times.Gel Loading buffer, 22 .mu.l:
CTP solution from Ambion MAXIscript kit diluted to 0.05 mM, 3 .mu.l
[alpha-32P]-CTP, 3000 Ci/mmole, 10 mCi/ml, 5 .mu.l (only 1 .mu.l for
transcription of size markers) This should be ordered for delivery within
3 days of use (Delivery dates are Monday and Friday).
pT-7-Human cDNA templates (from 100 .mu.l PCR rxn performed by FB), 5
.mu.l(.about.0.5-1.0 .mu.g) each pT7 18S rRNA antisense control template,
0.5 .mu.g/.mu.l (Ambion Cat # 7338) ("R"), 2 .mu.l total pT7 RNA size
marker template, 1 .mu.l (unless transcribed within the last 2 months)
DEPC-treated H.sub.2 0, up to 13 .mu.l RNase-free, screw-top 1.5 ml tubes,
labeled for each probe, 1 Heating blocks for 1.5 ml tubes, one at
37.degree. C. and one at 95.degree. C. Plexiglass radiation shield
Procedures
1) Set one heating block to 37.degree. C. and the other to 95.degree. C.
2) Move [alpha-32P]-CTP from freezer to RT
3) Thaw all reagents in table below to RT, except Polymerase and DNase I
4) Briefly vortex and microfuge xcription buffer and XTP solutions
5) To RNase-free 1.5 ml tubes, add components in order shown below (#'s
represent ul)
All components, except the templates and polymerase can be combined as one
batch, then distributed as 13 .mu.l aliquots, one to each tube to receive
template. Then add one template per tube, then polymerase
All procedures beginning with the addition of 32 P-CTP must be done using a
plexiglass radiation shield
Combine components at RT, NOT on ice
______________________________________
Component(see above)
.mu.l/probe
______________________________________
10X xscription buffer (kit)
2
ATP (kit) 1
GTP (kit) 1
UTP (kit) 1
CTP (diluted from kit, FB) 3(for transcription of size marker, use 1
.mu.l of
undiluted CTP)
.sup.32 P-CTP 5(for transcription of size marker, use 1 .mu.l)
Human cDNA templates 5 each
18S rRNA gene template 2 .mu.l template + 3 .mu.l DEPC-H.sub.2 O
*Size marker template 1 .mu.l template + 10 .mu.l DEPC-H.su
b.2 O
T7 RNA Polymerase (kit) 2
______________________________________
After adding polymerase, mix components by pipetting
*Size marker does not need to be transcribed if some has already been
prepared in the last 2 months and is still available. There is no need to
gel purify size markers after the in vitro transcription reaction.
6) Incubate in 37.degree. C. heating block for 30-60 minutes
During this period, prepare 4% acrylamide gel (See section C below)
7) Add 1 .mu.l of DNase (kit) to each reaction, mix by pipetting, and
incubate 15 minutes at 37.degree. C.
8) Add 21 .mu.l 2.times.Gel loading buffer (kit) and heat to 95.degree. C.
for 2-3 minutes
prior to this step, gel should be ready; prolonged heating may lead to
formation of aggregates in SDS that are not able to enter the gel during
electrophoresis.
leave tubes in heating block for loading gel directly from block.
If size markers were transcribed, they can be frozen at this time; no need
for gel purification.
