Back to EveryPatent.com
United States Patent |
5,762,934
|
Williams
,   et al.
|
June 9, 1998
|
Clostridium difficile toxin disease therapy
Abstract
The present invention includes methods and compositions for treating humans
and other animals intoxicated with at least one clostridial toxin by
administration of antitoxin. In particular, the antitoxin directed against
these toxins is produced in avian species. This avian antitoxin is
designed so as to be orally administerable in therapeutic amounts and may
be in any form (i.e., as a solid or in aqueous solution).
Inventors:
|
Williams; James A. (Madison, WI);
Kink; John A. (Madison, WI);
Clemens; Christopher M. (Madison, WI);
Carroll; Sean B. (Cottage Grove, WI)
|
Assignee:
|
Ophidian Pharmaceuticals, Inc. (Madison, WI)
|
Appl. No.:
|
456847 |
Filed:
|
June 1, 1995 |
Current U.S. Class: |
424/157.1; 424/164.1; 424/167.1; 530/389.5 |
Intern'l Class: |
C07K 016/00; A61K 039/395 |
Field of Search: |
530/389.5
424/157.1,164.1,167.1
|
References Cited
U.S. Patent Documents
Other References
P.H.A. Sneath et al., "Clostridium," Bergey's Manual.RTM. of Systematic
Bacteriology, vol. 2, pp. 1141-1200, Williams & Wilkins (1986).
P.G. Engelkirk et al., "Classification", Principles and Practice of
Clinical Anaerobic Bacteriology, pp. 22-23, Star Publishing Co., Belmont,
CA (1992).
J. Stephen and R.A. Petrowski, "Toxins Which Traverse Membranes and
Deregulate Cells," Bacterial Toxins, 2d ed., pp. 66-67, American Society
for Microbiology (1986).
R. Berkow and A.J. Fletcher (eds.). "Bacterial Diseases," Merck Manual of
Diagnosis and Therapy, 16th ed., pp. 119-126, Merck Research Laboratories,
Rahway, N.J. (1992).
O.H. Siegmund and C.M. Fraser (eds.). "Clostridial Infections," Merck
Veterinary Manual, 5th ed., pp. 396-409, Merck & Co., Rahway, N.J. (1979).
C.L. Hatheway, "Toxigenic Clostridia," Clin. Microbiol. Rev. 3:66-98
(1990).
S. Arnon, "Infant Botulism: Anticipating the Second Decade," J. Infect.
Dis. 154:201-206 (1986).
S. Arnon, "Infant Botulism," Ann. Rev. Med. 31:541 (1980).
K.L. MacDonald et al., "The Changing Epidemiology of Adult Botulism in the
United States," Am. J. Epidemiol. 124:794 (1986).
C.O. Tacket et al, "Equine Antitoxin Use and Other Factors That Predict
Outcome in Type A Foodborne Botulism," Am. J. Med. 76-794 (1984).
M.N. Swartz, "Anaerobic Spore-Forming Bacilli: The Clostridia," pp.
633-646, in B.D. Davis et al.,(eds.), Microbiology, 4th edition, J.B.
Lippincott Co. (1990).
S. Arnon et al., "Infant Botulism: Epidemiology and Relation to Sudden
Infant Death Syndrome," Epidemiol. Rev. 3:45 (1981).
T.L. Frankovich and S. Arnon, "Clinical Trial of Botulism Immune Globulin
for Infant Botulism," West. J. Med. 154:103 (1991).
M. Balady, "Botulism Antitoxin Fielded for Operation Desert Storm," USAMRDC
Newsletter, p. 6 (1991).
P.J. Schwarz and S.S. Arnon, "Botulism Immune Globulin for Infant Botulism
Arrives-One Year and A Gulf War Later," Western J. Med. 156:197 (1992).
D.R. Peterson et al., "The Sudden Infant Death Syndrome and Infant
Botulism," Rev. Infect. Dis. 1:630 (1979).
S. Arnon et al., "Intestinal Infection and Toxin Production by Clostridium
Botulinum as One Cause of Sudden Infant Death Syndrome," Lancet, pp.
1273-1276, Jun. 17, 1978.
