Back to EveryPatent.com
United States Patent | 6,008,200 |
Krieg | December 28, 1999 |
Oligonucleotides containing unthylated CpG dinucleotides and therapeutic utilities based on their ability to stimulate an immune response in a subject are disclosed. Also disclosed are therapies for treating diseases associated with immune system activation that are initiated by unthylated CpG dinucleotides in a subject comprising administering to the subject oligonucleotides that do not contain unmethylated CpG sequences (i.e. methylated CpG sequences or no CpG sequence) to outcompete unmethylated CpG nucleic acids for binding. Further disclosed are methylated CpG containing dinucleotides for use antisense therapies or as in vivo hybridization probes, and immunoinhibitory oligonucleotides for use as antiviral therapeutics.
Inventors: | Krieg; Arthur M. (Iowa City, IA) |
Assignee: | University of Iowa Research Foundation (Iowa City, IA) |
Appl. No.: | 386063 |
Filed: | February 7, 1995 |
Intern'l Class: | A61K 048/00; C12N 015/00 |
Field of Search: | 536/23.1,24.5,24.1 514/44 935/33,34,65,76 435/172.3,69.1,320.1,325,455,458 |
4956296 | Sep., 1990 | Fahnestock | 435/252. |
5234811 | Aug., 1993 | Beutler et al. | 435/6. |
5585479 | Dec., 1996 | Holze et al. | 536/24. |
5663153 | Sep., 1997 | Hutcherson et al. | 514/44. |
5723335 | Mar., 1998 | Hutcherson et al. | 435/375. |
5786189 | Jul., 1998 | Locht et al. | 435/455. |
Foreign Patent Documents | |||
0 468 520 A3 | Jan., 1992 | EP. | |
0 302 758 B1 | Mar., 1994 | EP. | |
PCT/US91/05815 | Aug., 1991 | WO. | |
PCT/US91/01327 | Sep., 1991 | WO. | |
PCT/US94/02471 | Mar., 1994 | WO. | |
WO 95/26204 | Oct., 1995 | WO. | |
WO 9602555 A1 | Feb., 1996 | WO. |
Ren jun et al., HCAPLUS Database, AN: 198874, Abstract, 1994. Anfossi et al., HCAPLUS Database, AN: 475562, Abstract, 1989. Stull et al., Pharmaceutical Res., vol. 12, 4:465-483, 1995. Mastranjelo et al., Seminars in Oncology, vol. 23, 1:4-21, 1996. Robert Whalen, Emerging Infectious Disease, vol. 2, 3:168-175, 1996. Etlinger, Immunology Today, vol. 13, 2:52-55, 1992. Sato et al., Science, vol. 273, 1996 : 352-354. Crystal, Science, vol. 270, pp. 404-410, 1995. Stein, C.A. et al. Oligodeoxynucleotides as inhibitors of gene expression: a review. Cancer Research 48:2659-2668, May 15, 1988. Wu, G.Y. et al. Receptor-mediated gene delivery and expression in vivo. J. Biological Chemistry 263:14621-14624, Oct. 15, 1988. Tanaka, T. et al. An antisense oligonucleotide comp;ementary to a sequence in IG2b germline transcripts, stimulates B cell DNA synthesis, and inhibits immunoglobulin secretion. J. Exp. Med. 175:597-607, Feb. 1, 1992. Tokunaga, et al., J Cancer Res, (Gann 1988), 79:682. Blaxter et al., Genes expressed in Brugia malayi infective third stage larvae, Molecular and Biochemical Parasitology, 77:77-93 (Apr. 1996). Fox , R.I., Mechanism of action of hydroxychloroquine as anantirheumatic drug, Chemical Abstracts 120:15, Abstract No.182630 (Apr. 29, 1994). Mottram et al., A novel CDC2-related protein kinase from leishmania mexicana,LmmCRK1, is post-translationally regulated during the life cycle, J. Biol. Chem. 268:28 21044-21052 (Oct. 1993). Schnell et al., Identification and characterization of a Saccharomyces cerevisiae gene (PAR1) conferring resistance to iron chelators, Eur. J. Biochem., 200:487-493. Wallace et al., Oligonucleotide probes for the screening of recombinant DNA libaries, Methods in Enzymology, 152:432-442 (1987). Azuma, I., "Biochemical and Immunological Studies on Cellular Components of Tubercle Bacilli", Kekkaku 67(9):45-55 (1992). Kataoka, T. et al., "Antitumor Activity of Synthetic Oligonucleotides with Sequences from cDNA Encoding Proteins of Mycobacterium bovis BCG", Jpn. J. Cancer Res. 83:244-247 (Mar. 1992). Kimura, Y., et al., "Binding of Oligoguanylate to Scavenger Receptors Is Required for Oligonucleotides to Augment NK Cell Activity and Induce IFN", J. Biochem. 