Back to EveryPatent.com
| United States Patent |
6,096,720
|
|
Love
, et al.
|
August 1, 2000
|
Liposomal oligonucleotide compositions
Abstract
A pharmaceutical composition comprising (A) an oligonucleotide 8 to 50
nucleotides in length, which is targeted to mRNA encoding human raf and is
capable of inhibiting raf expression, entrapped in (B) sterically
stabilized liposomes.
| Inventors:
|
Love; William Guy (Horsham, GB);
Nicklin; Paul Leslie (Henfield, GB);
Hamilton; Karen Ophelia (Lawrence, KS);
Phillips; Judith Ann (Sevenoaks, GB)
|
| Assignee:
|
Novartis AG (Basel, CH)
|
| Appl. No.:
|
000136 |
| Filed:
|
April 23, 1998 |
| PCT Filed:
|
July 24, 1996
|
| PCT NO:
|
PCT/GB96/01775
|
| 371 Date:
|
April 23, 1998
|
| 102(e) Date:
|
April 23, 1998
|
| PCT PUB.NO.:
|
WO97/04787 |
| PCT PUB. Date:
|
February 13, 1997 |
Foreign Application Priority Data
| Aug 01, 1995[GB] | 9515743 |
| Sep 19, 1995[GB] | 9519130 |
| Current U.S. Class: |
514/44; 424/450; 435/183; 435/194; 435/325; 435/366; 435/371; 435/375; 536/23.1; 536/24.31; 536/24.5 |
| Intern'l Class: |
A61K 048/00; A61K 009/127; C12N 015/85; C07H 021/04 |
| Field of Search: |
424/450
435/6,69.1,91.1,440,455,458,183,194,325,354,366,371,375
514/44
536/23.1,24.3,24.31,24.33,24.5
|
References Cited
U.S. Patent Documents
| 5034506 | Jul., 1991 | Summerton et al. | 528/391.
|
| 5225212 | Jul., 1993 | Martin et al. | 424/450.
|
| 5279833 | Jan., 1994 | Rose | 424/450.
|
| 5354853 | Oct., 1994 | Staveski et al. | 536/17.
|
| 5411947 | May., 1995 | Hostetler et al. | 514/43.
|
| 5540936 | Jul., 1996 | Coe et al. | 424/450.
|
| 5563255 | Oct., 1996 | Monia et al. | 536/24.
|
| Foreign Patent Documents |
| 90/10448 | Sep., 1990 | WO.
| |
| 91/05545 | May., 1991 | WO.
| |
| 94/20073 | Sep., 1994 | WO.
| |
| 95/32987 | Dec., 1995 | WO.
| |
Other References
Woodle, M.C. Adavanced Drug Delivery Reviews vol. 16 (1995) pp. 249-265.
Science, vol. 254, p. 1497 (1991).
|
Primary Examiner: Elliott; George C.
Assistant Examiner: Shibuya; Mark L.
Attorney, Agent or Firm: McCormack; Myra H., Nowak; Henry P.
Claims
What is claimed is:
1. A pharmaceutical composition comprising (A) an oligonucleotide 8 to 50
nucleotides in length, which is targeted to mRNA encoding human raf and
inhibits raf expression, entrapped in (B) sterically stabilised liposomes.
2. The composition according to claim 1, in which at least one nucleotide
of the oligonucleotide (A) is modified at the 2' position of the sugar
moiety.
3. The composition according to claim 1, in which the oligonucleotide (A)
is a chimeric oligonucleotide which contains a first region having at
least one nucleotide modified to enhance target affinity and a second
region which is a substrate for RNAse H.
4. The composition according to claim 3, in which a nucleotide modified to
enhance target affinity is modified at the 2' position of the sugar
moiety.
5. The composition according to claim 2, in which the modified nucleotide
has an alkoxy, alkoxyalkoxy or fluoro substituent at the 2' position.
6. The composition according to claim 3, in which the oligonucleotide (A)
is a chimeric oligonucleotide and the region which is a substrate for
RNAse H comprises at least one 2'-deoxynucleotide.
7. The composition according to claim 1, in which the oligonucleotide (A)
has at least one phosphorothioate linkage.
8. The composition according to claim 1, in which, in the oligonucleotide
(A), all nucleotides are 2'-deoxynucleotides and all backbone linkages are
phosphorothioate linkages.
9. The composition according to claim 1, in which the oligonucleotide (A)
is a chimeric oligonucleotide having one or more regions with
2'-deoxynucleotides and one or more regions with
2'-alkoxyalkoxynucleotides.
10. The composition according to claim 9, in which the
2'-alkoxyalkoxynucleotides are 2'-methoxyethoxynucleotides.
11. The composition according to claim 9, in which the one or more regions
with 2'-deoxynucleotides have phosphorothioate backbone linkages and the
one or more regions with 2'-alkoxyalkoxynucleotides have phosphodiester
backbone linkages.
12. The composition according to claim 9, in which the oligonucleotide (A)
comprises a region of 2'-deoxynucleotides between two regions of
2'-alkoxyalkoxynucleotides.
13. The composition according to claim 1, wherein the oligonucleotide (A)
is targeted to mRNA encoding human A-raf.
14. The composition according to claim 1, in which the oligonucleotide (A)
is targeted to mRNA encoding human c-raf.
15. The composition according to claim 14, in which the oligonucleotide (A)
is targeted to a translation initiation site, 3' untranslated region or 5'
untranslated region of mRNA encoding human c-raf.
16. The composition according to claim 1 in which the oligonucleotide (A)
comprises a nucleotide sequence
GCTCCATTGATGCAGCTTAA
(SEQ ID NO:1)
or
GATGCAGCTTAAACAATTCT
(SEQ ID NO:2)
or
TCCCGCCTGTGACATGCATT
(SEQ ID NO:3)
or
GTCTGGCGCTGCACCACTCT
(SEQ ID NO:4)
or
CGCTCCTCCTCCCCGCGGCG
(SEQ ID NO:5)
or
TCCTCCTCCCCGCGGCGGGT
(SEQ ID NO:6)
or
CTCGCCCGCTCCTCCTCCCC
(SEQ ID NO:7)
or
CTGGCTTCTCCTCCTCCCCT
(SEQ ID NO:8)
or
CGGGAGGCGGTCACATTCGG
(SEQ ID NO:9)
or
TCTGGCGCTGCACCACTCTC
(SEQ ID NO:10)
or
TTCTCGCCCGCTCCTCCTCC
(SEQ ID NO:11)
or
TTCTCCTCCTCCCCTGGCAG
(SEQ ID NO:12)
or
CCTGCTGGCTTCTCCTCCTC
(SEQ ID NO:13).
17. The composition according to claim 1, in which the liposomes (B)
comprise at least one underivatised vesicle-forming lipid and at least one
vesicle-forming lipid which is derivatised with a hydrophilic polymer.
18. The composition according to claim 17, in which the hydrophilic polymer
is a polyethyleneglycol.
19. The composition according to claim 17, in which the derivatised lipid
is a phospholipid having an amino group.
20. The composition according to claim 19, in which the hydrophilic polymer
is attached to the phospholipid through a carbamate linkage.
21. The composition according to claim 19, in which the amino-containing
phospholipid is a phosphatidylethanolamine.