G.F. Brooks et al., (eds.) "Infections Caused by Anaerobic Bacteria,"
Jawetz, Melnick & Adelberg's Medical Microbiology, 19th ed., pp. 257-262,
Appleton & Lange, San Mateo, CA (1991).
P.G. Engelkirk et al., Principles and Practice of Clinical Anaerobic
Bacteriology, pp. 64-67, Star Publishing Co., Belmont, CA (1992).
D.M. Lyerly et al., "Characterization of a Toxin A-Negative, Toxin
B-Positive Strain of Clostridium difficile," Infect. Immun. 60:4633
(1992).
S.P. Borriello et al., "Virulence Factors of Clostridium difficile," Rev.
Infect. Dis., 12(suppl. 2):S185 (1990).
D.M. Lyerly et al., "Effects of Clostridium difficile Toxins Given
Intragastrically to Animals," Infect. Immun., 47:349 (1985).
R.D. Rolfe, "Binding Kinetics of Clostridium difficile Toxins A and B to
Intestinal Brush Border Membranes from Infant and Adult Hamsters," 59:1223
(1990).
Banno et al., "Biochemical Characterization and Biologic Actions of Two
Toxins (D-1 and D-2) from Clostridium difficile," Rev. Infect. Dis.,
6(Suppl. 1:S11-S20 (1984).
Rihn et al., "A New Purification Procedure for Clostridium Difficile
Enterotoxin," Biochem. Biophys. Res. Comm., 124:690-695 (1984).
Justus et al., "Myoelectric Effects of Clostridium difficile:
Motility-Altering Factors Distinct from its Cytotoxin and Enterotoxin in
Rabbits," Gastroenterol., 83:836-843 (1982).
S.M. Finegold et al., "Antimicrobial-Associated Pseudomembranous Colitis,"
Clinical Guide to Anaerobic Infections, pp. 88-89, Star Publishing Co.,
Belmont, CA (1992).
H.N. Benson et al., "Requirement of Avian C'1 for Fixation of Guinea Pig
Complement by Avian Antibody-Antigen Complexes," J. Immunol. 87:616
(1961).
A.A. Benedict and K. Yamaga, "Immunoglobulins and Antibody Production in
Avian Species," in Comparative Immunology (J.J. Marchaloni, ed.), pp.
335-375, Blackwell, Oxford (1966).
R. Patterson et al., "Antibody Production and Transfer to Egg Yolk in
Chickens," J. Immunol. 89:272 (1962).
S.B. Carroll and B.D. Stollar, "Antibodies of Calf Thymus RNA Polymerase II
from Egg Yolks of Immunized Hens," J. Biol. Chem. 258:24 (1983).
A. Polson et al., "Antibodies to Proteins from Yolk of Immunized Hens,"
Immunol. Comm. 9:495 (1980).
M. Delmee et al., "Characterization of Flagella of Clostridium difficile
and Their Role in Serogrouping Reactions," J. Clin. Microbiol.,
28(10):2210 (1990).
M. Delmee and V. Avesani, "Virulence of Ten Serogroups of Clostridium
difficile in Hamsters," J. Med. Microbiol., 33:85-90 (1990).
S. Toma et al., "Serotyping of Clostridium difficile," J. Clin. Microbiol.,
26(3):426 (1988).
M. Delmee et al., "Serogrouping of Clostridium difficile Strains by Slide
Agglutination," J. Clin. Microbiol., 21:323 (1985).
H.A. Davies and S.P. Boriello, "Detection of Capsule in Strains of
Clostridium difficile of Varying Virulence and Toxigenicity," Microbial
Path., 9:41 (1990).
M.A.C. Edelstein, "Processing Clinical Specimens for Anaerobic Bacteria:
Isolation and Identification Procedures," in S.M. Finegold et al (eds.).,
Bailey and Scott's Diagnostic Microbiology, pp. 477-507, C.V. Mosby Co.,
(1990).
N.V. Padhye et al., "Production and Characterization of a Monoclonal
Antibody Specific for Enterohemorrhagic Escherichia coli of Serotypes
0157:H7 and 026:H11," J. Clin. Microbiol. 29:99-103 (1990).
D.M. Lyerly et al., "Passive Immunization of Hamsters Against Disease
Caused by Clostridium difficile by Use of Bovine Immunoglobulin G
Concentrate," Infect. Immun., 59:2215-2218 (1991).
