Back to EveryPatent.com
| United States Patent |
6,024,966
|
|
Inselburg
, et al.
|
February 15, 2000
|
Gene encoding protein antigens of plasmodium falciparum and uses therefor
Abstract
A Plasmodium falciparum gene encoding immunogenic SERA protein has been
isolated by a) systematically screening a lambda gt11 recombinant DNA
expression library with a murine monoclonal antibody directed against
protein antigens of this pathogen, and b) systematically screening a
lambda gt11 genomic cDNA and oligonucleotide probes directed against this
pathogen. A 111 kDa protein has been shown to have immunogenic activity
against parasite inhibitory antibodies. The gene encoding this protein,
including the signal sequence and regulatory sequence in the adjacent 5'
flanking sequence has been isolated and sequenced.
Isolation and characterization of genes encoding major protein antigens of
P. falciparum make it possible to develop reagents useful in the
diagnosis, prevention and treatment of malaria. In addition, the signal
sequences or regulatory sequences of this gene can be used to stimulate
the production of other useful genetic products.
| Inventors:
|
Inselburg; Joseph W. (Norwich, VT);
Bzik; David J. (Hanover, NH)
|
| Assignee:
|
Trustees of Dartmouth College (Hanover, NH)
|
| Appl. No.:
|
335204 |
| Filed:
|
November 7, 1994 |
| Current U.S. Class: |
424/268.1; 424/185.1; 424/272.1; 435/69.3; 530/350; 530/395 |
| Intern'l Class: |
A61K 039/015 |
| Field of Search: |
530/350,395
424/88,185.1,268.1,272.1
435/69.3
|
References Cited
U.S. Patent Documents
| 4546082 | Oct., 1985 | Kurjan et al. | 435/172.
|
| Foreign Patent Documents |
| 8703882 | Jul., 1987 | WO | .
|
Other References
Inselburg et al Infect. Immun. vol. 59 pp. 1247-1250 (1991).
Mitchell Parasitology vol. 98 pp. 529-547 (1989).
Eisen in Immunology 2.sup.nd Edition, Harper & Row Publishers, Hagerstown
PA (1980) p. 294.
Stedman's Medical Dictionary 25.sup.th Edition, Williams & Wilkens,
Baltimore MD 21202 (1990) p. 1680.
Phillips et al Parasitology Today vol. 2 pp. 271-282 (1986).
Cox TIBTECH vol. 9 pp. 389-394 (1991).
Horii et al Mol. Biochem Parasitol. vol. 30 pp. 9-18 (1988).
Banyal et al Am. J. Trop. Med. Hyg. vol. 34 pp. 1055-1064 (1985).
Weber et al Molecular Strategies of Parasitic Invasion.
Delplace Mol. Biochem. Parasitol. vol. 23 pp. 193-201 (1987).
Maniah's et al Molecular Cloning: A Laboratory Manual Cold Spring Harbor
Laboratory CSH, NY (1982) pp. 310-352 & 404-433.
|
Primary Examiner: Cunningham; Thomas M.
Attorney, Agent or Firm: DeConti, Jr., Esq.; Giulio A.
Goverment Interests
FUNDING
Work described herein was supported by funding from the National Institutes
of Health grant No. AI22038.
Parent Case Text
This application is a continuation of application Ser. No. 07/997,092 filed
on Dec. 29, 1992 (now abandoned), which is a divisional of Ser. No.
07/870,806 filed Apr. 17, 1992 (now abandoned), which is a file wrapper
continuation of Ser. No. 07/231,771 filed Aug. 12, 1988 (now abandoned).
Claims
We claim:
1. A vaccine for reducing the severity of P. falciparum malaria in a
subject comprising an isolated recombinant SERA (allele I) or SERA (allele
II) polypeptide in combination with a pharmaceutically acceptable carrier
and optionally an adjuvant, wherein said vaccine elicits parasite
inhibitory antibodies that reduce the severity of malaria.
2. The vaccine of claim 1 wherein the SERA polypeptide comprises the
sequence of allele I.
3. The vaccine of claim 1 wherein the SERA polypeptide comprises the
sequence of allele II.
4. A method for reducing the severity of P. falciparum malaria in a subject
comprising administering to the subject an immunogenic amount of the
vaccine of claim 1.
5. A method of producing a parasite-inhibitory antibody in a parasite host
comprising immunizing said host with the vaccine of claim 1 wherein said
antibody reduces the severity of P. falciparum malaria.
Description
BACKGROUND
Malaria is a significant global health problem. It is widespread, and
consitutes a growing health problem of major proportions, particularly in
developing countries.
Malaria is caused by several species of the genus Plasmodium, the most
virulent species being Plasmodium falciparum (P. falciparum). Parasites
growing in erythrocytes are responsible for the pathological
manifestations of the disease in man. During the blood stage of infection,
P. falciparum parasites infect the cells and develop within the
erythrocytes through three successive, morphologically distinct stages
known as ring, trophozoites and schizonts. A mature schizont eventually
produces multiple infectous particles, known as merozoites, which are
released upon rupture of the red blood cells. The merozoites invade new
red blood cells after a short extracellular life in the blood.
The increased resistance of the malaria parasite to drugs, as well as the
resistance of the mosquito vector to insectide, has increased the need for
a malaria vaccine. H. S. Banyal and J. Inselburg, Am. J. Trop. Med. Hyg.,
34(6): 1055-1064 (1985). One approach to the development of a vaccine has
been to use monoclonal antibodies to identify and characterize specific
malarial antigens involved in antibody-sensitive processes that are
essential to the maintenance of the parasite growth cycle. These
antibodies are known as "parasite inhibitory" antibodies. These parasite
inhibitory antibodies can be induced by a host's immune response to the
complementary antigens. Such an antigen, or combination of antigens, could
therefore provide the basis for an effective malarial vaccine. Some
parasite inhibitory antibodies have been isolated and the P. falciparum
parasite antigens they recognize have been identified by H. S. Banyal and
J. Inselburg, in Am.J. Trop. Med. Hyg., 34(6):1055-1064 (1985). See also,
P. Deplace, et al., Molecular and Biochemical Parasitology, 23: 193-201
(1987); J. L. Weber, et al., Molecular Strategies of Parasitic Invasion,
Agubian, Goodman and Nogueira (Eds.), Alan R. Liss, Inc., New York, N.Y.
pp. 379-388 (1987); P. Deplace, et al., Molecular and Biochemical
Parasitology, 17: 339-251 (1985); J. D. Chulay, et al., The Journal of
Immunology, 139: 2768-2774 (1987); and A. Bhatia, et al., Am. J. Trop.
Med., 36(1): 15-19 (1987).
The key to developing an antimalarial vaccine based on a defined antigen is
to isolate and characterize the gene encoding the antigen recognized by a
parasite inhibitory antibody so it may be manipulated by gene cloning
techniques to provide sufficient amounts of appropriate antigen for
vaccine production.