C. Gel purification of radioactive probes
Materials
Marathon Gel Mix 4(premix for 4% acrylamide, 8.3M Urea gel), 15 ml per two
gels
Ammonium Persulfate (APS), 10% (prepared within one day), 90 .mu.l
Running buffer; 1.times.TBE, .about.300 ml
Gel pouring apparatus
Comb with 40 .mu.l/well capacity (10 teeth, 0.75 mm thick)
Gel electrophoresis apparatus in radiation room
Fine tip pipetman tips
Electrophoresis power supply in radiation room
Plastic wrap
BIOMAX MR film (Kodak, Cat #895 2855)
RNase-free 1.5 ml tubes, 1 per probe+1 for combined probes
Elution buffer (0.5M Ammonium Acetate, 0.2% SDS, 1 mM EDTA), 300 .mu.l per
probe
Clean single-edge razor blade
Scintillation fluid (Optiphase "HiSafe"), 5 ml per probe
Scintillation vials, 1 per probe
Scintillation counter, programmed for counting P32
Procedures
1) Clean and assemble gel pouring apparatus
2) Warm Marathon Gel Mix 4 to RT, add APS, swirl the solution and pour gel
using 10 ml pipet
3) Insert comb, clamp, and add more gel solution to be sure gel reaches top
of teeth on comb. Gel can sit for hours in gel pouring apparatus before
proceeding
4) After gel sets (within 30 minutes), remove plate-gel-backing unit from
apparatus and rinse plates with tap distilled water. Remove comb and rinse
wells 2-3 times, shaking out water between rinses
5) Install plate-gel-backing in electrophoresis apparatus
6) Add 1.times.TBE to top reservoir, checking for leaking, and then to
bottom reservoir
7) Just before adding samples from in vitro transcription (Section I),
rinse wells with buffer in top reservoir, using P1000
8) With samples in 95.degree. C. heating block, load 30 .mu.l of each
sample into each well, spacing samples with empty wells
9) Hook up power supply and run gel at 125 V for.about.1 hr or until fast
dye is approx 2/3 down gel. Power may be raised to 200 V to speed
electrophoresis
10) Remove plate/gel/backing from electrophoresis apparatus and rinse all
components thoroughly with tap water.
11) Remove glass plate, leaving gel attached to backing
12) Wrap gel/backing with plasticwrap and expose x-ray film for 60 seconds,
noticing orientation of gel and film (gel precisely in upperleft corner of
film; dull side of film should be separated from gel by a single layer of
plasticwrap)
13) Develop film, and using film as a guide, mark the location of the four
bands containing the respective probes on the gel by adding mark directly
to plasticwrap over gel with marking pen. Save film for X-ray film binder
14) With razor, cut out each band of the gel containing probe of interest,
peal away plasticwrap, and drop each band into a separate 1.5 ml
RNase-free tube of 300 .mu.l Elution buffer
15) Incubate gel in elution buffer for 2.5-3 hrs at 37.degree. C., then
microfuge 1 minute at full speed
16) Add 10 ml scintillation fluid to each of four labeled scintillation
vials
17) Add 3 .mu.l (1% of total volume) from each elution to separate
scintillation vials
18) Count radioactivity in scintillation counter on 32P program; Record CPM
19) Calculate the volume in .mu.l, for each probe, equivalent to 25,000
counts
20) Combine probes into one 1.5 ml RNase-free tube, using above
calculations to give total of 25,000 n CPM of each probe, where n equals
the number of RNase protection assays (including controls) to be done with
the probe mixture. Because the energy from radiation can cause chemical
breakdown of the RNA, the probes should be used within the next three
days, the sooner the better
21) Return unused individual probes to freezer designated for radioactive
materials. Use shielded container.
D. Co-precipitation of cellular RNA with antisense probes should be done
the day before hydrization step
Materials
One 650 .mu.l RNase-free tube labeled "P+" (Control for probe; not to be
RNase treated)
One 650 .mu.l RNase-free tube labeled "P-" (Control: RNase-treated probe)
From Hybspeed RPA kit (Ambion):
Elution buffer from, .about.130 .mu.l per sample to be run in Rnase
Protection assay
Yeast RNA from Hybspeed RPA kit (Ambion), 10 .mu.l per sample
5M Ammonium Acetate from Hybspeed RPA kit, 0-13 .mu.l per sample
Combined radioactive probes from Section C, 25,000 cpm per probe per sample
One 1.0 .mu.g aliquot of each cellular RNA sample to be probed (each in 650
.mu.l RNase-free tubes).
Ideally, this should include an aliquot or aliquots of cellular RNA which
are known from previous assays to contain the RNA targeted by the probes
being used (positive control) and one aliquot of cellular RNA from
fibroblasts known not to express chondrospecific genes (negative control).
Cold 100% Ethanol, 375 .mu.l per sample
Procedures
1) Combine (n+2)10 .mu.l Yeast RNA+(n+2)130 .mu.l Elution buffer in one
tube where n=# of samples, including all controls, with volume of less
than 10 .mu.l
2) To above mix, add (n+2)y .mu.l of probe mix from section C where n=# of
samples, including all controls, with volume of less than 10 .mu.l where y
.mu.l=volume of probe mix which contains 25,000 cpm of each probe
3) Add (140+y) .mu.l to:
empty tube labeled P+
empty tube labeled P-
each tub with cellular RNA samples unless volume of RNA sample exceeds 10
.mu.l
4) To each RNA sample with volume exceeding 10 .mu.l, add:
1/10.sup.th volume of 5M Ammonium Acetate
10 .mu.l of Yeast RNA
Enough Elution buffer to bring total volume to 140 .mu.l
y .mu.l (see above) of combined probe
5) Briefly vortex samples, add 375 .mu.l (.about.2.5 volumes) of cold 100%
EtOH, and invert .about.40.times.