B.R. DasGupta & V. Sathyamoorthy, "Purification and Amino Acid Composition
of Type A Botulinum Neurotoxin," Toxicon, 22:415 (1984).
B.R. Singh & B.R. DasGupta, "Molecular Differences Between Type A Botulinum
Neurotoxin and Its Toxoid," Toxicon, 27:403 (1989).
H. Towbin et al., "Electrophoretic Transfer of Proteins from Polyacrylamide
Gels to Nitrocellulose Sheets: Procedure and Some Applications," Proc.
Nat'l Acad. Sci. USA, 76:4350 (1979).
K. Weber and M. Osborn, "Proteins and Sodium Dodecyl Sulfate: Molecular
Weight Determination on Polyacrylamide Gels and Related Procedures," The
Proteins, 3rd Edition (H. Neurath & R.L. Hill, eds), pp. 179-223,
(Academic Press, NY, 1975).
S.B. Carroll and A. Laughon, "Production and Purification of Polyclonal
Antibodies to the Foreign Segment of .beta.-galactosidase Fusion
Proteins," in DNA Cloning: A Practical Approach, vol. III, (D. Grover,
ed.), pp. 89-111, IRL Press, Oxford, (1987).
B.S. Thalley and S.B. Carroll, "Rattlesnake and Scorpion Antivenoms From
The Egg Yolks of Immunized Hens," Bio/Technology, 8:934-939 (1990).
J. Ohishi et al., "Oral Toxicities of Clostridium botulinum Toxins in
Response to Molecular Size," Infect. Immun., 16:106 (1977).
B.W. Wren et al., "Antigenic Cross-Reactivity and Functional Inhibition by
Antibodies to Clostridium difficile Toxin A, Streptococcus mutans
Glucan-Binding Protein, and a Synthetic Peptide," Infect. Immun.,
59:3151-3155 (1991).
M. Ehrich et al., "Production of Clostridium difficile Antitoxin," Infect.
Immun. 28:1041-1043 (1980).
Z.A. McGee et al., "Local Induction of Tumor Necrosis Factor as a Molecular
Mechanism of Mucosal Damage by Gonococci," Micorb. Path. 12:333-341
(1992).
R. Fekety, "Animal Models of Antibiotic-Induced Colitis," in O. Zak and M.
Sande (eds.). Experimental Models in Antimicrobial Chemotherapy, vol. 2,
pp. 61-72, (1986).
S.P. Borriello et al., "Clostridium difficile--A Spectrum of Virulence and
Analysis of Putative Virulence Determinants in the Hamster Model of
Antibiotic-Associated Colitis," J. Med. Microbiol., 24:53-64 (1987).
P-H Kim et al., "Immunization of Adult Hamsters Against Clostridium
difficile--Associated Heocecitis and Transfer of Protection to Infant
Hamsters," Immun., 55:2984-2992 (1987).
S.P. Borriello et al., "Mucosal Association by Clostridium difficile in The
Hamster Gastrointestinal Tract," J. Med. Microbiol., 25:191-196 (1988).
C.H. Dove et al., "Molecular Characterization of the Clostridium difficile
Toxin A Gene," Infect. Immun., 58:480-488 (1990).
J.A. Williams et al., "Preparation and Purification of Antibodies to
Foreign Proteins Produced in E. coli Using Plasmid Expression Vectors,"
DNA Cloning: Expression Systems, in press.
C. von Eichel-Streiber and M. Sauerborn, "Clostridium difficile Toxin A
Carries a C-Terminal Repetitive Structure Homologous to the Carbohydrate
Binding Region of Streptococcal Glycosyltransferases," Gene 96:107-113
(1990).
D.M. Lyerly et al., "Nonspecific Binding of Mouse Monoclonal Antibodies to
Clostridium difficile Toxins A and B," Curr. Microbiol., 19:303-306
(1989).
B.W. Wren and S. Tabaqchali, "Restriction Endonuclease DNA Analysis of
Clostridium difficile," J. Clin. Microbiol., 25:2402-2404 (1987).
Ausubel et al., Current Protocols in Molecular Biology (1989).
Sambrook et al., Molecular Cloning, A Laboratory Manual (1989).