Available approaches to diagnosing, preventing and treating malaria are
limited in their effectiveness and must be improved if a solution is to be
found for the important public health problem malaria represents
worldwide.
SUMMARY OF THE INVENTION
The invention pertains to an isolated nucleic acid sequence which encodes
the SERA protein antigen of the malaria parasite Plasmodium falciparum (P.
falciparum), which antigen is capable of eliciting parasite inhibitory
antibodies in a parasite host. The term "SERA" is derived from serine
repeat antigen based on the presence of a serine repeat sequence in the
amino acid sequence of the protein.
In particular, the invention comprises the P. falciparum cDNA having the
nucleotide sequence shown in FIG. 2, the amino acid sequence derived from
it shown in FIG. 3, and the genomic DNA sequence shown in FIG. 6. The
isolated genomic DNA sequence of the invention can include the SERA gene
regulatory sequences contained in the 5' flanking sequence of the gene,
and the signal sequences, also shown in FIG. 3 and FIG. 6. The regulatory
sequences can be used to direct expression of the SERA gene, or they may
be used independent of the SERA DNA sequences, to direct the expression of
other DNA sequences, especially other malarial DNA sequences. The signal
sequences can be used to direct exportation of the SERA protein, or
independent of the SERA DNA, to direct exportation of a protein by a cell.
The invention also pertains to the immunogenic protein antigen, SERA, or
immunogenic equivalents thereof, encoded by the isolated DNA of the
invention. The amino acid sequence of the protein antigen is shown in FIG.
3 and FIG. 6. The protein can be produced by recombinant DNA techniques.
For example, cDNA of the invention can be incorporated into an expression
vector and the vector used to infect a host cell for expression of the
SERA antigen.
This invention includes a malaria vaccine which is composed of the SERA
antigen or a portion thereof, in a pharmaceutically acceptable carrier,
and a method of vaccinating against malaria with this vaccine.
BRIEF DESCRIPTION OF THE FIGURES
FIG. 1 shows a schematic representation of the restriction map, cDNA and
genomic clones for the SERA gene. (a) Restriction sites shown are B.
BglII; E. EcoRI; H. HindIII; K. KpnI; P. PstI; X. XbaI. (b) Enlarged
restriction map encompassing the SERA gene. (c) Locations of certain cDNA
molecules. (d) Location of the genomic DNA clone MBN#3102. (e) Location of
the long open reading frame coding for the SERA protein.
FIG. 2 shows the cDNA sequence encoding the SERA protein. The sequence
begins in the non-translated leader sequence for the SERA gene mRNA.
FIG. 3 shows the amino acid sequence of the SERA protein. The 989 amino
acids encoded by the SERA gene are shown using the one letter code. The
signal sequence and the three possible N-linked glycosylation sites of the
SERA gene are underlined.
FIG. 4 shows the results of a Northern blot analysis of the SERA gene mRNA.
The locations of RNA size markers of 5.1 and 2.1 Kb are shown.
FIG. 5 shows the a schematic representation of the restriction map of the
SERA gene, cDNA clones and genomic DNA clones. (a) Restriction sites shown
are B.sub.1 BglII; E, EcoRI; H, HindIII; K, KpnI; P, PstI; x, XbaI. (b)
Enlarged restriction map encompassing the SERA gene. (c) Location of the
cDNA clones used as probes in this study. (d) Location of the genomic
clones E31 and E3C. (e) Location of the genomic DNA clone MBN#3102. (f)
Location of the SERA genomic DNA including the exons, introns and flanking
sequences. Three introns are clear (.rect-hollow.) boxes and the exons are
filled (.rect-solid.) boxes.
FIG. 6 shows the genomic DNA sequence of the SERA gene and the amino acid
sequence which it encodes. Nucleotide sequences corresponding to the
broken line of the amino acid sequence indicates the location of the three
SERA gene introns. The stop codon is marked ***. Several restriction sites
are boxed: three HinfI sites, GANTC, and one EcoRI site, GAATTC. The 5'
nucleotide of the clone MBN#3102 is underlined (T, nucleotide 3795). The
regulatory sequence is encoded by base pairs 485-2526.
FIG. 7 shows portions of the SERA allele I and allele II repeat sequences,
AG(T or C) TC(A or T), encoding the polyserine repeats. The nucleotide
numbers in the right margin correspond to those in FIG. 6. The upper 39 bp
sequence found in allele I at the position shown, is absent from allele
II. Eight single nucleotide differences between allele I and allele II
were underlined in allele II. A ninth nucleotide change in the coding
region is not shown (nucleotide 3993 in Table I). The two boxed sequences
shown were chosen to make the oligonucleotide probes (probe A in cDNA to
identify allele I and probe B in clone E31 genomic DNA to identify allele
II). A HinfI restriction site in the 39 bp sequence is also boxed.
FIG. 8 shows the results of Southern hybridization of HinfI-treated clone
E3C, clone E31, FCR3 genomic DNA, and Honduras I genomic DNA with the 210
bp HinfI fragment of allele II (clone E31). Lanes a-c respectively
contained 0.9 .mu.g, 1.8 .mu.g and 3.6 .mu.g of FCR3 genomic DNA. Lanes
d-f respectively contained 0.225 ng, 0.45 ng and 0.90 ng of clone E3C.
Lanes g-i contained clone E31 in the same amounts as lanes d-f. Lanes j-l
contained Honduras-1 genomic DNA in the same amounts as lanes a-c. The
filter was hybridized with the .sup.32 P-labeled 210 bp HinfI fragment of
clone E31. The upper band in lanes a-c and g-i is a 210 bp fragment. The
lower broader bands in lanes a-f and j-l contain two fragments (132 bp and
117 bp), which are not well resolved in agarose gels.
FIG. 9 shows the results of Southern hybridization of EcoRI digested clone
E3C, clone E31 and FCR3 genomic DNA. The filter was probed with .sup.32
P-labeled probe A. Lanes a-c respectively contained 1.8 ug, 3.6 ug and 7.2
ug of FCR3 genomic DNA. Lanes d-f respectively contained 0.45 ng, 0.90 ng
and 1.8 ng of pUC19 plasmid containing clone E3C. Lanes g-i respectively
contained 0.45 ng, 0.90 ng and 1.8 ng of pUC19 plasmid containing clone
E31.
DETAILED DESCRIPTION OF THE INVENTION
The SERA gene encodes the SERA antigen, which is an immunogenic protein
antigen of the parasite P. falciparum, the most virulent species of
malaria. FIG. 2 shows the nucleotide sequence encoding the SERA antigen.