6) Place all tubes and unused probe in "hot" freezer to allow
co-precipitation for 1 hr or o/n
Day 2
E. Hybrization of cellular RNA with antisense probes and Rnase treatment to
remove ssRNA
See HybSpeed.TM. RPA (Ambion, Cat #1412) Instruction Manual for additional
information on background, kit components, additional procedures, and
troubleshooting.
Materials
Three Heating blocks for 650 .mu.l tubes, set for 95, 68, & 37.degree.
(near radioactive shields)
From HybSpeed RPA kit (Ambion, Cat # 1412):
Rnase Digestion Buffer, 100 .mu.l per cellular RNA and probe control
samples
Hybridization Buffer, 10 .mu.l per cellular RNA and probe control samples
Gel Loading Buffer II, 10 .mu.l per cellular RNA and probe control samples,
and for size marker
One lane of size markers should be loaded per gel; one or two gels will be
loaded, depending on number of samples (maximum of 10 lanes per gel)
Rnase A/T1 Mix (enzyme: keep in freezer until use and return to freezer
immediately, 1 .mu.l per sample
Inactive/Precipitation Mix (keep in freezer until use), 150 .mu.l per
cellular RNA and probe control samples
Co-precipitation tubes containing cellular RNA and probe stored o/n in
freezer
(Section D)
Mifrofuge in cold room
elongated pipetman tips (fine-tip)
vacuum flask designated for radioactive waste
radioactive shields (in Laboratory)
1% SDS, several mls for washing pipet tips
70% Ethanol, stored at -20.degree. C., 300 .mu.l per cellular RNA and probe
control samples
Timer
Procedures
These Procedures may be performed in the lab (Radiation Room not
necessary).
Perform procedures behind plexiglass radioactive shields, and use
radioactive waste container.
Pay close attention to incubation times and temperatures.
1) Preheat one heating blocks and waterbath (These should all be in close
proximity to each other)
2) Preheat Rnase digestion buffer to 37.degree. C.
3) Thaw Hybridization Buffer and Gel Loading Buffer II to room temperature
4) Pellet RNA precipitate: Remove o/n co-precipitation tubes from freezer
(Section D) and microfuge at full speed for 15 minutes in cold room.
Orient tubes such that you will know where the pellet is.
5) Using elongated pipetman tips (fine-tip), carefully aspirate supernatent
(ethanol) into flask designated for radioactive waste.
Do not touch pellet. Rinse pepetman tip in 1% SDS between each tube.
6) Wash RNA pellet: To each pellet, gently (so as to not dislodge the
pellet) add 300 .mu.l cold 70% Ethanol. Invert tubes gently .about.4
times, and microfuge at full speed for 5 minutes in cold room.
7) During centrifugation, aliquot the amount of Hybridization Buffer needed
and heat to 95.degree. C.
8) Repeat aspiration, removing as much Ethanol as possible from sides of
tube without disturbing pellet.
9) Place pellets in 95.degree. C. heat block and add 10 .mu.l of preheated
hybridization buffer to each tube.
10) Solubilization: Vortex each sample for a full 20 seconds; return each
sample to 95.degree. C. immediately after vortexing (Proceed quickly,
vortexing two tubes at a time).
Revortez.about.10 seconds each, returning each sample to 95.degree. C.
immediately.
"Resolubilization of the coprecipitated probe+RNA is essential for
maximizing the sensitivity of the HybSpeed System. Do not be concerned by
foaming that may occur."
11) Hybridization: After 2-3 minutes at 95.degree. C., transfer tubes
quickly to 68.degree. C. waterbath and incubate for 10 minutes.