Price et al., "Cloning of the Carbohydrate-binding Portion of the Toxin A
Gene of Clostridium difficile," Curr. Microbiol., 16:55-60 (1987).
H.C. Krivan et al., "Cell Surface Binding Site for Clostridium difficile
Enterotoxin: Evidence for a Glycoconjugate Containing the Sequence
Cal.alpha.1-3Gal.beta.1-4GlcNAc," Infect. Immun., 53:573 (1986).
T.A. Mietzner et al., "A Conjugated Synthetic Peptide Corresponding to the
C-terminal Region of Clostridium perfringens Type A Enterotoxin Elicits an
Enterotoxin-Neutralizing Antibody Response in Mice," Infec. Immun.,
60:3947-3951 (1992).
C. von Eichel-Streiber et al., "Cloning and Characterization of Overlapping
DNA Fragments of the Toxin A Gene of Clostridium difficile," J. Gen.
Microbiol., 135:55-64 (1989).
S.K. Kamiya et al., "Production of Monoclonal Antibody to Clostridium
difficile Toxin A which Neutralises Enterotoxicit but not
Haemagglutination Activity," FEMS Microbiology Lett., 81:311-316 (1991).
G.M. Thorne and S.L. Gorbach, "General Characteristics: Nomenclature of
Microbial Toxins," in Pharmacology of Bacterial Toxins, In: International
Encyclopedia of Pharmacology and Therapeutics, pp. 5-16, (Dorner and
Drews, Eds.) (Pergamom Press, Oxford) (1986).
|
Primary Examiner: Eisenschenk; Frank C.
Attorney, Agent or Firm: Medlen & Carroll, LLP
Parent Case Text
This application is a divisional of application Ser. No. 08/161,907, filed
Dec. 2, 1993, now U.S. Pat. No. 5,601,823, which is a Continuation-in-Part
of application Ser. No. 07/985,321, filed Dec. 4, 1992, which is a
continuation-in-part of two applications, the first being Ser. No.
07/842,709, filed Feb. 26, 1992 (abandoned), which is a
continuation-in-part of application Ser. No. 07/429,791, filed Oct. 31,
1989, which issued as U.S. Pat. No. 5,196,193 and the second being
application Ser. No. 07/429,791, filed Oct. 31, 1989, which issued as U.S.
Pat. No. 5,196,193.
Claims
We claim:
1. A method of treating intoxication by Clostridium difficile comprising
the steps:
a) providing:
i) a subject exposed to toxin A of Clostridium difficile
ii) an avian polyclonal antitoxin from egg yolk, in a therapeutic amount,
directed against Clostridium difficile toxin A, that is orally
administrable and suitable for administration to said subject for a
treatment period, wherein said avian polyclonal antitoxin neutralizes said
toxin A in vivo and promotes long-term recovery from disease symptoms
beyond the treatment period; and
b) orally administering said polyclonal antitoxin to said subject, wherein
said subject has not been previously treated with said neutralizing
polyclonal antitoxin.
2. The method of claim 1 wherein said antitoxin is in an aqueous solution.
3. The method of claim 2 wherein said aqueous solution comprises a
nutritional formula.
4. The method of claim 3 wherein said nutritional formula comprises infant
formula.
5. A method of prophylactically treating a subject for intoxication by
Clostridium difficile comprising the steps:
a) providing:
i) an avian polyclonal antibody from egg yolk, in a therapeutic amount,
directed against Clostridium difficile toxin A, that is orally
administrable and suitable for administration for a treatment period,
wherein said avian polyclonal antitoxin neutralizes said toxin and
promotes long-term recovery from Clostridial toxin disease symptoms beyond
the treatment period,
ii) a subject; and
b) orally administering said polyclonal antibody to said subject prior to
exposure of said subject to said Clostridium difficile toxin.
6. The method of claim 5 wherein said antitoxin is administered in an
aqueous solution.
7. The method of claim 6 wherein said aqueous solution comprises a
nutritional formula.
8. The method of claim 7 wherein said nutritional formula comprises infant
formula.