22. The composition according to claim 21, in which the amino-containing
phospholipid is distearoyl phosphatidylethanolamine.
23. The composition according to claim 17, in which the derivatised lipid
comprises 1-20 mole % of the total lipid content of the liposomes.
24. The composition according to claim 17, in which the underivatised lipid
is a lipid having two hydrocarbon chains and a polar head group and/or a
sterol.
25. The composition according to claim 24, in which the lipid having two
hydrocarbon chains and a polar head group is a phosphatidylcholine.
26. The composition according to claim 25, in which the phosphatidylcholine
is distearoyl phosphatidylcholine.
27. The composition according to claim 24, in which the sterol is
cholesterol.
28. The composition according to claim 17, in which the liposomes comprise
4-10 mol % derivatised lipid, 40-80 mol % underivatised lipid and 20-50
mol % sterol.
29. The composition according to claim 28, in which the molar ratio of
derivatised lipid: underivatised lipid: sterol is 1:10:5.
30. The composition according to claim 1, in which the liposomes (B)
comprise (i) a glycolipid together with (ii) a vesicle-forming
phospholipid or sphingolipid or mixture thereof and, optionally, (iii) a
sterol and/or an acylglycerol lipid.
31. The composition according to claim 30, in which the glycolipid is a
negatively charged glycolipid.
32. The composition according to claim 31, in which the liposomes comprise
(i) a negatively charged glycolipid together with (ii) a vesicle-forming
phospholipid and/or sphingolipid and (iii) a sterol or acylglycerol lipid.
33. The composition according to claim 31, in which the glycolipid is
ganglioside GM.sub.1 or hydrogenated phosphatidylinositol.
34. The composition according to claim 30, in which the vesicle-forming
phospholipid is a phosphatidylcholine or a phosphatidylethanolamine.
35. The composition according to claim 34, in which the phospholipid is
distearoyl phosphatidylcholine or dioleoyl phosphatidylethanolamine.
36. The composition according to claim 30, in which the sphingolipid is
sphingomyelin.
37. The composition according to claim 30, in which the acylglycerol lipid
has two fatty acid acyl groups each having at least 12 carbon atoms and
one acyl group of formula R.sup.1 CO--, where R.sup.1 is a residue,
containing up to 10 carbon atoms, of a monocarboxylic acid of formula
R.sup.1 COOH after removal of the --COOH group, or of formula OC--R.sup.2
--COOH where R.sup.2 is a residue, containing up to 10 carbon atoms, of a
dicarboxylic acid of formula HOOC--R.sup.2 --COOH after removal of both
--COOH groups.
38. The composition according to claim 37, in which the acylglycerol is
1,2-dipalmitoyl-sn-3-succinyl glycerol.
39. The composition according to claim 30, in which the liposomes comprise
2 to 20 mol % of the glycolipid, 40 to 80 mol % of the phospholipid,
sphingolipid or mixture thereof and 10 to 50 mol % of the sterol or 10 to
30 mol % of the acylglycerol.
40. The composition according to claim 39, in which the liposomes comprise
4 to 10 mol % of the glycolipid, 60 to 80 mol % of the phospholipid,
sphingolipid or mixture thereof and 20 to 40 mol % of the sterol or 10 to
30 mol % of the acylglycerol.
41. The composition according to claim 1, in which the liposomes have an
average particle size of 50 to 200 nm.
42. The composition according to claim 41, in which the liposomes have an
average particle size of 80 to 120 nm.
43. A method of inhibiting the expression of human raf which comprises
contacting tissues or cells which express human raf with a composition
according to claim 1.
44. A method of treating mammalian cancer which comprises administering a
composition according to claim 1 to a mammal in need of such treatment.
Description
This invention relates to liposomal oligonucleotide compositions, their
preparation and their use.
Alterations in cellular genes which directly or indirectly control cell
growth and differentiation are considered to be the main cause of cancer.
There are some thirty families of genes, called oncogenes, which are
implicated in human tumor formation. Members of one such family, the raf
gene family, are frequently found to be mutated in human tumors. The raf
family includes three highly conserved genes termed A-, B- and c-raf (also
called raf-1). c-Raf, the best characterized member of the raf family, is
the cellular homologue of v-raf, the transforming gene of the murine
sarcoma virus 3611. Raf genes encode protein kinases that are thought to
play important regulatory roles in signal transduction processes that
regulate cell proliferation. Mutation of raf genes causing a truncation or
other modification that leads to the expression of raf kinase without a
functional negative regulatory domain at the amino-terminal end results in
conversion to a form which is implicated in transformation of mammalian
cells in culture, and tumor formation. A raf gene having an absent or
inactive regulatory domain is said to be "activated." Activated
(truncated) raf has been detected in a variety of human cancers including
small-cell lung carcinoma, primary stomach cancer, renal cancer, breast
cancer, laryngeal cancer, skin fibroblasts from members of a cancer-prone
family (Li-Fraumeni syndrome), and in a human glioblastoma cell line.
Abnormal expression of the normal (non-activated) c-raf protein is
believed to play a role in abnormal cell proliferation since it has been
reported that 60% of all lung carcinoma cell lines express unusually high
levels of normal c-raf mRNA and protein. Rapp et al., The Oncogene
Handbook, E. P. Reddy, A. M. Skalka and T. Curran, eds., Elsevier Science
Publishers, New York, 1988, pp. 213-253.
Oligonucleotides have been employed as therapeutic moieties in the
treatment of disease states in animals and man. For example, there have
been identified antisense, triplex and other oligonucleotide compositions
which are capable of modulating expression of genes implicated in viral,
fungal and metabolic diseases. There remains a need for compositions which
can effectively inhibit abnormal raf gene expression, i.e. inhibit
expression of the activated raf product or inhibit unusually high level of
expression of the normal raf product.
It has now been found that compositions which inhibit abnormal gene
expression and retain high anti-hyperproliferative activity after
prolonged circulation in the bloodstream can be prepared by formulation of
oligonucleotides capable of inhibiting raf expression which are targeted
to mRNA encoding human raf within sterically stablised liposomes. These
compositions facilitate the reduction of accumulation of oligonucleotide
in non-target organs and reduction of acute and chronic side effects
during prolonged treatment.
Accordingly, the present invention provides a pharmaceutical composition
comprising (A) an oligonucleotide 8 to 50 nucleotides in length, which is
targeted to mRNA encoding human raf and is capable of inhibiting raf
expression, entrapped in (B) sterically stabilised liposomes.
The relationship between an oligonucleotide and its complementary nucleic
acid target to which it hybridises is commonly referred to as "antisense".
Targetting an oligonucleotide to a chosen nucleic acid target may involve
a multistep process. The process usually begins with identifying a nucleic
acid sequence whose function is to be modulated. This may be, as examples,
a cellular gene (or mRNA made from the gene) whose expression is
associated with a particular disease state, or a foreign nucleic acid from
an infectious agent. In the present invention, the target is a nucleic
acid encoding raf; in other words, the raf gene or mRNA expressed from the
raf gene. The targeting process also includes determination of a site or
sites within the nucleic acid sequence for the oligonucleotide interaction
to occur such that the desired effect--inhibition of abnormal raf gene
expression-will result. Once the target site or sites have been
identified, oligonucleotides are chosen which are sufficiently
complementary to the target, i.e., hybridize sufficiently well and with
sufficient specificity, to give the desired inhibition.