"Do not allow temperature of samples to drop"
12) During 10 minute hybridization, aliquot remove Rnase A/TI, vortex and
microfuge briefly, and dilute 100:1 by adding 1 .mu.l into every 100 .mu.l
of Rnase Digestion Buffer (buffer prewarmed to 37.degree. C.). Return
stock Rnase to freezer. Briefly vortex and microfuge diluted Rnase. Keep
diluted Rnase and unused Digestion Buffer at 37.degree. C. "Do not put on
ice". You will need 100 .mu.l Digestion Buffer without Rnase for "P+"
sample).
13) Digestion of non-hybridized ssRNA: At the end of the 10 minute
hybridization, One tube at a time, transfer sample from 68.degree. C. bath
directly to 37.degree. C. block and immediately add 100 .mu.l of diluted
Rnase prewarmed to 37.degree. C.
Exception: To tube labeled "P+" (see Section D), do not add diluted Rnase.
Instead, add 100 .mu.l of Digestion Buffer without Rnase. This sample will
show the migration of intact probes during electrophoresis.
14) After all tubes have been treated as above, vortex each tube briefly
and return to 37.degree. C. for 30 minutes, revortexing after the first 15
minutes. During this incubation, you may want to pour gel for
electrophoresis (see below).
15) At end of 30' Rnase- treatment, add 150 .mu.l of cold
Inactivation/Precipitation Mix to each tube.
Vortex and microfuge briefly. Transfer tubes to -20.degree. C. freezer for
at least 15 minutes (Can leave for several hours).
F. Electrophoresis of protected RNA
Pour 1 gel per maximum of 9 samples (not including marker lane)
Materials, per 4% acrylamide/8.3M Urea gel
______________________________________
From PAGE 1 Sequencing Gel Kit (Boehringer Cat# 100688):
______________________________________
Component 1: Acrylamide:Bisacrylamide (19:1)/8.3 M Urea,
1.6 ml
Component 2: Diluent, 8.3 M Urea, 7.4 ml
10X TBE/8.3 M Urea (Boehringer Cat# 100919), 1.0 ml
Ammonium Persulfate (APS), 10% (prepared within one day) 70 .mu.l
TEMED 10 .mu.l
Running buffer: 1X TBE, .about.300 ml
Gel pouring apparatus
Comb (10 teeth, 0.75 mm thick)
Gel electrophoresis apparatus
Fine tip pipetman tips
Electrophoresis power supply
Plastic wrap
BIOMAX MR Kodak film
Radioactive RNA size markers (transcribed as described in section B)
Samples in Inactivation/Precipitation Mix
Elongated pipetman tips (fine-tip)
Vacuum flask designated for radioactive waste
Gel Loading Buffer II from HybSpeed RPA kit, 10 .mu.l per sample
Heating block for 650 .mu.l tubes set at 90.degree. C.
______________________________________
Procedures
1) Pour 4% acrylamide/8.3M Urea gel: follow steps 1-5 of Section C
2) 2)O Thaw radioactive size markers and Gel Loading Buffer
3) Remove samples in Inactivation/Precipitation Mix from freezer and
microfuge 15 minutes at maximum speed in cold room
4) During centrifugation, remove plate-gel-backing unit from apparatus and
rinse plates with tap distilled water. Remove comb and rinse well 2-3
times, shaking out water between rinses
5) Install plate-gel-backing in electrophoresis apparatus
6) Add 1.times.TBE to top reservoir checking for leaking, and then to
bottom reservoir
7) After 15 minute centrifugation, using elongated pipetman tips
(fine-tip), carefully aspirate supernatent (ethanol) into vacuum flask
designated for radioactive waste.
Do not touch pellet Rinse Pipetman tip in 1% SDS between each tube.
8) Microfuge 30 seconds full speed in cold room and aspirate again
"Residual supernatent will cause aberrant migration of bands in gel"
9) Add 10 .mu.l Gel Loading Buffer, vortex vigorously and microfuge briefly
10) Heat samples in heating block to 90.degree. C. for 3-4 minutes. Note:
heating too long may cause samples to become trapped in well of gel.
11) Just before adding samples, rinse wells with buffer in top reservoir,
using P1000
12) With samples in 90.degree. C. heating block, load 8 .mu.l of each
sample per wells
Exceptions
Markers: Dilute 1 .mu.l into 9 .mu.l Gel Loading Buffer and load only 1
.mu.l into well. Markers do not need to be heated. As marker decays (half
life=2 weeks), increase amount of marker loaded accordingly.