FIG. 3 shows the amino acid sequence derived from that cDNA sequence, and
FIG. 6 shows the genomic DNA, introns, and flanking sequences that contain
the transcriptional regulatory sites as well as the encoded amino acid
sequence. The nucleotide sequence of the invention includes DNA sequences
substantially complementary to the nucleotide sequence shown in FIGS. 2
and 6, or portions thereof, including additions, deletions and variations
of the nucleotide sequence which encode one or more antigenic determinants
of the SERA antigen.
The SERA gene was isolated from the P. falciparum genome using recombinant
DNA techniques. Briefly, RNA was obtained from red blood cells containing
parasites in the trophozoite and schizont stages. A lambda gt11 expression
library was constructed from the RNA, and the expression library was
screened immunologically with pooled human immune serum to form a gene
bank of positive clones. The gene bank expressed antigens recognized by
human anti-malarial polyclonal serum. The positive-clone gene bank was
then screened with a parasite-inhibitory, mouse monoclonal antibody, 43E5,
to identify clones producing antigens recognized by both it and the
parasite-inhibitory human antibodies. A cDNA clone in the gene bank,
designated clone #366, was isolated. Clone #366 strongly reacted with both
the human immune sera and the murine monoclonal antibody, indicating that
it encoded an immunogenic protein antigen present in the blood stage of
the parasite. The cDNA clone was then sequenced to obtain part of the
complete nucleotide sequence shown in FIG. 2. The complete cDNA sequence
in FIG. 2 was finally established using clone #366 as a probe of cDNA
libraries and other probes developed from clones in such libraries. A
representation of the clones derived starting with clone #366, from which
the complete cDNA sequence was determined, is shown in FIG. 1.
The complete genomic DNA sequence was established using two genomic DNA
clones gDNA #E3C and MBN#3102 (see FIG. 5). The genomic sequence with
introns is shown in FIG. 6.
The gross protein structure appeared conserved in 10 geographically
separate P. falciparum isolates. Bhatia et al., Am. J. Trop. Med. Hyg.,
36:15-19 (1987). The independent demonstration of its parasite-inhibitory
immunogenicity, its abundance in late developmental stages, its
accessibility to the host immune system, and its apparent conservation in
geographically isolated strains all suggest the antigen is an excellent
candidate antigen for a vaccine. The knowledge of the complete SERA
sequence and genomic structure, which is essential for the engineering of
its production, makes its use as a vaccine practical.
A vaccine based on the SERA protein, or an immunogenic portion of the
protein, can be made by incorporating the protein into a pharmaceutically
acceptable carrier. For example, the SERA antigen or portions thereof
containing one or more antigenic determinants of the SERA antigen can be
prepared in injectable form for parenteral administration by incorporating
them in a vehicle with or without an adjuvant.
The protein antigens encoded by part of or the entire SERA gene of P.
falciparum may be used in serodiagnostic tests for malaria. Such antigens
would be highly specific to P. falciparum, and the tests in which they are
used would also be highly specific. Highly specific serological tests
would be of great value in screening populations for individuals producing
antibodies to P. falciparum; in monitoring the development of active
disease in individuals, and in assessing the efficacy of treatment. As a
result of using such a diagnostic tool, early diagnosis of malaria will be
feasible, thus making it possible to institute treatment at an early stage
in the disease and, in turn, reduce the likelihood it will be transmitted.
The cDNA nucleotide sequence of the SERA gene, (shown in FIG. 2), the amino
acid sequence and the genomic sequence of the SERA gene (both shown in
FIG. 6), have been identified. Recombinant DNA techniques can be used to
produce the SERA protein. In these techniques, generally, the DNA encoding
all or a desired part of the protein would be incorporated into a DNA
expression vector, such as a plasmid. The resulting recombinant vector can
then be introduced into a host cell. Generally the host cell is a
prokaryote, such as E. coli, but eukaryotic host cells can be employed.
The transformed cells can be screened for the production of the gene
product. This can be accomplished by linking the DNA of interest to a
marker gene in the vector, such as LacZ, or by direct assay, such as by
using antibodies to detect the presence of the antigen. The cells which
are found to express the antigen at high levels can then be cultivated to
produce desired quantities of the protein.
The region of the genomic DNA containing gene regulatory sequences
associated with the SERA gene (shown in FIG. 6, bp 485-2526) cause the
SERA gene product to be produced at very high levels in the parasite.
Based on a Northern blot analysis of trophozoite and schizont mRNA and an
analysis of the P. falciparum cDNA library with SERA gene probes, as much
as 2% of trophozoite and schizont mRNA is devoted to this antigen's
production (see FIG. 4). The regulatory sequence of the SERA DNA can be
used to stimulate high-efficiency expression of other genes in addition to
the SERA gene. For example, the regulatory sequences can be isolated using
the appropriate restriction endonucleases, or it can be synthesized. The
regulatory sequence can then be incorporated into a vector, such as a
plasmid, to direct the expression of a gene of choice.
The SERA signal sequence (shown in FIG. 3, in one letter code for amino
acids, as the amino acid sequence MKSYISLFFILCVIFN) can be used to cause
the SERA protein, or other proteins to which it becomes linked, to be
exported. The SERA signal sequences can be linked to a protein-encoding
DNA sequence to produce secretable protein. The signal sequence directs
the passage of the protein through the cell membrane. Such signal or "pre"
sequences are characteristic of secreted proteins and consist mainly of
hydrophobic amino acid residues which determine the export of the protein
across the cell membrane. The SERA signal sequence can be incorporated
into a vector with the gene of choice, with an appropriate flanking
promoter sequence. Normally the signal sequence is placed upstream of and
adjacent to the gene. The vector is then used to transform a host cell.
The recombinant host cell will secrete the protein encoded by the gene of
choice as directed by the SERA signal sequence.
The invention is further illustrated by the following exemplification.
EXEMPLIFICATION
MATERIALS AND METHODS
Parasites and Culture Conditions
P. falciparum strains FCR3 and Honduras I were grown in vitro as described
by W. Trager and Jensen in Science, 193:673-675 (1976) and by J.
Inselburg, J. Parasitol, 69:584-591 (1983). RPMI 1640 medium was
supplemented with 25 mM HEPES buffer (pH 7.2), 0.2% sodium bicarbonate,
10% heat inactivated human plasma (type A, Rh.sup.+), penicillin (100 IU
ml.sup.-1), streptomycin (100 .mu.g ml.sup.-1), and gentamycin (20 .mu.g
ml.sup.-1).
Synchronization of parasites was done by the sorbital method, C. Lambros
and S. P. Vandenburg, J. Parasitol., 65:418-420 (1976), and a population
of trophozoite and schizont containing red blood cells (RBC) was prepared
by Plasmagel fractionation of a culture. R. T. Reese, et al., (1979)
B711.WHO57 (suppl.), 53-61.