Inhibition of abnormal raf gene expression can be measured in ways which
are routine in the art, for example by Northern blot assay of mRNA
expression or Western blot assay of protein expression. Effects on cell
proliferation or tumor cell growth can also be measured, as described
hereinafter in the Examples. "Hybridization," in the context of this
invention, means hydrogen bonding, also known as Watson-Crick base
pairing, between complementary bases, usually on opposite nucleic acid
strands or two regions of a nucleic acid strand. Guanine and cytosine are
examples of complementary bases which ar e known to form three hydrogen
bonds between them. Adenine and thymine are examples of complementary
bases which form two hydrogen bonds between them. "Specifically
hybridizable" and "complementary" are terms which are used to indicate a
sufficient degree of complementarity such that stable and specific binding
occurs between the DNA or RNA target and the oligonucleotide. It is
understood that an oligonucleotide need not be 100% complementary to its
target nucleic acid sequence to be specifically hybridizable. An
oligonucleotide is specifically hybridizable when binding of the
oligonucleotide to the target interferes with the normal function of the
target molecule to cause a loss of utility, and there is a sufficient
degree of complementarity to avoid non-specific binding of the
oligonucleotide to non-target sequences under conditions in which specific
binding is desired, i.e., under physiological conditions in the case of in
vivo assays or therapeutic treatment, or, in the case of in vitro assays,
under conditions in which the assays are conducted.
In preferred embodiments of this invention, the oligonucleotide (A) is
targeted to mRNA encoding c-raf or A-raf. In accordance with this
invention, persons of ordinary skill in the art will understand that mRNA
includes not only the coding region which carries the information to
encode a protein using the three letter genetic code, but also associated
ribonucleotides which form a region known to such persons as the
5'-untranslated region, the 3'-untranslated region, the 5' cap region,
intron regions and intron/exon or splice junction ribonucleotides. Thus,
oligonucleotides may be formulated in accordance with this invention which
are targeted wholly or in part to these associated ribonucleotides as well
as to the coding ribonucleotides. In preferred embodiments, the
oligonucleotide is targeted to a translation initiation site (AUG codon)
or sequences in the 5'- or 3'-untransiated region of th e human c-raf
mRNA. Th e functions of messen ger RNA to be interfered with include all
vital functions such as translocation of the RNA to the site for protein
translation, actual translation of protein from the RNA, splicing or
maturation of the RNA and possibly even independent catalytic activity
which may be engaged in by the RNA. The overall effect of such
interference with the RNA function is to cause interference with raf
protein expression. Oligonucleotides targeted to mRNA encoding human A-raf
and, especially, human c-raf are presently preferred; however,
compositions for modulating expression of other forms of raf are also
believed to have utility and are comprehended by this invention.
In the context of this invention, the term "oligonucleotide" refers to an
oligomer or polymer of nucleotide or nucleoside monomers consisting of
naturally occurring bases, sugars and intersugar (backbone) linkages. The
term "oligonucleotide" also includes oligomers comprising non-naturally
occurring monomers, or portions thereof, which function similarly. Such
modified or substituted oligonucleotides are often preferred over native
forms because of properties such as, for example, enhanced cellular uptake
and increased stability in the presence of nucleases.
In some preferred oligonucleotides (A), at least one nucleotide is modified
at the 2' position of the sugar moiety. Certain preferred oligonucleotides
(A) are chimeric oligonucleotides. "Chimeric oligonucleotides" or
"chimeras", in the context of this invention, are oligonucleotides which
contain two or more chemically distinct regions, each made up of at least
one nucleotide. These oligonucleotides typically contain at least one
region of modified nucleotides that confers one or more beneficial
properties (such as, for example, increased nuclease resistance, increased
uptake into cells, increased binding affinity for the RNA target) and a
region that is a substrate for RNase H cleavage. In one preferred
embodiment, a chimeric oligonucleotide comprises at least one region
modified to increase target binding affinity, and usually, a region that
acts as a substrate for RNAse H. Affinity of an oligonucleotide for its
target (in this case a nucleic acid encoding raf) is routinely determined
by measuring the Tm of an oligonucleotide/target pair, which is the
temperature at which the oligonucleotide and target dissociate;
dissociation is detected spectrophotometrically. The higher the Tm, the
greater the affinity of the oligonucleotide for the target. In a more
preferred embodiment, the region of the oligonucleotide which is modified
to increase raf mRNA binding affinity comprises at least one nucleotide
modified at the 2' position of the sugar, particularly a 2'-alkoxy,
2'-alkoxyalkoxy or 2'-fluoro-modified nucleotide. Such modifications are
routinely incorporated into oligonucleotides and these oligonucleotides
have been shown to have a higher Tm (i.e., higher target binding affinity)
than 2'-deoxyoligonucleotides against a given target. The effect of such
increased affinity is to greatly enhance antisense oligonucleotide
inhibition of raf gene expression. RNAse H is a cellular endonuclease that
cleaves the RNA strand of RNA:DNA duplexes; activation of this enzyme
therefore results in cleavage of the RNA target, and thus can greatly
enhance the efficiency of antisense inhibition. Cleavage of the RNA target
can be routinely demonstrated by gel electrophoresis. In another preferred
embodiment, the chimeric oligonucleotide is also modified to enhance
nuclease resistance. Cells contain a variety of exo- and endo-nucleases
which can degrade nucleic acids. A number of nucleotide and nucleoside
modifications have been shown to make the oligonucleotide into which they
are incorporated more resistant to nuclease digestion than the native
oligodeoxynucleotide. Nuclease resistance is routinely measured by
incubating oligonucleotides with cellular extracts or isolated nuclease
solutions and measuring the extent or isolated nuclease solutions and
measuring the extent of intact oligonucleotide remaining over time,
usually by gel electrophoresis. Oligonucleotides which have been modified
to enhance their nuclease resistance survive intact for a longer time than
unmodified oligonucleotides. A variety of oligonucleotide modifications
have been demonstrated to enhance or confer nuclease resistance.
Oligonucleotides which contain at least one phosphorothioate modification
are presently more preferred. In some cases, oligonucleotide modifications
which enhance target binding affinity are also, independently, able to
enhance nuclease resistance.