116(5):991-994 (1994). Tokunaga, T., et al., "Synthetic Oligonucleotides with Particular Base Sequences from the cDNA Encoding Proteins of Mycobacterium bovis BCG Induce Interferons and Activate Natural Killer Cells", Microbiol. Immunol. 36(1):55-66 (1992). Yamamoto, S. et al., "DNA from Bacteria, but Not from Vertebrates, Induces Interferons, Activates Natural Killer Cells and Inhibits Tumor Growth", Microbiol. Immunol. 36(9):983-997 (1992). Yamamoto, S., "Mode of Action of Oligonucleotide Fraction Extracted From Mycobacterium bovis BCG", Kekkaku 69(9):29-32 (1994). Yamamoto, T. et al., "Ability of Oligonucleotides with Certain Palindromes to Induce Interferon Production and Augment Natural Killer Cell Activity Is Associated with Their Base Length", Antisense Res. and Devel. 4:119-123 (1994). Yamamoto, T. et al., "Lipofection of Synthetic Oligodeoxyribonucleotide Having a Palindromic Sequence of AACGTT to Murine Splenocytes Enhances Interferon Production and Natural Killer Activity", Microbiol. Immunol. 38(10):831-836 (1994). Yamamoto, T. et al., "Synthetic Oligonucleotides with Certain Palindromes Stimulate Interferon Production of Human Peripheral Blood Lymphocytes in vitro", Jpn. J. Cancer Res. 85:775-779 (1994). International Search Report for PCT/US95/01570 (Jul. 4, 1995). Yamamoto, Toshiko et al., "Ability of Oligonucleotides with Certain Palindromes to Induce Interferon Production and Augment Natural Killer Cell Activity is Associated with their Base Length", Antisense Research and Development, (1994), vol. 4, pp. 119-122. Azad, Raana F. et al., "Antivoral Activity of a Phosphorothioate Oligonucleotide Complementary to RNA of the Human Cytomegalovirus Major Immediate-Early Region", Antimicrobial Agents and Chemotherapy, (Sep. 1993), vol. 37, pp. 1945-1954. Messina et al., "The Influence of DNA Structure on the in vitro Stimulation of Murine Lymphocytes by Natural and Synthetic Polynucleotide Antigens", Cellular Immunology, (1993), vol. 147, pp. 148-157. Branda et al., "Immune Stimulation by an Antisense Oligomer Complementary to the rev gene of HIV-1", Biochemical Pharmacology, (1993), vol. 45, No. 10, pp. 2037-2043. Kuramoto et al., "Oligonucleotide Sequences Required for Natural Killer Cell Activation", Jpn. J. Cancer Res., (Nov. 1992), vol. 83, pp. 1128-1131. Yamamoto et al., "Unique Palindromic Sequences in Synthetic Oliognucleotides are Required to Induce INF and Augment INF-Mediated NAtural Killer Activity", The Journal of Immunology, (Jun. 15, 1992), vol. 148, No. 12, pp. 4072-4076. Kataoka, Tetsuro et al., "Antitumor Activity of Synthetic Oligonucleotides with Sequences from cDNA Encoding Proteins of Mycobacterium bovis BCG", Japan J. Cancer Res., (Mar. 1992), vol. 83, pp. 244-247. Tanaka et al., "An Antisense Oligonucleotide Complementary to a Sequence in I.gamma.2b Increases .gamma.2b Germline Transcripts, Stimulates B Cell DNA Synthesis, and Inhibits