"P+" control probe sample: load only 1 .mu.l
Note on loading: If possible, avoid use of end lanes and leave an empty
well between the Marker land and the adjacent sample
13) Hook up power supply and run gel at 125 V until fast dye is near end of
gel
14) Remove plate/gel/backing from electrophoresis apparatus and rinse all
components thoroughly with tap water.
15) Remove glass plate
16) Transfer gel from backing plate to Wharman paper and dry on gel dryer
G. Phosphoimager
1) Expose gel in erased phosphoimager cassette, recording position of gel
on grid 2) After 1-4 days exposure, scan image and quantify bands
DNA fragments containing partial sequences of aggregan (Agg) (Doege et al.,
J. Biol. Chem 266:894-902, 1991) and types I and II collagens (Kuivaniemi
et al., Biochem J. 252:633-640, 1988 and Baldwin et al., Biochem J.
262:521-528, 1989) were generated by PCR amplification of human
chondrocyte cDNA libraries. Paired oligonucleotides, representing coding
sequences within each gene separated by several hundred basepairs (bp)
were used as primers for PCR. Included at the 5' end of the downstream
primer, was an anchor sequence (CAGTGCCAT) for subsequent addition of the
T7 RNA polymerase promoter. The sequence of the primers with upstream and
downstream sequences shown respectively in 5' to 3' orientation are as
follows:
i) CCATGCAATTTGAGAACT (SEQ ID No:1); and
ii) ACAAGAAGAGGACACCGT (SEQ ID No:2) to generate 551 bp of aggregan gene
sequence (Agg.sub.551);
iii) CCATGCAATTTGAGAACT (SEQ ID No:3); and
iv) CTTCGATGGTCCTGTCGTTCAG (SEQ ID No:4); for Agg.sub.207 ;
v) GCGGAATTCCCCCAGCCACAAAGAGTC (SEQ ID No:5); and
vi) CGTCATCGCACAACACCT (SEQ ID No:6) for 261 bp of the type II collagen
(CI) gene; and
vii) GTCCCCGTGGCCTCCCCG (SEQ ID No:7); and
viii) CCACGAGCACCAGCACTT (SEQ ID No:8) for 307 bp of type II collagen gene
(CII).
The amplified fragments were inserted into pCRscript vector (Stratagene,
Lajolla Calif.) for the propagation and maintenance. In order to generate
templates for the transcription of antisense probes, a second PCR
amplification was performed using these cloned cDNA fragments. For
priming, respective upstream primers shown above were each paired with the
T7 promoter sequence containing the same anchor sequence (underlined) that
use used in the first PCR amplification:
GGAATTCTTAGATAATACGACTCACTATAGGGCAGTGCCAT (SEQ ID No:9); DNA templates
containing either 80 bp of the 18S rRNA gene or 316 bp of the
glyceraldehyde-3-phosphate dehydrogenase (GAPDH) gene, each linked to an
upstream T7 promoter, were supplied by Ambion (Austin, Tex.). Prior to use
as a template, GAPDH sequence linked to the promoter was reduced to 149 bp
by digestion with Dde I.
In vitro transcription from the above templates was performed using the
Maxiscript.TM. kit (Ambion) according to manufacturer's instructions.
Full-length probes were purified from the transcription reaction by
electrophoresis on 7M urea, 4% polyacrylamide 1.times.TBE gels, followed
by autoradiography, excision from the gel of bands corresponding to the
full length transcripts, and passive diffusion into probe elution buffer
(supplied in the Maxiscript.TM. kit) for two hours at 37.degree. C. The
activity of the probe was quantified by scintillation counting.
RNase protection assays were performed using the Hybspeed.TM. RPA kit
(Ambion) according to manufacturer's instructions. Briefly, radiolabelled
antisense RNA probes for aggrecan and types I and II collagens were
combined and hybridized with RNA isolated from chondrocytes, using an
excess of probe. A probe for 18S rRNA or GAPDH was also included in each
hybridization mixture to normalize for total RNA. For negative controls,
yeast RNA alone was combined with probes. For positive controls, probes
were hybridized to RNA samples know to contain sequences complementary to
all four probes. Digestion with an RNaseA/RNase T1 mix was performed to
degrade unhybridized RNAs. Hybridized RNAs protected from digestion were
resolved by electrophoresis as described above and visualized by
autoradiography or by using a Fujifilm BAS-1500 phosphorimager. Bands on
the phoshorimage representing types I and II collagen genes were
quantified using MacBAS version 2.4 software. Any signal from the
corresponding position of the negative control (no chondrocyte RNA) was
subtracted.