Specific examples of some preferred oligonucleotides may contain
phosphorothioate phosphotriester, methyl phosphonate, short chain alkyl or
cycloalkyl intersugar linkages or short chain heteroatomic or heterocyclic
intersugar ("backbone") linkages. Most preferred are phosphorothioates and
those with CH.sub.2 --NH--O--CH.sub.2, CH.sub.2
--N(CH.sub.3)--O--CH.sub.2, CH.sub.2 --O--N(CH.sub.3)--CH.sub.2, CH.sub.2
--N(CH.sub.3)--N(CH.sub.3)--CH.sub.2 and O--N(CH.sub.3)--CH.sub.2
--CH.sub.2 backbones (where phosphodiester is O--P--O--CH.sub.2). Also
preferred are oligonucleotides having morpholino backbone structures, for
example as described in U.S. Pat. No. 5,034,506. In other preferred
embodiments, such as the protein-nucleic acid or peptide-nucleic acid
(PNA) backbone, the phosphodiester backbone of the oligonucleotide may be
replaced with a polyamide backbone, the bases being bound directly or
indirectly to the aza nitrogen atoms of the polyamide backbone, as
described by P. E. Nielsen, M. Egholm, R. H. Berg, O. Buchardt, Science
1991, 254, 1497. Other preferred oligonucleotides may contain alkyl and
halogen-substituted sugar moieties comprising one of the following at the
2' position: OH, SH, SCH.sub.3, F, OCN, OCH.sub.2 OCH.sub.3, OCH.sub.2
CH.sub.2 OCH.sub.3, OCH.sub.2 O(CH.sub.2).sub.n CH.sub.3,
O(CH.sub.2).sub.n NH.sub.2 or O(CH.sub.2).sub.n CH.sub.3 where n is from 1
to about 10; C.sub.1 to C.sub.10 lower alkyl, substituted lower alkyl,
alkaryl or aralkyl; Cl; Br; CN; CF.sub.3 ; OCF.sub.3 ; O--, S--, or
N-alkyl; O-, S-, or N-alkenyl; SOCH.sub.3 ; SO.sub.2 CH.sub.3 ; ONO.sub.2
; NO.sub.2 ; N.sub.3 ; NH.sub.2 ; heterocycloalkyl; heterocycloalkaryl;
aminoalkylamino; polyalkylamino; substituted silyl; an RNA cleaving group;
a cholesteryl group; a conjugate; a reporter group; an intercalator; a
group for improving the pharmacokinetic properties of an oligonucleotide;
or a group for improving the pharmacodynamic properties of an
oligonucleotide and other substituents having similar properties.
Oligonucleotides may also have sugar mimetics such as cyclobutyls in place
of the pentofuranosyl group. Other preferred embodiments may include at
least one modified base form or "universal base" such as inosine.
In certain especially preferred embodiments of the invention, all
nucleotides of the oligonucleotide (A) are 2'-deoxynucleotides and all
backbone linkages are phosphorothioate linkages.
In certain other especially preferred embodiments, the oligonucleotide (A)
is a chimeric oligonucleotide having one or more regions with
2'-deoxynucleotides and one or more regions with
2'-alkoxyalkoxynucleotides, particularly 2'-methoxyethoxynucleotides, the
one or more, 2'-deoxynucleotide regions preferably having phosphorothioate
backbone linkages and the one or more 2'-alkoxyalkoxynucleotide regions
preferably having phosphodiester backbone linkages. These chimeric
oligonucleotides preferably comprise a region of 2'-deoxynucleotides
between two regions of 2'-alkoxyalkoxynucleotides.
The oligonucleotides used as component (A) of the composition of the
invention may be conveniently and routinely made using well-known
techniques such as solid phase synthesis. Equipment for such synthesis is
available commercially from various sources including Applied Biosystems.
The use of such techniques to prepare oligonucleotides such as the
phosphorothioates and alkylated derivatives is well known. It is also well
known to use similar techniques and commercially available modified
amidites and controlled-pore glass (CPG) products such as biotin,
fluorescein, acridine or psoralen-modified amidites and/or CPG (available
from Glen Research, Sterling VA) to synthesize fluorescently labeled,
biotinylated or other modified oligonucleotides such as
cholesterol-modified oligonucleotides.
Specific especially preferred oligonucleotides, for which the nucleotide
sequences have been published in WO 95/32987, include the following:
______________________________________
No. Sequence (5' .fwdarw. 3')
Site SEQ ID NO:
______________________________________
ON1 GCTCCATTGATGCAGCTTAA
AUG 1
ON2 GATGCAGCTTAAACAATTCT
5'UTR
2
ON3 TCCCGCCTGTGACATGCATT
3'UTR
3
ON4 GTCTGGCGCTGCACCACTCT
3'UTR
4
ON5 CGCTCCTCCTCCCCGCGGCG
5'UTR
5
ON6 TCCTCCTCCCCGCGGCGGGT
5'UTR
6
ON7 CTCGCCCGCTCCTCCTCCCC
5'UTR
7
ON8 CTGGCTTCTCCTCCTCCCCT
3'UTR
8
ON9 CGGGAGGCGGTCACATTCGG
5'UTR
9
ON10 TCTGGCGCTGCACCACTCTC
3'UTR
10
______________________________________
ON1 to ON10 are oligodeoxynucleotides with phosphorothioate backbones
desgined using the Genbank c-raf sequence HUMRAFR (Genbank listing x
03484), synthesised and tested for inhibition of c-raf mRNA expression in
T24 bladder carcinoma cells using a Northern blot assay.
Other specific especially preferred oligonucleotides include:
______________________________________
No. Sequence Site SEQ ID NO:
______________________________________
ON11 CGGGAGGCGGTCACATTCGG
5'UTR 9
ON12 GATGCAGCTTAAACAATTCT
5'UTR
2
ON13 GCTCCATTGATGCAGCTTAA
AUG 1
ON14 CGCTCCTCCTCCCCGCGGCG
5'UTR
5
ON15 CGGGAGGCGGTCACATTCGG
5'UTR
9
______________________________________
ON11, ON12 and ON13 are oligonucleotides synthesised with phosphorothioate
backbones and uniformly substituted at the 2' position of the sugar moiety
by a methoxy group. ON14 is synthesized with a phosphodiester backbone and
is uniformly substituted by a propoxy group at the 2' position of the
sugar moiety. ON15 is synthesized with a phosphorothioate backbone and is
uniformly substituted by fluoro at the 2' position of the sugar moiety.
Specifically especially preferred chimeric oligonucleotides include:
______________________________________
No. Sequence Target Site
SEQ ID NO:
______________________________________
ON16 TCCTCCTCCCCGCGGCGGGT
5'UTR 6
ON17 CTCGCCCGCTCCTCCTCCCC
5'UTR 7
ON18 TTCTCGCCCGCTCCTCCTCC
5'UTR 11
ON19 TTCTCCTCCTCCCCTGGCAG
3'UTR 12
ON20 CTGGCTTCTCCTCCTCCCCT
3'UTR 8
ON21 CCTGCTGGCTTCTCCTCCTC
3'UTR 13
ON22 TCCCGCCTGTGACATGCATT
3'UTR 3
ON23 TCCCGCCTGTGACATGCATT
3'UTR 3
ON24 TCCCGCCTGTGACATGCATT
3'UTR 3
ON25 TCTGGCGCTGCACCACTCTC
3'UTR 10
______________________________________
ON16 to ON25 are chimeric oligonucleotides with uniform phosphorothiate
backbones, the nucleotides shown underlined being substituted by methoxy
at the 2' position of the sugar moiety.
Other specific especially preferred chimeric oligonucleotides include:
______________________________________
No. Sequence Target Site
SEQ ID NO:
______________________________________
ON26 TCCCGCCTGTGACATGCATT
3'UTR 3
ON27 TCCCGCCTGTGACATGCATT
3'UTR 3
ON28 TCTGGCGCTGCACCACTCTC
3'UTR 10
______________________________________
ON26, ON27 and ON28 are chimeric oligonucleotides with uniform
phosphorothioate backbones, the nucleotides shown underlined being
substituted at the 2' position of the sugar moiety, in ON26 by propoxy and
in ON27 and ON28 by fluoro.