Immunoglobulin Secretion", The Journal of Experimental Medicine, (Feb. 1992), vol. 175, pp. 597-607. Tokunaga, Tohru et al., "Synthetic Oligonucleotides with Particular Base Sequences from the cDNA encoding Proteins of Mycobacterium bovis BCG Induce Interferons and Activate Natural Killer Cells", Microbiol. Immunol., (1992), vol. 36(1), pp. 55-66. Yamamoto, Saburop et al., "DNA from Bacteria, but not from Vertebrates, Induces Interferons, Activates Natural Killer Cells and Inhibits Tumor Growth", Microbiol. Immunol., (1992), vol. 36 (9), pp. 983-997. Messina et al., "Stimulation of in vitro Murine Lymphocyte Proliferation by Bacterial DNA", The Journal of Immunology, (Sep. 15, 1991), vol. 147, No. 6, pp. 1759-1764. Tokunaga et al., "A Synthetic Single-Stranded DNA, Ply (dG, dC), Induces Interferon .alpha./.beta. and -.gamma., Augments Natural Killer Activity and Suppresses Tumor Growth", Jpn. J. Cancer Res. (Gann), (Jun. 1988), vol. 79, pp. 682-686. |
TABLE 1 ______________________________________ Oligonucleotide Stimulation of B Cells Stimulation Index` .sup.3 H IgM ODN Sequence (5' to 3').dagger. Uridine Production ______________________________________ 1 (SEQ ID GCTAGACGTTAGCGT 6.1 .+-. 17.9 .+-. NO: 2) 0.8 3.6 1a (SEQ. ID ......T........ 1.2 .+-. 1.7 .+-. NO: 3) 0.2 0.5 1b (SEQ ID ......Z........ 1.2 .+-. 1.8 .+-. NO: 4) 0.1 0.0 1c (SEQ ID ............Z.. 10.3 .+-. 9.5 .+-. NO: 5) 4.4 1.8 1d (SEQ ID ..AT......GAGC. 13.0 .+-. 18.3 .+-. NO: 6) 2.3 7.5 2 (SEQ ID ATGGAAGGTCCAGCGTTCTC 2.9 .+-. 13.6 .+-. NO: 7) 0.2 2.0 2a (SEQ ID ..C..CTC..G......... 7.7 .+-. 24.2 .+-. NO: 8) 0.8 3.2 2b (SEQ ID ..Z..CTC.ZG..Z...... 1.6 .+-. 2.8 .+-. NO: 9) 0.5 2.2 2c (SEQ ID ..Z..CTC..G......... 3.1 .+-. 7.3 .+-. NO: 10) 0.6 1.4 2d (SEQ ID ..C..CTC..G......Z.. 7.4 .+-. 27.7 .+-. NO: 11) 1.4 5.4 2e (SEQ ID ............A....... 5.6 .+-. ND NO: 12) 2.0 3D (SEQ ID GAGAACGCTGGACCTTCCAT 4.9 .+-. 19.9 .+-. NO: 13) 0.5 3.6 3Da (SEQ ID .........C.......... 6.6 .+-. 33.9 .+-. NO: 14) 1.5 6.8 3Db (SEQ ID .........C.......G.. 10.1 .+-. 25.4 .+-. NO: 15) 2.8 0.8 3Dc (SEQ ID ...C.A.............. 1.0 .+-. 1.2 .+-. NO: 16) 0.1 0.5 3Dd (SEQ ID .....Z.............. 1.2 .+-. 1.0 .+-. NO: 17) 0.2 0.4 3De (SEQ ID .............Z...... 4.4 .+-. 18.8 .+-. NO: 18) 1.2 4.4 3Df (SEQ ID .......A............ 1.6 .+-. 7.7 .+-. NO: 19) 0.1 0.4 3Dg (SEQ ID .........CC.G.ACTG.. 6.1 .+-. 18.6 .+-. NO: 20) 1.5 1.5 3M (SEQ ID TCCATGTCGGTCCTGATGCT 4.1 .+-. 23.2 .+-. NO: 21) 0.2 4.9 3Ma (SEQ ID ......CT............ 0.9 .+-. 1.8 .+-. NO: 22) 0.1 0.5 3Mb (SEQ ID .......Z............ 1.3 .+-. 1.5 .+-. NO: 23) 0.3 0.6 3Mc (SEQ ID ...........Z........ 5.4 .+-. 8.5 .+-. NO: 24) 1.5 2.6 3Md (SEQ ID ......A..T.......... 17.2 .+-. ND NO: 25) 9.4 3Me (SEQ ID ...............C..A. 3.6 .+-. 14.2 .+-. NO: 26) 0.2 5.2 4 TCAACGTT 6.1 .+-. 19.2 .+-. 1.4 5.2 4a ....GC.. 1.1 .+-. 1.5 .+-. 0.2 1.1 4b ...GCGC. 4.5 .+-. 9.6 .+-. 0.2 3.4 4c ...TCGA. 2.7 .+-. ND 1.0 4d ..TT..AA 1.3 .+-. ND 0.2 4e ....... 1.3 .+-. 1.1 .+-. 0.2 0.5 4f C....... 3.9 .+-. ND 1.4 4g ......CT 1.4 .+-. ND 0.3 4h .......C 1.2 .+-. ND 0.2 LPS 7.8 .+-. 4.8 .+-. 2.5 1.0 ______________________________________ `Stimulation indexes are the means and std. dev. derived from at least 3 separate experiments, and are compared to wells cultured with no added ODN. ND = not done. CpG dinucleotides are underlined. Dots indicate identity; dashes indicate deletions. Z indicates 5 methyl cytosine.)