Preparation of Parasite RNA and DNA
Red blood cells (RBCs) containing parasites in the trophozoite and schizont
stages were washed once with RPMI 1640 medium, resuspended in a solution
that contained 0.015% saponin, incubated for 0.3 hours at 37.degree. C.,
and were then collected and washed twice by centrifugation with phosphate
buffered saline (PBS 0.01 M KH.sub.2 PO.sub.4 /NaHPO.sub.4, 0.14 M NaCl,
pH 7.4).
Total parasite RNA was isolated using the guanidium isothiocynate method.
The Poly(A) RNA was purified through an oligo d(T)-cellulose column as
described previously. T. Maniatis, et al., Molecular Cloning: A Laboratory
Manual, Cold Spring Harbor Laboratory, Cold Spring Harbor, N.Y. (1982).
Chromosomal DNA was co-purified with the RNA from the GUITC homogenate.
After ultracentrifugation of the GuITC homogenate, the DNA on the CsCl
shelf was collected and purified by conventional CsCl banding (T.
Maniatis, et al., ibid.)
Construction of a cDNA Expression Library
The method of cDNA synthesis using reverse transcriptase and the Klenow
fragment of Eschericia Coli DNA polymerase I was followed. T. Maniatis, et
al, ibid. Ten micrograms of poly(A) RNA was used in each reaction. After
the synthesis of the second strand, the cDNA hairpin structure was cut
with S1 nuclease (Bethesda Research Labs), and the reaction was treated
with a phenol/chloroform mixture. The purified double stranded cDNA was
repaired by successive treatment with the Klenow fragment of DNA
polymerase I and T4 DNA polymerase (New England Biolabs). The DNA was
methylated with EcoRI methylase and the cDNA was ligated with an octamer
EcoRI linker (GGAATTCC). After digestion with EcoRI, the DNA was
fractionated by size using agarose gel electrophoresis to avoid possible
bias in the size distribution of the cDNA library. The cDNAs with the
length of 0.2-0.5 kb, 0.5-2 kb, 2-5 kb and 5-10 kb were separately
collected by electrophoresis onto DEAE 81 paper. G. Dretzen, et al., Anal.
Biochem., 112:295-298 (1981). The lambda gt11 phage (R. A. Young and R. W.
Davis, Proc. Natl. Acad. Sci. USA, 80:1194-1198 (1983)), was the vector
used for construction of the cDNA expression library. (T. Maniatis et al.,
ibid.)
Mung Bean Nuclease Genomic DNA Libraries
Mung bean nuclease (MBN) digestion of FCR3 parasite DNA was done as
described by D. J. Bzik et al. in Proc. Nat'l. Acad. Sci. USA,
84:8360-8364 (1987). DNA fragment sizes of 0.75 to 3.0 kb and 3.0 to 10 kb
were collected from a 1.0% agarose gel and purified. The libraries were
constructed in the lambda phage vector lambda gt11, as for the cDNA
library above.
Construction and Screening of Genomic DNA Libraries
Genomic DNA libraries were constructed in lambda gt11 as an EcoRI library
(G. Dretzen et al., (1981) Anal. Biochem., 112:295-298) and as an MBN
library. Gene fragments in lambda gt11 were subcloned into the plasmid
pUC19 and the recombinant plasmids were introduced into E. coli strain DH5
by transformation. D. Hanahan, J. Mol. Biol., 166:557-580 (1983). Plasmid
DNA was prepared exactly as previously described. T. Maniatis et al.,
ibid.
Screening of Recombinant Phage by Immunochemical Reactions
Phage producing parasite antigens were screened by an in situ plaque
immunoassay. R. A. Young and R. W. Davis, Proc. Nat'l Acad. Sci. USA, 80:
1194-1198 (1983). About 100,000 packaged phage were screened. The source
of antimalarial polyclonal antibody was pooled Nigerian serum provided by
Dr. D. Haynes (Walter Reed Army Institute of Research). The Nigerian serum
was used at a 1:200 dilution. In total, 288 of the screened Nigerian
positive phages were collected, and represented clones from each size
fraction of the cDNA library.
Oligonucleotide Synthesis and Labeling
Two single stranded SERA gene specific oligonucleotides, called probe A (a
30-mer: 5'CTG TAT CTC CTC TAA CTG TTC CCG TAC TTG 3') and probe B (a
31-mer: 5'CTA GAA CTT GAA CTT GAA CTA GAA CTT TGT T 3') were synthesized
at the Dartmouth Molecular Genetics Center, Hanover, N.H. The
oligonucleotides were purified on polyacrylamide gels and end-labeled
using T.sub.4 polynucleotide kinase and (.sup.32 P) ATP. T. Maniatis et
al., ibid.
Subcloning of the cDNA Inserts
DNA from positive phage clones identified in the previous section were
purified and subcloned into plasmid pUC19 at its EcoRI site. T. Maniatis
et al., ibid. A pUC19 plasmid cloning vector was linearized by EcoRI
digestion and treated with calf intestinal phosphatase. One microgram of a
phage clone DNA was cleaved with EcoRI, extracted with phenol/chloroform,
ethanol precipitated, and mixed with 0.5 ug of the prepared plasmid DNA in
25 ul of ligation mixture. E. coli HB101 or DA52 competent cells (Bethesda
Research Labs) were transformed with the ligated DNA by the procedure
described by the manufacturer and plated on ampicillin (100 .mu.g
ml.sup.-1) containing LB plates.
In situ and Southern Hybridization
Phage DNA was transferred to nitrocellulose. T. Maniatis et al., ibid.
Restriction enzyme digested P. falciparum DNA was transferred to Zeta
probe membranes (BioRad, Richmond, Calif.) using the alkaline transfer
method as previously described. K. C. Reed and D. A. Mann, Nucleic Acids
Res., 13:72077221 (1985) and J. Inselburg et al., Mol. Biochem.
Parasitol., 26:121-134 (1987). A. P. Feinberg and B. Vogelstein, Anal.
Biochem., 32:6-13 (1983) and Anal. Biochem., 137:266-267 (1984).
Typically, 50 ng of DNA to be used as a probe was oligo-labelled to a
specific activity of 1 to 3.times.10.sup.9 cpm .mu.g.sup.-1 of DNA.
Hybridization conditions were identical for plaque lifts and Southern
blots. Hybridizations were usually done overnight at 42.degree. C., in 35%
formamide (vol/vol), 6.times.SSC (T. Maniatis et al.), 0.5% BLOTTO (D. A.
Johnson et al., (1984) Gene Anal. Tech., 1:3-8 and 5 .mu.g poly(A)
ml.sup.-1. The addition of exogenous poly(A) dramatically decreased
background hybridization. After hybridization, filters were washed 3
times, for a total of 0.5 h in 1.times.SSC and 0.1% sodiumdodecylsulfate
(NaDodSO.sub.4) at room temperature. The filters were then washed twice
for 1 hour at 60.degree. C., or more, in 1.times.SSC and 0.1%
NaDodSO.sub.4 to remove non-specific hybridizing material.