Specific preferred chimeric oligonucleotides with 2' modifications and
chimeric phosphorothiote/phosphodiester backbones include:
______________________________________
No. Sequence Target Site
SEQ ID NO:
______________________________________
ON29 TCCCGCCTGTGACATGCATT
3'UTR 3
ON30 TCTGGCGCTGCACCACTCTC
3'UTR 10
ON31 TCCCGCCTGTGACATGCATT
3'UTR 3
______________________________________
ON29 and ON30 have regions, shown underlined, which have both 2'-propoxy
substituents and phosphodiester backbones. ON31 has regions, shown
underlined, which have both 2'-methoxyethoxy substituents and
phosphodiester backbones.
It is believed that certain oligonucleotides targeted to portions of the
A-raf mRNA and which inhibit A-raf expression will be useful for
interfering with cell hyperproliteration.
Specific phosphorthioate deoxyoligonucleotides of this kind, designed and
synthesised using the Genbank A-raf sequence HUMARAFIR (Genbank listing x
04790), for which the nucleotide sequences have been published in WO
95/32987, include the following:
______________________________________
No. Sequence Target Site
SEQ ID NO:
______________________________________
ON32 CCA TCC CGG ACA GTC ACC AC
Coding 15
ON33 ATG AGC TCC TCG CCA TCC AG
Coding 16
ON34 AAT GCT GGT GGA ACT TGT AG
Coding 17
ON35 CCG GTA CCC CAG GTT CTT CA
Coding 18
ON36 CTG GGC AGT CTG CCG GGC CA
Coding 19
ON37 CAC CTC AGC TGC CAT CCA CA
Coding 20
ON38 GAG ATT TTG CTG AGG TCC GG
Coding 21
ON39 GCA CTC CGC TCA ATC TTG GG
Coding 22
ON40 CTA AGG CAC AAG GCG GGC TG
Stop 23
ON41 ACG AAC ATT GAT TGG CTG GT
3'UTR 24
ON42 GTA TCC CCA AAG CCA AGA GG
3'UTR 25
ON43 GTC AAG ATG GGC TGA GGT GG
5'UTR 14
______________________________________
In compositions of the invention, the oligonucleotide (A) is entrapped in
sterically stablised liposomes (B). Examples of sterically stabilised
liposomes are those in which part of the lipid is a glycolipid,
particularly ganglioside GM, saturated phosphatidylinositol or
galactocerebroside sulphate ester, such as those described in WO 88/04924;
those in which part of the lipid is derivatised with hydrophilic polymer
such as those described in WO 91/05545 or U.S. Pat. No. 5,225,212; and
those comprising a vesicle-forming lipid and a lipid-polymer conjugate
having a hydrophobic moiety and a polar head group, such as those
described in WO 94/20073.
In a preferred embodiment of the invention, the liposomes (B) comprise at
least one underivatised vesicle-forming lipid and at least one
vesicle-forming lipid derivatised with hydrophilic polymer which may be,
for example, a polymer containing a hydroxy and/or carboxyl group such as
a polylactic acid, a polyglycolic acid or, preferably, a polyethylene
glycol. More preferably, the hydrophilic polymer is a polyethyleneglycol
having a molecular weight of 1000 to 5000 daltons, such as 1500 to 2500
daltons, especially 1800 to 2200 daltons. The hydrophilic polymer is
preferably derivatised with a polar head group of a phospholipid,
especially a phospholipid having an amino head group, i.e. the derivatised
lipid is preferably a phospholipid having an amino group, especially a
phosphatidylethanolamine such as dilauroyl phosphatidylethanolamine,
dimyristoyl phosphatidylethanolamine, dioleoyl phosphatidylethanolamine
or, particularly, distearoyl phosphatidylethanolamine.
Various methods of derivatising an amino-containing lipid with a hydroxyl-
and/or carboxyl-containing hydrophilic polymer will be apparent to those
skilled in the art. Several such methods are described in WO 91/05545 and
U.S. Pat. No. 5,225,212; the phospholipid having an amino group may be
derivatised with the hydrophilic polymer by any of these methods.
Preferably, the phospholipid having an amino group is derivatised with a
hydroxyl-containing hydrophilic polymer such that the polymer is attached
to the phospholipid through a carbamate linkage; this may be achieved by
reacting a hydroxyl group of the polymer (other hydroxyl groups being
capped, if necessary in view of their reactivity, for example by
etherification) with diimidazole to give an activated
imidazole--terminated polymer which is then reacted with the
amino-containing phospholipid to couple the phospholipid to the
hydrophilic polymer through a carbamate group, as described in WO 91/05545
or U.S. Pat. No. 5,225,212. In an especially preferred embodiment of the
invention, the derivatised lipid is an amino-containing phospholipid,
particularly a phosphatidylethanolamine, coupled through a carbamate group
to a polyethyleneglycol capped at one end by an alkoxy group, particularly
a methoxy or ethoxy group. Such a derivatised lipid is available
commercially.
The derivatised lipid is generally present in a minor molar amount relative
to the total Lipid content of the liposomes, preferably in an amount of 1
to 20 mole % of the total lipid content, although a lower amount, for
example 0.1 mole %, may be appropriate when the derivatised lipid has a
high molecular weight. The major part of the lipid content of the
liposomes generally comprises one or more underivatised vesicle-forming
lipids such as are used in conventional liposomes. Such lipids include,
for example, lipids having two hydrocarbon chains, usually in acyl groups,
and a polar head group, including phospholipids, for example
phosphatidylcholines such as dilauroyl phosphatidylcholine, dimyristoyl
phosphatidylcholine, dipalmitoyl phosphatidyicholine, distearoyl
phosphatidylcholine, dioleoyl phosphatidylcholine, dilinoleoyl
phosphatidylcholine, 1-palmitoyl-2-oleoyl phosphatidylcholine,
phosphatidylethanolamines such as those mentioned hereinbefore, and
phosphatidic acids such as dimyristoyl phosphatidic acid and dipalmitoyl
phosphatidic acid. Other conventionally used lipids include sterols,
particularly cholesterol, and glycolipids such as those mentioned
hereinbefore. Preferably, the underivatised lipid comprises a mixture of a
phospholipid, especially a phosphatidylcholine, and a sterol, especially
cholesterol.
In the abovementioned preferred embodiment, the sterically stabilised
liposomes (B) preferably comprise 4-10 mol % of the derivatised lipid,
40-80 mol % of the underivatised phospholipid and 20-50 mol % of the
sterol. In especially preferred liposomes (B), the molar ratio of
derivatised lipid: underivatised phospholipid: sterol is 1:10:5.