TABLE 2 ______________________________________ Cell Cycle Analysis with CpG ODN Percent of cells in Treatment G0 G1 SA + G2 + M ______________________________________ Media 97.6 2.4 0.02 ODN 1a 95.2 4.8 0.04 ODN 1d 2.7 74.4 22.9 ODN 3Db 3.5 76.4 20.1 LPS (30 .mu.g/ml) 17.3 70.5 12.2 ______________________________________
TABLE 3 ______________________________________ Induction Of NK Activity By CpG Oligodeoxynucleotides (ODN) % YAC-1 Specific Lysis* % 2C11 Specific Lysis Effector: Target Effector: Target ______________________________________ ODN 50:1 100:1 50:1 100:1 None -1.1 -1.4 15.3 16.6 1 16.1 24.5 38.7 47.2 3Db 17.1 27.0 37.0 40.0 non-CpG ODN -1.6 -1.7 14.8 15.4 ______________________________________
__________________________________________________________________________ # SEQUENCE LISTING - (1) GENERAL INFORMATION: - (iii) NUMBER OF SEQUENCES: 27 - (2) INFORMATION FOR SEQ ID NO:1: - (i) SEQUENCE CHARACTERISTICS: #pairs (A) LENGTH: 20 base (B) TYPE: nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear - (ii) MOLECULE TYPE: DNA - (xi) SEQUENCE DESCRIPTION: SEQ ID NO:1: # 20 GGGG - (2) INFORMATION FOR SEQ ID NO:2: - (i) SEQUENCE CHARACTERISTICS: #pairs (A) LENGTH: 15 base (B) TYPE: nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear - (ii) MOLECULE TYPE: DNA - (xi) SEQUENCE DESCRIPTION: SEQ ID NO:2: # 15 - (2) INFORMATION FOR SEQ ID NO:3: - (i) SEQUENCE CHARACTERISTICS: #pairs (A) LENGTH: 15 base (B) TYPE: nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear - (ii) MOLECULE TYPE: DNA - (xi) SEQUENCE DESCRIPTION: SEQ ID NO:3: # 15 - (2) INFORMATION FOR SEQ ID NO:4: - (i) SEQUENCE CHARACTERISTICS: #pairs (A) LENGTH: 15 base (B) TYPE: nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear - (ii) MOLECULE TYPE: DNA - (ix) FEATURE: (A) NAME/KEY: misc.sub.-- - #feature (B) LOCATION: 7 #"N indicates 5 methyl cytosine" - (xi) SEQUENCE DESCRIPTION: SEQ ID NO:4: # 15 - (2) INFORMATION FOR SEQ ID NO:5: - (i) SEQUENCE CHARACTERISTICS: #pairs (A) LENGTH: 15 base (B) TYPE: nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear - (ii) MOLECULE TYPE: DNA - (ix) FEATURE: (A) NAME/KEY: misc.sub.-- - #feature (B) LOCATION: 13 #"N indicates 5 methyl cytosine" - (xi) SEQUENCE DESCRIPTION: SEQ ID NO:5: # 15 - (2) INFORMATION FOR SEQ ID NO:6: - (i) SEQUENCE CHARACTERISTICS: #pairs (A) LENGTH: 15 base (B) TYPE: nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear - (ii) MOLECULE TYPE: DNA - (xi) SEQUENCE DESCRIPTION: SEQ ID NO:6: # 15 - (2) INFORMATION FOR SEQ ID NO:7: - (i) SEQUENCE CHARACTERISTICS: #pairs (A) LENGTH: 20 base (B) TYPE: nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear - (ii) MOLECULE TYPE: DNA - (xi) SEQUENCE DESCRIPTION: SEQ ID NO:7: # 20 TCTC - (2) INFORMATION FOR SEQ ID NO:8: - (i) SEQUENCE CHARACTERISTICS: #pairs (A) LENGTH: 20 base (B) TYPE: nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear - (ii) MOLECULE TYPE: DNA - (xi) SEQUENCE DESCRIPTION: SEQ ID NO:8: # 20 TCTC - (2) INFORMATION FOR SEQ ID NO:9: - (i) SEQUENCE CHARACTERISTICS: #pairs (A) LENGTH: 20 base (B) TYPE: nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear - (ii) MOLECULE TYPE: DNA - (ix) FEATURE: (A) NAME/KEY: misc.sub.