Northern Blot Analysis
Total P. falciparum RNA and poly(A).sup.+ RNA were prepared as previously
described. Total RNA and poly(A).sup.+ RNA of malaria were
size-fractionated by electrophoresis in a 1.2% agarose formaldehyde (6.7%)
gel (Lehrach et al., Biochemistry, 16:4743-4751 (1977) and then
electrophoretically blotted onto Zetabind membrane (CUNO, Inc. Meriden,
Conn.). Hybridization of .sup.32 P-labeled cDNA to RNA-containing filters
was done overnight at 42.degree. C. Wahl, et al., Proc. Nat'l. Head. Sci.
USA, 76:3683-3687 (1979). Hybridization of probe A and probe B
oligonucleotides to the RNA-containing filters was done by treating the
filters for 2 hr at 37.degree. C. in a solution containing 1 M NaCl, 1033
Denhardt's solution, 5% NaDodSO.sub.4, 10 mg of poly(A) ml.sup.-1, and 0.1
mM ATP, followed by hybridization overnight at 37.degree. C. in 1 M NaCl,
10.times.Denhardt's solution, 1% NaDodSO.sub.4, 5% formamide, and 10%
Dextran sulfate. The filters were then washed in 1 M NaCl,
10.times.Denhardt's solution and 1% NaDodSO4 for 30 min at 37.degree. C.
Finally, the filters were washed, as required, in more stringent
conditions.
DNA Sequencing
DNA sequencing was performed as previously described by D. J. Bzik, et al.
in Proc. Nat'l Acad. Sci. USA, 84:8360-8364 (1987), using the
dideoxynucleotide technology. F. Sanger et al., Proc. Nat'l Acad. Sci.
USA, 74:5463-5467 (1977). Briefly, DNA fragments were purified (G. Dretzen
et al., (1981), Anal. Biochem., 112:295-298), self-ligated, and sonicated.
P. L. Deininger, Biochem., 129:216-223 (1983). 0.3 to 0.7 kb fragments
were purified and the DNA ends were enzymatically repaired (blunted) and
cloned into Smal digested, alkaline phosphatase treated M13mp8. Every bp
of the sonicated fragments was independently sequenced approximately 6
times (average), and both DNA strands were completely sequenced. DNA
sequences were reconstructed using the DNA Inspector II programs (Textco,
West Lebanon, N.H.). The BIONET computer resource for molecular biology
(IntelliGenetics, Palo Alto, Calif.) was also utilized to manipulate and
to compare DNA and amino acid sequences.
RESULTS
Construction of the Blood Stage cDNA Gene Bank
Parasite poly(A) RNA was prepared from parasites in the late trophozoite
and schizont stages to construct a lambda gt11 cDNA expression library.
This period of the erythrocytic growth cycle is when both protein and RNA
synthesis is most active, and when the greatest numbers of different
proteins appear to be synthesized. H. Banyal and J. Inselburg, Am.J.Trop.
Med. Hyg., 34: 1055-1064 (1985). The FCR3 cDNA library was screened with a
pooled human Nigerian serum that contained antibodies reactive with
numerous malaria proteins identified by western blot analysis. About
100,000 packaged phage were screened and 288 positive clones were picked,
purified, and numbered to form the FCR3 gene bank that was used to screen
other sources of antimalarial antibodies.
Lambda gt11 is a bacteriophage vector which is capable of driving the
expression of foreign DNA which is inserted into its genome with E. coli
transcription and translation signals. Lambda gt11 expresses the insert
DNA as a fusion protein connected to the E. coli beta-galactosidase
polypeptide. This approach ensures that the foreign DNA sequence will be
efficiently transcribed and translated in E. coli. This approach is also
useful in addressing the problem of the highly unstable nature of most
foreign proteins; fusion proteins are often more resistant to proteolytic
degradation than the foreign polypeptide alone. The use of lambda gt11 and
the P. falciparum strains used (FCR3 and Honduras-1) are described by T.
Horii, D. J. Bzik and J. Inselburg in Molecular and Biochemical
Parasitology, 30:9-18 (1988). The teachings of this publication are
incorporated herein by reference.
Determining the Structure of the SERA cDNA
Clone cDNA #366 reacted more strongly with mMAb 43E5, so this clone was
selected for further study. The cDNA #366 was subcloned into-pUC19.
The frequencies of expression of the genes coding for cDNA #366 were
estimated by using the oligo-labelled cDNA #366 sequence as a probe of the
original cDNA library. Ten thousand phage plaques from the library were
assayed by in situ DNA hybridization with each probe. 1.5% of total cDNA
phage containing inserts were hybridizable with the cDNA #366.
Isolation of SERA cDNA Clones and a Genomic DNA Clone
cDNA#366 DNA was used as a probe to select additional cDNA clones from a
cDNA library by DNA hybridization. Five additional cDNA clones that
hybridized with radioactively labeled cDNA#366 DNA were isolated,
purified, and analyzed. Each of those five cDNA clones contained a single
EcoRI fragment insert. The largest clone, cDNA#3102, contained a 1.8 kb
EcoRI insert. The cDNA#3102 DNA sequence did not contain a poly(A)
sequence. The DNA sequences of cDNA#366 and cDNA#3102 had a 971 bp overlap
and together they encoded a 629 amino acid sequence of the SERA gene.
In order to obtain the 3' cDNA sequences a MBN genomic DNA library was
constructed and screened to identify both the 3' cDNA and 5' cDNA
containing clones of the SERA gene, because MBN was previously shown to
cleave near, but outside of, P. falciparum coding regions. Radioactively
labeled cDNA#3102 was used to screen the genomic MBN libraries (0.75 to
3.0 kb; and 3.0 to 10 kb size fractions). 100,000 phage from each library
were screened and one clone, MBN#3102, from the 0.75 to 3.0 kb MBN
library, hybridized with cDNA#3102. The MBN#3102 clone contained two EcoRI
fragments, of 1.0 kb and 1.4 kb. The 1.0 kb EcoRI fragment strongly
hybridized with cDNA#3102 sequences. The 1.4 kb EcoRI fragment hybridized
very weakly with cDNA#3102 sequences under low but not high stringency
washing conditions. Two approaches were-used to determine if the 1.4 kb
EcoRI fragment of MBN#3102 contained 3' coding sequences of the SERA gene
or represented a random double ligation event. The cDNA libraries were
screened by hybridization with either the 1.0 or the 1.4 kb EcoRI fragment
of MBN#3102. If both of these fragments were adjacent on chromosomal DNA
and represented SERA gene sequences, then many cDNA clones should strongly
hybridize with both of them. In cDNA libraries constructed from both the
0.5 to 2.0 kb and the 2.0 to 5.0 kb cDNA fragments, many of the cDNA
clones strongly hybridized with both the 1.0 kb and 1.4 kb EcoRI
fragments. In the second approach, the hybridization pattern of both the
1.0 kb and 1.4 kb EcoRI fragments in Southern blotting experiments were
analyzed.