Cells in alginate culture were grown in the basal medium described above,
supplemented as follows:
Culture 1: 1.times.ITS+
Culture 2: 1.times.ITS+and 0.2 ng/ml TGF-.beta.1
Culture 3: 1.times.ITS+and 1.0 ng/ml TGF-.beta.1
Culture 4: 1.times.ITS+and 5.0 ng/ml TGF-.beta.1
Cells were harvested at 7 and 21 days for RNA isolation.
The results of Rnase Protection Assay on RNA from the 7-day cultures showed
that in the absence of TGF-.beta.1 (culture 1), there was little or no
detectable CII or Agg mRNA while CI mRNA was abundant. With addition of
0.2 ng/ml TGF-.beta.1 (culture 2) there was a clear induction of mRNA
abundance for the chondrocyte differentiation markers CII and Agg, while
CI abundance was not significantly altered. Addition of higher TFG-.beta.1
concentrations (cultures 3 and 4) showed a dose-dependent increase CII and
Agg with no change in CI. Cultures harvested at 21 days yielded similar
results. In a separate example we showed that a 100-fold molar excess of a
monoclonal neutralizing antibody against TGF-.beta., when included with
the culture supplements listed for culture 3, yielded results similar to
that of culture 1. This effectively eliminates the possibility that the
differentiating activity was due to a contaminant of the TGF-.beta.1
preparation.
EXAMPLE 8
Culture conditions for cultures 1, 3 and 4 of example 7 were repeated. In
parallel cultures, TGF-.beta.2 was used in place of TGF-.beta.1. The
results from the TGF-.beta.1 and .beta.2 cultures were similar to the
corresponding cultures from Example 7, indicating that TGF-.beta.1 and
.beta.2 have similar properties with respect to induction of
chondrogenesis in this culture system.
EXAMPLE 9
Chondrocytes embedded in alginate were cultured in basal medium
supplemented with ITS+and 1 ng/ml TGF-.beta.2 for 1,2,4,7, and 21 days. As
a negative control, cells were cultured for 21 days in basal medium
supplemented with ITS+alone. RNA analysis of these cultures showed a
general trend of increasing CII and Agg RNA throughout the first seven
days (.about.5-fold increase in aggrecan and .about.40-fold increase in
CII). At day 21, the abundance of CII and Agg mRNA apparently dropped off,
but remained high compared to day 1.
EXAMPLE 10
As shown in appendix C, 1.times.ITS+is a mixture of several components
including 6.25 .mu.g/ml insulin. This example was performed to determine
whether, in the above examples, the insulin in ITS+was playing a role in
TGF-.beta. mediated induction of CII and Agg. Secondly, if insulin was
playing a role, we wanted to see if it can be replaced by IGF-I. The
culture condition of culture 3 in example 7 was repeated. In parallel
cultures, ITS+media was reproduced with insulin omitted or replaced with
10 ng/ml IGF-I. The results from 7 day cultures showed that in the absence
of insulin and IGF-I, 1 ng/ml TGF-.beta. induced neither CII nor Agg
expression. However, addition to the culture of 10 ng/ml IGF-I in lieu of
6.25 .mu.g/ml insulin, restored TGF-.beta.1 mediated induction of these
chondrogenic markers to levels comparable to that of condition 3 of
example 7. This suggests that the IGF receptor, which binds insulin with
low affinity (Schmid, 1995), needs to be activated in order for TGF-.beta.
mediated chondrogenesis to occur. Furthermore, the use of IGF-I at
approximately 600-fold lower concentration than that of insulin
substantially reduces the possibility of contaminating factors affecting
differentiation.
In a separate example, other components of the ITS+were omitted or
substituted. We found that transferrin and selenious acid could be removed
without consequence, and that human serum albumin can replace bovine serum
albumin.
In conclusion, a complete defined medium, that includes basal medium
supplemented with 1 ng/ml TGF-.beta.1 or .beta.2, 10 ng/ml IGF-I, 1 mg/ml
human serum albumin, and may further include 5 .mu.g/ml linoleic acid,
will induce de-differentiated human chondrocytes to re-express the
chondrocyte differentiated markers CII and Agg in suspension cultures.
Top