-- - #feature (B) LOCATION: 3 #"N indicates 5 methyl cytosine" - (ix) FEATURE: (A) NAME/KEY: misc.sub.-- - #feature (B) LOCATION: 10 #"N indicates 5 methyl cytosine" - (ix) FEATURE: (A) NAME/KEY: misc.sub.-- - #feature (B) LOCATION: 14 #"N indicates 5 methyl cytosine" - (xi) SEQUENCE DESCRIPTION: SEQ ID NO:9: # 20 TCTC - (2) INFORMATION FOR SEQ ID NO:10: - (i) SEQUENCE CHARACTERISTICS: #pairs (A) LENGTH: 20 base (B) TYPE: nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear - (ii) MOLECULE TYPE: DNA - (ix) FEATURE: (A) NAME/KEY: misc.sub.-- - #feature (B) LOCATION: 3 #"N indicates 5 methyl cytosine" - (xi) SEQUENCE DESCRIPTION: SEQ ID NO:10: # 20 TCTC - (2) INFORMATION FOR SEQ ID NO:11: - (i) SEQUENCE CHARACTERISTICS: #pairs (A) LENGTH: 20 base (B) TYPE: nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear - (ii) MOLECULE TYPE: DNA - (ix) FEATURE: (A) NAME/KEY: misc.sub.-- - #feature (B) LOCATION: 18 #"N indicates 5 methyl cytosine" - (xi) SEQUENCE DESCRIPTION: SEQ ID NO:11: # 20 TNTC - (2) INFORMATION FOR SEQ ID NO:12: - (i) SEQUENCE CHARACTERISTICS: #pairs (A) LENGTH: 20 base (B) TYPE: nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear - (ii) MOLECULE TYPE: DNA - (xi) SEQUENCE DESCRIPTION: SEQ ID NO:12: # 20 TCTC - (2) INFORMATION FOR SEQ ID NO:13: - (i) SEQUENCE CHARACTERISTICS: #pairs (A) LENGTH: 20 base (B) TYPE: nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear - (ii) MOLECULE TYPE: DNA - (xi) SEQUENCE DESCRIPTION: SEQ ID NO:13: # 20 CCAT - (2) INFORMATION FOR SEQ ID NO:14: - (i) SEQUENCE CHARACTERISTICS: #pairs (A) LENGTH: 20 base (B) TYPE: nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear - (ii) MOLECULE TYPE: DNA - (xi) SEQUENCE DESCRIPTION: SEQ ID NO:14: # 20 CCAT - (2) INFORMATION FOR SEQ ID NO:15: - (i) SEQUENCE CHARACTERISTICS: #pairs (A) LENGTH: 20 base (B) TYPE: nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear - (ii) MOLECULE TYPE: DNA - (xi) SEQUENCE DESCRIPTION: SEQ ID NO:15: # 20 CGAT - (2) INFORMATION FOR SEQ ID NO:16: - (i) SEQUENCE CHARACTERISTICS: #pairs (A) LENGTH: 20 base (B) TYPE: nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear - (ii) MOLECULE TYPE: DNA - (xi) SEQUENCE DESCRIPTION: SEQ ID NO:16: # 20 CCAT - (2) INFORMATION FOR SEQ ID NO:17: - (i) SEQUENCE CHARACTERISTICS: #pairs (A) LENGTH: 20 base (B) TYPE: nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear - (ii) MOLECULE TYPE: DNA - (ix) FEATURE: (A) NAME/KEY: misc.sub.