In Southern blotting experiments of parasite genomic DNA it was observed
that the 1.0 kb and 1.4 kb EcoRI fragments of MBN#3102 hybridized to the
same major bands in BglII, HindIII, and KpnI digests of chromosomal DNA.
It was concluded that the two fragments were adjacent on the chromosomal
DNA and did not represent a double-ligation event of random EcoRI
fragments. A preliminary restriction map for FCR3 and Honduras-1 DNA,
which behaves similarly to FCR3 DNA, was constructed from hybridization
data (see FIG. 1).
Nucleotide Sequence of the cDNA Clones and the Amino Acid Sequence of the
SERA Gene
Additional cDNA clones that hybridized with MBN#3102 DNA sequences were
identified. Sixteen of those cDNA clones were selected, plaque purified,
and their inserts subcloned into pUC19. Their insert sizes were determined
by EcoRI digestion and Southern hybridization with the 1.0 kb and 1.4 kb
EcoRI fragment of MBN#3102 (the 3' probe) were all approximately 1.0 to
1.1 kb in size. This indicated the distance from the unique EcoRI site in
the SERA gene to the 3' end of the mRNA was about 1.0 to 1.1 kb. Several
5' cDNA clones were selected for DNA sequence analysis. The locations of
some of those cDNA clones (FIG. 1c) and the MBN#3102 clone (FIG. 1d) are
shown. The alignment of the cDNA clones with the genomic restriction map
(FIG. 1b) was based on the presence or absence of the unique KpnI, PstI,
and EcoRI sites in the cDNA clones, and upon the aligned DNA sequences of
the cDNA clones The DNA sequences for the following cDNA clones: cDNA#4,
cDNA#6, cDNA#7, cDNA#366 and cDNA#3102 were determined.
The aggregate cDNA sequence derived from all of those clones is shown in
FIG. 2. The complete DNA sequence for both DNA strands was determined for
each cDNA clone. Minor differences from the consensus cDNA sequence were
found in some cDNA clones and are summarized in Table 1.
TABLE 1
______________________________________
Resolution of Base-pair Differences Between SERA cDNA clones
cDNA clone
Location.sup.a
bp difference
Resolution
______________________________________
cDNA#4 1 to 1571 NONE
cDNA#366.sup.b
126 to 1183
bp 233; G to A
G was present in
cDNA#4
cDNA#6, and
cDNA#3102
bp 1169; G to A
G was present in
cDNA#4, cDNA#6, and
cDNA#3102.
bp 1175; G to A
G was present in
cDNA#4, cDNA#6, and
cDNA#3102
bp 1180; T to A
T was present in
cDNA#4, cDNA#6, and
cDNA#3102
cDNA#6 168 to 3058
bp 1738; deleted
A was present to
cDNA#3102
bp 222; T to G
T was present in
cDNA#4, cDNA#366,
and cDNA#3102
bp 228; A to G
A was present in
cDNA#4, cDNA#366,
and cDNA#3102
cDNA#3102
212 to 2014
NONE
cDNA#7 2009 to 3107
NONE
______________________________________
.sup.a bp location numbers are from FIG. 2.
.sup.b cDNA#366 sequence is from reference Horii, T., et al., Molec. and
Biochem. Parasitol., 30:9-18 (1988).
There were 7 base pair (bp) discrepancies between the total 8,427 bp
determined for the cDNA clones, and a bp at these locations was assigned
(Table 1). Three of the base differences were located at the 3' end of
cDNA#366 and were caused during the second strand synthesis in cDNA
construction due to the annealing of an oligo-dT molecule at this site
(Table 1). cDNA#6 had a 1 bp deletion (bp 1738), probably generated during
either cDNA synthesis or the cloning process. The remaining three base
changes were clustered at bp 222, 228, and 233 and may represent mRNA
polymorphism based on those changes being located in the degenerate
octamer repeat of the SERA gene. The presence of the unique EcoRI site (bp
2009 to 2014) in the gene was confirmed by sequencing across that EcoRI
site in the phage DNA for both cDNA#6 and MBN#3102.
A long open reading frame began with the ATG at bp 104 and ended at the TAA
at bp 3071 (FIG. 1 and FIG. 2). That reading frame, which encoded the SERA
gene, contained 989 amino acids with a predicted molecular mass of 111 kDa
(FIG. 3). The SERA gene amino acid sequence contained a hydrophobic signal
peptide (amino acids 1 to 16 in FIG. 3), but did not contain a membrane
anchor domain. The absence of a membrane anchor domain was not unexpected
as the antigen was reported to be an exported protein that accumulated in
the parasitophorous vacuole. P. Deplace et al., Mol. Biochem. Parasitol.,
23:193-201 (1987); P. Delplace et al., Mol. Biochem. Parasitol.,
17:239-251 (1985). The protein which is highly acidic has an expected net
charge of -35. Serine residues account for 11% of the amino acids in the
protein and 57% of those serine residues (62 of 108) were localized within
a 201 amino acid sequence (residues 26 to 227) that included a 35-mer
polyserine repeat. Forty percent of the amino acid residues in that serine
rich segment were either serine or threonine (serine=30%; threonine=10%).
The coding portion of the SERA gene conformed to the known properties of
P. falciparum coding regions in that the coding region had a relatively
low A+T content (71%), a high A to T ration (1.4), an S-value comparable
to that of other P. falciparum coding sequences, and an increasing A+T
content for the three coding positions (62%, 66%, 86%).
Expression of the SERA Gene in the Parasite
It was previously found that the mRNA for the SERA gene was probably
abundant during late trophozoite-schizont stages because a large fraction
(1.5%) of cDNA clones in that cDNA library hybridized with cDNA#366. Total
RNA was isolated from late trophozoite-schizont stage parasites and was
purified into poly (A).sup.- and poly(A).sup.+ fractions by oligo-dT
affinity chromatography. Northern blot analysis of the SERA mRNA revealed
it was a single 4.1 kb species (FIG. 4). It was concluded that the mRNA
was apparently very abundant because the 4.1 kb SERA mRNA in the Northern
blot was easily detectable autoradiographically, requiring only a one
minute exposure of the X-ray film. In addition, on the ethidium bromide
stained gel prior to the blotting of the RNA, we could visually detect
four stained bands in the smear of parasite mRNA, one of which
corresponded in size with the 4.1 kb SERA mRNA. All available evidence
suggests that both the SERA mRNA and protein are abundant during late
trophozoite-schizont parasite stages.