In another preferred embodiment of the invention, the liposomes (B)
comprise (i) a glycolipid together with (ii) a vesicle-forming
phospholipid or sphingolipid or mixture thereof and, optionally, (iii) a
sterol and/or an acylglycerol lipid. The glycolipid is preferably a
negatively charged glycolipid, especially ganglioside GM.sub.1
(monosialoganglioside) or hydrogenated phosphatidylinositol. The
vesicle-forming phospholipid may be one or more of the phospholipids
hereinbefore mentioned, preferably a phosphatidylcholine, a
phosphatidylethanolamine or a mixture thereof. Especially preferred
phospholipids are distearoyl phosphatidylcholine and dioleoyl
phosphatidylethanolamine. The sphingolipid is preferably sphingomyelin and
is preferably used together with a phospholipid. The sterol may be, for
example, ergosterol or, preferably, cholesterol. The acylglycerol lipid
may be an ester of glycerol containing two fatty acid acyl groups each
having at least 12 carbon atoms, for example lauroyl, myristoyl, palmitoyl
or oleoyl groups, and one acyl group of formula R.sup.1 CO--, where
R.sup.1 is a residue, containing up to 10 carbon atoms, of a
monocarboxylic acid of formula R.sup.1 COOH after removal of the --COOH
group or, preferably, of formula --COR.sup.2 COOH where R.sup.2 is a
residue, containing up to 10 carbon atoms, preferably 1 to 4 carbon atoms,
of a dicarboxylic acid of formula HOOC--R.sup.2 --COOH, especially
succinic acid, after removal of both --COOH groups. An especially
preferred acylglycerol is 1,2-dipalmitoyl-sn-3-succinyl glycerol.
In this second preferred embodiment of the invention, the liposomes
preferably comprise (i) a negatively charged glycolipid together with (ii)
a vesicle-forming phospholipid and/or sphingolipid and (iii) a sterol or
acylglycerol lipid, especially (i) ganglioside GM.sub.1 or hydrogenated
phosphatidylinositol together with (ii) distearoyl phosphatidylcholine or
dioleoyl phosphatidylethanolamine or a mixture thereof with sphingomyelin
and (iii) cholesterol or 1,2-dipalmitoyl-sn-3-succinylglycerol.
The liposomes may comprise from 2 to 20 mol% of the glycolipid (i) and 80
to 98 mol% of (ii) the phospholipid, sphingolipid or mixture thereof. In
preferred embodiments, where the liposomes also comprise a sterol or
acylglycerol, they may comprise 2 to 20 mol %, preferably 4 to 10 mol %,
of the glycolipid, 40 to 80 mol %, preferably 60 to 80 mol %, of the
phospholipid, sphingolipid or mixture thereof and 10 to 50 mol %,
preferably 20 to 40 mol%, of the sterol or 5 to 40 mol %, preferably 10 to
30 mol %, of the acylglycerol.
Specific especially preferred liposomes (B) are those described hereinafter
in the Examples.
The oligonucleotide-containing liposomes of the invention can be prepared
using known methods for the preparation of drug-containing liposomes. For
example, in one method, the lipid composition is dissolved in an organic
solvent, such as an alcohol, ether, halohydrocarbon or mixture thereof,
the solvent is removed from the resulting solution, for example by rotary
evaparation or freeze drying, and the resulting lipid film is hydrated by
dispersing in an aqueous medium, such as phosphate-buffered saline or an
aqueous solution of a sugar, e.g. lactose, which medium also contains the
oligonucleotide (A), to give an aqueous suspension of liposomes in the
form of multilamellar vesicles (MLV's). The aqueous liposome suspension
may be treated to reduce the liposome size, for example to give small
unilamellar vesicles (SUV's), using known methods, for example by
sonication or by extrusion through one or more membranes, e.g.
polycarbonate membranes, having a selected pore size. Liposomes according
to the invention preferably have on average a particle size below 500 nm,
more preferably 50 to 200 nm, especially 80 to 120 nm.
It is generally desirable to have as high a weight ratio of oligonucleotide
to lipid as possible consistent with liposome stability. The maximum for
this weight ratio may vary depending on the nature and composition of the
lipid component, but in general this maximum is likely to be about 1:20.
Ratios between 1:40 and 1:400 can be used with good results.
The invention includes a method of inhibiting the expression of human raf
which comprises contacting tissues or cells which express human raf with a
composition of the invention as hereinbefore defined. The invention also
includes a method of treating mammalian cancer which comprises
administering a composition of the invention as hereinbefore defined to a
mammal, particularly a human, in need of such treatment.
The composition of the invention may be administered by pulmonary delivery
or, preferably, parenterally, for example intravenously, subcutaneously,
intraperitoneally or intramuscularly. The dosage depends principally on
the method of administration and on the severity and responsiveness of the
condition to be treated. Individual doses and the administration regime
can best be determined by individual judgement of a particular case of
illness. Diseases which may be treated with the composition include
mammalian cancer, particularly human cancer such as lung cancer, stomach
cancer, renal cancer, breast cancer, laryngeal cancer, pancreatic cancer,
colorectal cancer and malignant melanoma.
The invention is illustrated by the following Examples.
EXAMPLE 1
A derivatised lipid, prepared by coupling distearoyl
phosphatidylethanolamine to a methoxy-capped polyethylene glycol of
molecular weight 2000 through a carbamate group (DSPE-MPEG 2000 available
from Genzyme), distearoyl phosphatidylcholine (available from Sigma
Chemical) and cholesterol are dissolved, at a molar ratio of 1:10:5, in
chloroform. The solvent is removed by rotary evaporation to leave a lipid
film. This film (250 mg) is hydrated with Hanks' balanced salt solution (2
ml) buffered to pH 7.4 with 25 mM 4-(2-hydroxyethyl)piperazine-1-ethane
sulphonic acid (HEPES) and containing oligonucleotide ON3 as hereinbefore
defined (1.2 mg). The resulting MLV's are subjected to ten liquid
nitrogen-water freeze-thaw cycles and then sonicated (wavelength 6 .mu.m)
for 2 minutes to give small unilamellar vesicles (SUVs) having an average
diameter of 80 to 100 nm. The resulting liposomes are purified to remove
unentrapped oligonucleotide by size exclusion chromatography using a
Sephadex G-150 column and a 25 mM sodium borate elution buffer.
Human lung adenocarcinoma A549 cells are implanted subcutaneously under the
dorsal outer skin of nude mice. A suspension of the
oligonucleotide-containing liposomes in phosphate buffered saline is
administered by intravenous injection at a dosage of 0.60 mg/kg once daily
beginning on day 10 after tumour cell inoculation. Tumour size is measured
and tumour volume calculated on days 10, 14, 17, 21, 24 and 27 following
tumour cell inoculation. The above test is repeated with the
oligonucleotide-containing liposomes being administered at a dosage of
0.60 mg/kg a) every second day, b) every third day and c) once weekly,
beginning on day 10 following tumour cell inoculation. The above test
procedure is repeated using a solution of oligonucleotide ON3, instead of
liposomes containing ON3, in phosphate buffered saline. The test results
are as follows:
______________________________________
Daily Administration
Tumour Volume (cm.sup.3)
Days After Inoculation
ON3 ON3 in Liposomes
______________________________________
10 0.1130 0.1160
14 0.0830 0.0700
17 0.0850 0.0580
21 0.1210 0.0510
24 0.1340 0.0610
27 0.1560 0.0670
______________________________________
______________________________________
Administration Every Second Day
Tumour Volume (cm.sup.3)
Days After Inoculation
ON3 ON3 in Liposomes
______________________________________
10 0.1160 0.1270
14 0.1010 0.0810
17 0.1160 0.0810
21 0.1690 0.0820
24 0.2540 0.0920
27 0.3300 0.1090
______________________________________
______________________________________
Administration Every Third Day
Tumour Volume (cm.sup.3)
Days After Inoculation
ON3 ON3 in Liposomes
______________________________________
10 0.1230 0.1130
14 0.1150 0.0700
17 0.1750 0.0700
21 0.2260 0.0710
24 0.4290 0.0970
27 0.6650 0.1210
______________________________________
______________________________________
Weekly Administration
Tumour Volume (cm.sup.3)
Days After Inoculation
ON3 ON3 in Liposomes
______________________________________
10 0.1300 0.1230
14 0.1510 0.0980
17 0.2460 0.1310
21 0.3980 0.2110
24 0.7090 0.3460
27 1.0660 0.5010
______________________________________
EXAMPLE 2
Liposomes containing entrapped oligonucleotide ON3 are prepared using the
procedure described in Example 1, but replacing the lipid mixture used in
that Example by hydrogenated phosphatidylinositol, distearoyl
phosphatidylcholine and cholesterol in a molar ratio of 1:10:5.