-- - #feature (B) LOCATION: 6 #"N indicates 5 methyl cytosine" - (xi) SEQUENCE DESCRIPTION: SEQ ID NO:17: # 20 CCAT - (2) INFORMATION FOR SEQ ID NO:18: - (i) SEQUENCE CHARACTERISTICS: #pairs (A) LENGTH: 20 base (B) TYPE: nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear - (ii) MOLECULE TYPE: DNA - (ix) FEATURE: (A) NAME/KEY: misc.sub.-- - #feature (B) LOCATION: 14 #"N indicates 5 methyl cytosine" - (xi) SEQUENCE DESCRIPTION: SEQ ID NO:18: # 20 CCAT - (2) INFORMATION FOR SEQ ID NO:19: - (i) SEQUENCE CHARACTERISTICS: #pairs (A) LENGTH: 20 base (B) TYPE: nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear - (ii) MOLECULE TYPE: DNA - (xi) SEQUENCE DESCRIPTION: SEQ ID NO:19: # 20 CCAT - (2) INFORMATION FOR SEQ ID NO:20: - (i) SEQUENCE CHARACTERISTICS: #pairs (A) LENGTH: 20 base (B) TYPE: nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear - (ii) MOLECULE TYPE: DNA - (xi) SEQUENCE DESCRIPTION: SEQ ID NO:20: # 20 TGAT - (2) INFORMATION FOR SEQ ID NO:21: - (i) SEQUENCE CHARACTERISTICS: #pairs (A) LENGTH: 20 base (B) TYPE: nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear - (ii) MOLECULE TYPE: DNA - (xi) SEQUENCE DESCRIPTION: SEQ ID NO:21: # 20 TGCT - (2) INFORMATION FOR SEQ ID NO:22: - (i) SEQUENCE CHARACTERISTICS: #pairs (A) LENGTH: 20 base (B) TYPE: nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear - (ii) MOLECULE TYPE: DNA - (xi) SEQUENCE DESCRIPTION: SEQ ID NO:22: # 20 TGCT - (2) INFORMATION FOR SEQ ID NO:23: - (i) SEQUENCE CHARACTERISTICS: #pairs (A) LENGTH: 20 base (B) TYPE: nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear - (ii) MOLECULE TYPE: DNA - (ix) FEATURE: (A) NAME/KEY: misc.sub.-- - #feature (B) LOCATION: 8 #"N indicates 5 methyl cytosine" - (xi) SEQUENCE DESCRIPTION: SEQ ID NO:23: # 20 TGCT - (2) INFORMATION FOR SEQ ID NO:24: - (i) SEQUENCE CHARACTERISTICS: #pairs (A) LENGTH: 20 base (B) TYPE: nucleic acid
(C) STRANDEDNESS: single (D) TOPOLOGY: linear - (ii) MOLECULE TYPE: DNA - (ix) FEATURE: (A) NAME/KEY: misc.sub.-- - #feature (B) LOCATION: 12 #"N indicates 5 methyl cytosine" - (xi) SEQUENCE DESCRIPTION: SEQ ID NO:24: # 20 TGCT - (2) INFORMATION FOR SEQ ID NO:25: - (i) SEQUENCE CHARACTERISTICS: #pairs (A) LENGTH: 20 base (B) TYPE: nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear - (ii) MOLECULE TYPE: DNA - (xi) SEQUENCE DESCRIPTION: SEQ ID NO:25: # 20 TGCT - (2) INFORMATION FOR SEQ ID NO:26: - (i) SEQUENCE CHARACTERISTICS: #pairs (A) LENGTH: 20 base (B) TYPE: nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear - (ii) MOLECULE TYPE: DNA - (xi) SEQUENCE DESCRIPTION: SEQ ID NO:26: # 20 TGAT - (2) INFORMATION FOR SEQ ID NO:27: - (i) SEQUENCE CHARACTERISTICS: #pairs (A) LENGTH: 20 base (B) TYPE: nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear - (ii) MOLECULE TYPE: DNA - (xi) SEQUENCE DESCRIPTION: SEQ ID NO:27: # 20 GGGG __________________________________________________________________________