Nucleotide Sequencing of SERA Genomic DNA
A P. falciparum genomic EcoRI library constructed in lambda gt11 was
screened with .sup.32 P-labeled cDNA#366 and twelve positive phage clones
were isolated. A genomic DNA clone that was plaque purified, clone E31,
contained a 4.8 kb DNA insert (FIG. 5). Its sequence was determined and
compared to the previously determined nucleotide sequence of the SERA cDNA
(FIG. 1). Clone E31 contained sequences 5' to the unique EcoRI site in the
SERA gene. Portions of its nucleotide sequence differed significantly from
the sequence of the SERA cDNA. Because a 39 bp sequence was present in the
SERA cDNA sequence, but was absent in clone E31, it was believed that
clone E31 might not represent an expressed form (allele) of the gene that
encoded the SERA antigen. To identify possible genomic DNA clones that
corresponded to the allele encoding the cDNA defined SERA antigen, a 30 bp
single-stranded oligonucleotide (probe A, see Methods section) was
synthesized. That 30 base oligonucleotide was the antisense sequence of
nucleotides 630 to 659 in the SERA cDNA sequence FIG. 2, and contained
part of the 39 bp sequence that was missing from clone E31. Probe A did
not hybridize with clone E31.
.sup.32 P-labeled probe A was used to re-screen the genomic EcoRI library
and eight of 40,000 phage plaques hybridized with probe A. Each of those
eight plaque-purified clones contained a 4.8 kb EcoRI fragment that
hybridized with the previously characterized SERA cDNA clones, cDNA#366
and cDNA#3102 (FIG. 1 and FIG. 5). One genomic DNA clone, clone E3C (FIG.
5), was subcloned into plasmid pUC19, and it was completely sequenced
(nucleotides 1 to 4779 in FIG. 6). The sequence of clone E3C and the
previously determined SERA cDNA sequence was identical in the coding
region of the SERA gene. This result indicated that probe A specifically
hybridized to an allele of the SERA gene that encoded the previously
isolated SERA cDNA clones. The comparison of the sequence of clone E3C and
clone E31 is summarized in Table II.
TABLE II
______________________________________
Nucleotide Differences Between the Nucleotide Sequence Defined by
the cDNA Clones and Clone E3C (allele I), and the Clone E31 (allele II)
Location.sup.a Allele I.sup.b
Allele II
______________________________________
132 A C
158 A G
between 1817 and 1818 TATATATATA
between 2047 and 2048 TT
2151 A deleted
from 2478 to 2483
GAAAAA deleted
between 2649 and 2650.sup.c
24 bp insert.sup.d
3087 G A
3092 A T
3096 A T
from 3098 to 3136
39 bp.sup.e
deleted
3140 C T
3149 A T
3157 G A
3185 T A
3191 A T
from 3812 to 3815
ATAT deleted
3993 C A
______________________________________
.sup.a The nucleotide locations are based on the SERA genomic DNA sequenc
defined by cDNA and clone E3C (allele I) as shown in FIG. 6.
.sup.b The nucleotide sequence of clone E3C in the SERA coding region and
the corresponding cDNA clones are identical. The previously determined
SERA cDNA sequence was encoded between nucleotides 2304 and 5867 of the
genomic DNA sequence in FIG. 6.
.sup.c As there are two identical 24bp sequences in clone E31. This 24 bp
insert may either be located between nucleotides 2649 and 2650 or 2673 an
2674.
.sup.d The 24 bp insert was 5' GTAATACAGGAGGAGGTCAAGCAG 3'.
.sup.e The 39 bp sequence was 5' GGGAACAGTTAGAGGAGATACAGAACCAATTTCAGATTC
3'.
Clone E3C, that encoded the SERA mRNA defined by the previously sequenced
SERA cDNA clones, was called allele I, while the clone E31 was considered
to represent another SERA gene allele, allele II, not represented in SERA
cDNA.
The 3' portion of the SERA gene was previously identified in clone MBN#3102
(FIG. 1 and FIG. 5), which was isolated by using cDNA#3102 to probe a P.
falciparum MBN genomic DNA library. MBN#3102 was sequenced and its
sequence was compared to the 4.8 kb fragments of allele I (clone E3C) and
allele II (clone E31), as well as to the corresponding SERA cDNA
sequences. The sequence 5' of the EcoRI site in MBN#3102 (FIG. 5) differed
from the sequence of clone E3C by 1 nucleotide (nucleotide 3993, Table I)
and was identical to the sequence of clone E31. Therefore, MBN#3102
represented allele II DNA (Table II). Because the 1.4 kb sequence 3' of
the EcoRI site (FIG. 5) in MBN#3102 was identical to the 3' nucleotide
sequence in the SERA cDNA, we concluded that the 3' genomic sequence of
allele I was identical to that of allele II. The 6124 bp genomic DNA
sequence containing the SERA gene, allele I, is shown in FIG. 6.
Structure of the SERA Gene
The open reading frame which encoded the SERA antigen began with the ATG at
nucleotide 2407 and ended at the TAA at nucleotide 5836 (FIG. 6). The SERA
gene (allele I and allele II) contained two separate regions of repeated
amino acid sequences. One region in allele I which included amino acids 23
to 62 contained 5 copies of a degenerate octamer amino acid repeat. Allele
II contained one additional octamer amino acid repeat in that region
caused by a 24 bp insert (see Table II). The other amino acid repeat of
allele I, which included amino acids 191 to 225, contained a polyserine
repeat composed of 35 serine residues. The polyserine repeat was encoded
by a hexanucleotide repeat, AG(T or C) TC(A or T). Allele II contained a
polyserine repeat of only 34 serine residues because a 39 bp deletion
(Table II) removed amino acids 178 to 191 (FIG. 3 and FIG. 6). Amino acid
191 is the first serine residue in the polyserine repeat of allele I. In
addition, there were nucleotide differences between allele I and allele II
in the polyserine repeat region (Table II, FIG. 6).
There were three large sequences present in SERA genomic DNA that were not
found in SERA cDNA (FIG. 6). They were believed to be intron sequences of
the SERA gene for several reasons. Those reasons were: a) All the presumed
intron sequences contained nucleotides immediately flanking exon borders
(FIG. 6) that conformed to the eukaryotic introns GT . . . AG junction
rule. Mount, S. M. (1982) Nucleic Acids Res., 10:459-472). All of these
presumptive intron sequences had higher A+T contents (85-89%) than the
surrounding exons (A+T content 71%); and c) Each presumptive intron
sequence contained multiple stop codons in each reading frame. Both SERA
gene alleles contained three introns.