The ability of the liposomes to inhibit uptake of oligonucleotide ON3 by
murine macrophage-like J774 cells is tested using the procedure of Namba
et al, 1992, Life Sciences, 50, 1773-1779, with minor modifications. After
an incubation period of 360 minutes, the uptake of ON3 by the J774 cells
is 0.583%. When the procedure is repeated, replacing the liposomes by a
solution of ON3 in phosphate buffered saline, the uptake of ON3 by the
J774 cells is 8.714%.
EXAMPLE 3
Liposomes containing entrapped oligonucleotide ON3 are prepared using the
procedure described in Example 1, but replacing the lipid mixture used in
that Example by ganglioside GM.sub.1 (ex Sigma Chemicals), distearoyl
phosphatidylcholine and cholesterol in a molar ratio of 1:10:5 and using a
2:1 (by volume) mixture of methanol:chloroform, instead of chloroform
alone, as the solvent for the lipids. The liposomes are tested as in
Example 2: after an incubation period of 360 minutes, the uptake of ON3 by
J774 cells is 0.422%.
__________________________________________________________________________
# SEQUENCE LISTING
- <160> NUMBER OF SEQ ID NOS: 25
- <210> SEQ ID NO 1
<211> LENGTH: 20
<212> TYPE: DNA
<213> ORGANISM: Artificial Sequence
<220> FEATURE:
#Sequence:R INFORMATION: Description of Artificial
oligonucleotide
<220> FEATURE:
<223> OTHER INFORMATION: phosphorothioate backbones
<220> FEATURE:
#prepared withFORMATION: alternative oligonucleotide
methoxy group substituting 2' sug - #ar moiety
- <400> SEQUENCE: 1
# 20 ttaa
- <210> SEQ ID NO 2
<211> LENGTH: 20
<212> TYPE: DNA
<213> ORGANISM: Artificial Sequence
<220> FEATURE:
#Sequence:R INFORMATION: Description of Artificial
oligonucleotide
<220> FEATURE:
<223> OTHER INFORMATION: phosphorothioate backbone
<220> FEATURE:
#having methoxyORMATION: alternative oligonucleotide
#at 2' positionsituting for sugar moiety
- <400> SEQUENCE: 2
# 20 ttct
- <210> SEQ ID NO 3
<211> LENGTH: 20
<212> TYPE: DNA
<213> ORGANISM: Artificial Sequence
<220> FEATURE:
#Sequence:R INFORMATION: Description of Artificial
oligonucleotide
<220> FEATURE:
<223> OTHER INFORMATION: phosphorotioate backbone
<220> FEATURE:
#with uniformNFORMATION: alternative oligonucleotide
phosphorothiate backbone and nucleotide - #s 1-7 and
#at the 2'0 being substituted by methoxy
position of the sugar moiety
<220> FEATURE:
#with uniformNFORMATION: alternative oligonucleotide
phosphorothiate backbone and nucleotide - #s 1-6 and
#at the 2'0 being substituted by methoxy
position of the sugar moiety
<220> FEATURE:
#with uniformNFORMATION: alternative oligonucleotide
phosphorthiate backbone and nucleotides - # 1-5 and
#at the 2 ' being substituted by methoxy
position of the sugar moiety
<220> FEATURE:
#with uniformNFORMATION: alternative oligonucleotide
phosphorothioate backbones and nucleoti - #des 1-6 and
15-20 being substituted at the 2'- # position of the
sugar moiety by propoxy
<220> FEATURE:
#backbones withORMATION: alternative phosphorothioate
nucleotides 1-6 and 15-20 substitute - #d at the 2'
#fluoroosition of the sugar moiety by
<220> FEATURE:
#prepared withFORMATION: alternative oligonucleotide
nucleotides 1-6 and 15-20 have ph - #osphodiester
backbone and 2'-propoxy substitution - #s
<220> FEATURE:
#with nucleotidesMATION: alternative oligonucleotide
#backbones and15-20 having phosphodiester
2'-methoxyethoxy substitutents
- <400> SEQUENCE: 3
# 20 catt
- <210> SEQ ID NO 4
<211> LENGTH: 20
<212> TYPE: DNA
<213> ORGANISM: Artificial Sequence
<220> FEATURE:
#Sequence:R INFORMATION: Description of Artificial
oligonucleotide
<220> FEATURE:
<223> OTHER INFORMATION: phosphorothioate backbone
- <400> SEQUENCE: 4
# 20 ctct
- <210> SEQ ID NO 5
<211> LENGTH: 20
<212> TYPE: DNA
<213> ORGANISM: Artificial Sequence
<220> FEATURE:
<223> OTHER INFORMATION: Description of Artificial
Sequence:oliigonucleotide
<220> FEATURE:
<223> OTHER INFORMATION: phosphorothioate backbone
<220> FEATURE:
#havingTHER INFORMATION: alternative oligonucleotide
#substituted by a propoxybone and uniformly
#the sugar moietye 2' position of
- <400> SEQUENCE: 5
# 20 ggcg
- <210> SEQ ID NO 6
<211> LENGTH: 20
<212> TYPE: DNA
<213> ORGANISM: Artificial Sequence
<220> FEATURE:
#Sequence:R INFORMATION: Description of Artificial
oligonucleotide
<220> FEATURE:
<223> OTHER INFORMATION: phosphorothioate backbone
<220> FEATURE:
#with uniformNFORMATION: alternative oligonucleotide
phosphorothiate backbones and nucleotid - #es 1-11
being substituted by methoxy at t - #he 2' position of
the sugar moiety
- <400> SEQUENCE: 6
# 20 gggt
- <210> SEQ ID NO 7
<211> LENGTH: 20
<212> TYPE: DNA
<213> ORGANISM: Artificial Sequence
<220> FEATURE:
#Sequence:R INFORMATION: Description of Artificial
oligonucleotide
<220> FEATURE:
<223> OTHER INFORMATION: phosphorothioate backbone
<220> FEATURE:
#with uniformNFORMATION: alternative oligonucleotide
phosphorothiate backbone with nucleotid - #es 10-20
being substituted by methoxy at t - #he 2' position of
the sugar moiety
- <400> SEQUENCE: 7
# 20 cccc
- <210> SEQ ID NO 8
<211> LENGTH: 20
<212> TYPE: DNA
<213> ORGANISM: Artificial Sequence
<220> FEATURE:
#Sequence:R INFORMATION: Description of Artificial
oligonucleotide
<220> FEATURE:
#with uniformNFORMATION: alternative oligonucleotide
phosphorothiotate backbones and nucleot - #ides 7-20
being substituted by methoxy at t - #he 2' position of
the sugar moiety
- <400> SEQUENCE: 8
# 20 ccct
- <210> SEQ ID NO 9
<211> LENGTH: 20
<212> TYPE: DNA
<213> ORGANISM: Artificial Sequence
<220> FEATURE:
#Sequence:R INFORMATION: Description of Artificial
oligonucleotide
<220> FEATURE:
<223> OTHER INFORMATION: phosphorothioate backbone
<220> FEATURE:
#substituted at theTION: alternative oligonucleotide
2' position of the sugar moiet - #y by a methoxy group
<220> FEATURE:
#prepared with aRMATION: alternative oligonucleotide
phosphorothioate backbone and is uni - #formly
substituted by fluoro at the 2'- # position of the
sugar moiety
- <400> SEQUENCE: 9
# 20 tcgg
- <210> SEQ ID NO 10
<211> LENGTH: 20
<212> TYPE: DNA
<213> ORGANISM: Artificial Sequence
<220> FEATURE:
#Sequence:R INFORMATION: Description of Artificial
oligonucleotide
<220> FEATURE:
<223> OTHER INFORMATION: phosphorothioate backbone
<220> FEATURE:
#includes uniformMATION: alternative oligonucleotide
phosphorothiate backbone with nucleotid - #es 8-15
substituted by methoxy at the 2'- # position of the
sugar moiety
<220> FEATURE:
#prepared withFORMATION: alternative oligonucleotide
uniform phosphorothioate backbones with - # nucleotides 8-20
being substituted at the 2' po - #sition of the sugar
moiety by flouro
<220> FEATURE:
#having nucleotidesTION: alternative oligonucleotide
8-20 phosphodiester backbones and 2'- #-propoxy
substitutions
- <400> SEQUENCE: 10
# 20 tctc
- <210> SEQ ID NO 11
<211> LENGTH: 20
<212> TYPE: DNA
<213> ORGANISM: Artificial Sequence
<220> FEATURE:
#Sequence:R INFORMATION: Description of Artificial
oligonucleotide
<220> FEATURE:
<223> OTHER INFORMATION: oligonucleotide has phosphor -
#othiate backbones,
#15-20 areeotides at positions 1-5 and
substituted by methoxy at the 2'- # position of the
sugar moiety
- <400> SEQUENCE: 11
# 20 ctcc
- <210> SEQ ID NO 12
<211> LENGTH: 20
<212> TYPE: DNA
<213> ORGANISM: Artificial Sequence
<220> FEATURE:
#Sequence:R INFORMATION: Description of Artificial
oligonucleotide
<220> FEATURE:
#phosphorothiateRMATION: oligonucleotide has uniform
backbones, nucleotides 1-12 are subs - #tituted by
#the sugar moietythe 2' position of
- <400> SEQUENCE: 12
# 20 gcag
- <210> SEQ ID NO 13
<211> LENGTH: 20
<212> TYPE: DNA
<213> ORGANISM: Artificial Sequence
<220> FEATURE:
#Sequence:R INFORMATION: Description of Artificial
oligonucleotide
<220> FEATURE:
#phosphorothiateRMATION: oligonucleotide has uniform
#substituted byand nucleotides 10-20 are
#the sugar moietythe 2' position of
- <400> SEQUENCE: 13
# 20 cctc
- <210> SEQ ID NO 14
<211> LENGTH: 20
<212> TYPE: DNA
<213> ORGANISM: Artificial Sequence
<220> FEATURE:
#Sequence:R INFORMATION: Description of Artificial
oligonucleotide
- <400> SEQUENCE: 14
# 20 gtgg
- <210> SEQ ID NO 15
<211> LENGTH: 20
<212> TYPE: DNA
<213> ORGANISM: Artificial Sequence
<220> FEATURE:
#Sequence:R INFORMATION: Description of Artificial
oligonucleotide
- <400> SEQUENCE: 15
# 20 ccac
- <210> SEQ ID NO 16
<211> LENGTH: 20
<212> TYPE: DNA
<213> ORGANISM: Artificial Sequence
<220> FEATURE:
#Sequence:R INFORMATION: Description of Artificial
oligonucleotide
- <400> SEQUENCE: 16
# 20 ccag
- <210> SEQ ID NO 17
<211> LENGTH: 20
<212> TYPE: DNA
<213> ORGANISM: Artificial Sequence
<220> FEATURE:
#Sequence:R INFORMATION: Description of Artificial
oligonucleotide
- <400> SEQUENCE: 17
# 20 gtag
- <210> SEQ ID NO 18
<211> LENGTH: 20
<212> TYPE: DNA
<213> ORGANISM: Artificial Sequence
<220> FEATURE:
#Sequence:R INFORMATION: Description of Artificial
oligonucleotide
- <400> SEQUENCE: 18
# 20 ttca
- <210> SEQ ID NO 19
<211> LENGTH: 20
<212> TYPE: DNA
<213> ORGANISM: Artificial Sequence
<220> FEATURE:
#Sequence:R INFORMATION: Description of Artificial
oligonucleotide
- <400> SEQUENCE: 19
# 20 gcca
- <210> SEQ ID NO 20
<211> LENGTH: 20
<212> TYPE: DNA
<213> ORGANISM: Artificial Sequence
<220> FEATURE:
#Sequence:R INFORMATION: Description of Artificial
oligonucleotide
- <400> SEQUENCE: 20
# 20 caca
- <210> SEQ ID NO 21
<211> LENGTH: 20
<212> TYPE: DNA
<213> ORGANISM: Artificial Sequence
<220> FEATURE:
#Sequence:R INFORMATION: Description of Artificial
oligonucleotide
- <400> SEQUENCE: 21
# 20 ccgg
- <210> SEQ ID NO 22
<211> LENGTH: 20
<212> TYPE: DNA
<213> ORGANISM: Artificial Sequence
<220> FEATURE:
<223> OTHER INFORMATION: Description of Artificial
Sequence:oligionucleotide
- <400> SEQUENCE: 22
# 20 tggg
- <210> SEQ ID NO 23
<211> LENGTH: 20
<212> TYPE: DNA
<213> ORGANISM: Artificial Sequence
<220> FEATURE:
#Sequence:R INFORMATION: Description of Artificial
oligonucleotide
- <400> SEQUENCE: 23
# 20 gctg
- <210> SEQ ID NO 24
<211> LENGTH: 20
<212> TYPE: DNA
<213> ORGANISM: Artificial Sequence
<220> FEATURE:
#Sequence:R INFORMATION: Description of Artificial
oligonucleotide
- <400> SEQUENCE: 24
# 20 tggt
- <210> SEQ ID NO 25
<211> LENGTH: 20
<212> TYPE: DNA
<213> ORGANISM: Artificial Sequence
<220> FEATURE:
#Sequence:R INFORMATION: Description of Artificial
oligonucleotide
- <400> SEQUENCE: 25
# 20 gagg
__________________________________________________________________________
Top