The genomic DNA contained a 2406 bp flanking sequence at the 5' end and a
286 bp flanking sequence at the 3' end of the gene. Both 5' and 3'
flanking sequences contained higher A+T content (87%) than the coding
sequence (71%) and also contained multiple stop codons in all reading
frames. These differences between coding and flanking sequences have been
observed in other P. falciparum genes. Weber, J. L., Gene, 52:103-109
(1987). Another open reading frame was found at the 5' end of the clone
E3C (FIG. 6) which started within the EcoRI site at the 5' end of the
sequence and ended at nucleotide 485. The precise ends of the genomic DNA
sequence that encode the SERA gene can not be identified until the 5' and
3' mRNA termini and the SERA gene regulatory elements have been mapped.
Copy Number Analysis of the SERA Gene
One explanation of the previously observed abundance of SERA gene mRNA
(allele I) in late trophozoite and schizont stage parasites could be the
presence of a high SERA gene copy number. The SERA gene copy number per
parasite of allele I and allele II in the chromosomal DNA was therefore
determined according to the Wellems method. Wellems, T. E. et al., Cell,
49:633-642 (1987). Alleles I and II were discriminated based on the
observation that allele I contained an additional and unique HinfI
restriction site FIG. 6 and 7, nucleotides 3132-3136) within the 39 bp
sequence which was not present in allele II (Table II). Digestion of
allele II with HinfI produced only one fragment (210 bp) while digestion
of allele I with HinfI produced 2 fragments (117 bp and 132 bp) from that
region. The DNA concentration of clone E3C, clone E31, FCR3, and
Honduras-1 were quantitated both spectrophotometrically and by agarose gel
electrophoresis. A defined amount of clone E3C, clone E31, FCR3, and
Honduras-1 DNA was digested with HinfI, electrophoresed, and Southern
blotted. The filter was hybridized with the purified and .sup.32 P-labeled
210 bp HinfI fragment of allele II (FIG. 8). Clone E3a (lanes g,h,i)
contained only the 210 bp HinfI fragment used as the probe for Southern
blot, while clone E3C (lanes d,e,f) contained the 117 bp and 132 bp
fragments, which were not well resolved in the agarose gel. HinfI
digestion of Honduras-1 genomic DNA produced the 117 bp and the 132 bp
fragments only (lanes j,k,l), while digestions of FCR3 genomic DNA
produced the 210 bp, 132 bp and 117 bp DNA fragments (lanes a,b,c). The
results indicated that FCR3 genomic DNA contained oth alleles, but at
unequal levels. A comparison between the binding of the probe to the
genomic DNA and to both cloned alleles was made by optical density
analysis of the autoradiograms (FIG. 8). The copy number of allele I and
allele II was calculated to be 1.3 and 0.2 copies per FCR3 parasite based
on the P. falciparum genomic size of 30,000 kb. Only allele I of the SERA
gene was found in the P. falciparum Honduras-1 strain and was detected at
a level of 1.1 copy per parasite.
The copy number of allele I in FCR3 using probe A (probe A is specific for
allele I) was also determined. As expected, probe A only hybridized to
allele I (FIG. 9) and the copy number of allele I was determined to be 1.3
copies per parasite.
DISCUSSION
A lambda gt11 cDNA expression library was constructed from poly(A) RNA
prepared from trophozoite and schizont enriched cultures of P. falciparum.
About 1% of the clones containing cDNA inserts expressed antigens that
were recognized by a pooled antimalarial Nigerian serum. A cDNA gene bank
was established consisting of 288 independent antigen-expressing phage
that reacted with parasite inhibitory Nigerian serum that strongly reacts
with P. falciparum antigens. It was observed that a number of cDNA clones
were recognized by a parasite inhibitory mMAb, 43E5. H. Banyal et al., Am.
J. Trop. Med. Hyg., 34:1055-1064 (1985).
The cDNA#366 was sequenced and it exhibited a well conserved homology to
the partial genomic DNA sequence reported for a P. falciparum gene
previously designated pl26. J. L. Weber et al., Molecular Strategies of
Parasitic Invasion, Agabian, Goodman and Nogueira (eds.) p. 379-388, Alan
R. Liss, Inc. NY (1987)). We reported the first cDNA sequence for that
gene (pl26) and have significantly extended the gene's primary structural
information. Their sequence was from a clone isolated from a genomic DNA
library of the P. falciparum Camp strain screened by a monospecific rabbit
antiserum against an "exported" parasite antigen reported to be a 126 kDa
protein that was processed into antigens of 50, 47 and 18 kDa that were
released into the culture supernatant. DelPlace et al., Mol. Biochem.
Parsitol., 23:193-201 (1987). The mMAb 43E5 reacted with antigens of 40
and 35 kd at all stages of development by Western blot analysis, though it
reacted with greater intensity of binding to the schizont and merozoite
preparations. H. Banyal et al., Am. J. Trop. Med. Hyg., 34:1055-1064
(1985). Some parts of the 126 kDa schizont precursor protein (i.e., 40 and
35 kDa peptides) may remain associated with the schizonts and merozoites
and may be the only form of the original protein recognized by mMAb 43E5.
With the knowledge of the cDNA and amino acid sequence, we have been able
to establish a structural basis for developing a malarial vaccine based
upon the SERA gene.
Among the 288 pre-screened Nigerian positive clones, 2.8% (8 clones)
reacted with mMAb 43E5 and 5H10. These frequencies might reflect the
populations of each antibody in the pooled Nigerian serum that was used
for the pre-screening of the original cDNA expression library. The
estimation of the frequencies of clones that hybridized with cDNA#366 in
the total cDNA library was 1.5%. While neither the frequence of phage
plaques that are reactive with the mMAb nor the frequency of plaques that
hybridize with the cDNA probe can provide an unambiguous measure of the
relative expression of the gene coded for by the cDNAs, the results did
suggest that the gene was expressed at relatively high frequencies. This
was substantiated by the subsequent Northern blot analysis of the MRNA
obtained from trophozoites and schizonts (FIG. 4).
We have subsequently cloned and sequenced the genomic DNA constituting the
parasite SERA gene and its flanking sequence. The gene copy number was
found to be one per parasite, which means that the high levels of mRNA and
SERA protein are most likely related to a strong promoter which should be
located in the 5' flanking region of the gene. This sequence should
enhance our ability to increase production of the SERA antigen when cloned
and expressed in an appropriate host. In addition, the relation of the
first SERA gene intron to the signal sequence (FIGS. 5 and 6) provides the
potential for manipulating the signal sequence to improve the recovery of
the SERA protein from the cloned gene that will be used to produce a
genetically engineered protein.
In summary, the defining of the cDNA and gDNA sequences of the P.
falciparum SERA gene opens a number of avenues for utilization of this
knowledge for providing a vaccine and as a source of antigenic material to
be used in diagnostic tests.
Equivalents
Those skilled in the art will recognize or be able to ascertain, using no
more than routine experimentation, many equivalents to the specific
materials and components described herein. Such equivalents are intended
to be encompassed in the scope of the following claims.
Top