9. A method of treating intoxication by Clostridium difficile comprising
the steps:
a) providing:
i) a purified Clostridium difficile toxin, and
ii) an avian host;
b) immunizing said host with said purified Clostridium difficile toxin so
as to generate a polyclonal antitoxin from egg yolk of said immunized
host, wherein said antitoxin is suitable for administration to a subject
for a treatment period, wherein said antitoxin neutralizes said toxin and
promotes long-term recovery from disease symptoms beyond said treatment
period; and
c) orally administering said neutralizing polyclonal antitoxin in a
therapeutic amount to a subject exposed to said Clostridium difficile
toxin.
10. The method of claim 9 wherein said antitoxin is administered in an
aqueous solution.
11. The method of claim 10 wherein said aqueous solution comprises a
nutritional formula.
12. The method of claim 11 wherein said nutritional formula comprises
infant formula.
13. A method of treating intoxication from Clostridium difficile comprising
the steps:
a) providing:
i) a subject exposed to Clostridium difficile toxin A, and
ii) an avian polyclonal antitoxin from egg yolk, wherein said antitoxin is
directed against a portion of C. difficile toxin A encoded by the
restriction fragment of the C. difficile toxin A gene produced by
restriction of C. difficile toxin A genomic DNA with SpeI and PstI,
wherein said polyclonal antitoxin neutralizes said toxin in vivo and
wherein said antitoxin is suitable for administration for a treatment
period and promotes long-term recovery from disease symptoms beyond the
treatment period; and
b) orally administering said antitoxin to said subject.
14. The method of claim 13, wherein said antitoxin is in an aqueous
solution.
15. The method of claim 14, wherein said aqueous solution is a nutritional
formula.
16. The method of claim 15, wherein said nutritional formula comprises
infant formula.
Description
FIELD OF THE INVENTION
The present invention relates to clostridial antitoxin therapy for humans
and other animals.
BACKGROUND OF THE INVENTION
The genus Clostridium is comprised of gram-positive, anaerobic,
spore-forming bacilli. The natural habitat of these organisms if the
environment and the intestinal tracts of humans and other animals. Indeed,
clostridia are ubiquitous; they are commonly found in soil, dust, sewage,
marine sediments, decaying vegetation, and mud. ›See e.g., P.H.A. Sneath
et al., "Clostridium," Bergey's Manual.RTM. of Systematic Bacteriology,
Vol. 2, pp. 1141-1200, Williams & Wilkins (1986).! Despite the
identification of approximately 100 species of Clostridium, only a small
number have been recognized as relatively common etiologic agents of
medical and veterinary importance. Nonetheless, some of these species are
associated with very serious diseases, including botulism, tetanus,
anaerobic cellulitis, gas gangrene, bacteremia, pseudomembranous colitis,
and clostridial gastroenteritis. Table 1 lists some of the species of
medical and veterinary importance and the diseases with which they are
associated. As virtually all of these species have been isolated from
fecal samples of apparently healthy persons, some of these isolates may be
transient, rather than permanent residents of the colonic flora.
Nonetheless, as indicated in Table 1, the majority of these organisms may
be associated with serious and/or debilitating disease. In most cases, the
pathogenicity of these organisms is related to the release of powerful
exotoxins or highly destructive enzymes. Indeed, several species of the
genus Clostridium produce toxins and other enzymes of great medical and
veterinary significance. ›C. L. Hatheway, Clin. Microbiol. Rev. 3:66-98
(1990).!
TABLE 1
______________________________________
Clostridium Species of Medical and Veterinary Importance*
Species Disease
______________________________________
C. aminovalericum
Bacteriuria (pregnant women)
C. argentinense
Infected wounds; Bacteremia; Botulism;
Infections of amniotic fluid
C. baratii Infected war wounds; Peritonitis; Infectious
processes of the eye, ear and prostate
C. beijerinckikii
Infected wounds
C. bifermentans
Infected wounds; Abscesses; Gas Gangrene;
Bacteremia
C. botulinum Food poisoning; Botulism (wound,
food, infant)
C. butyricum Urinary tract, lower respiratory tract, pleural
cavity, and abdominal infections; Infected
wounds; Abscesses; Bacteremia
C. cadaveris Abscesses; Infected wounds
C. carnis Soft tissue infections; Bacteremia
C. chauvoei Blackleg
C. clostridioforme
Abdominal, cervical, scrotal, pleural, and
other infections; Septicemia; Peritonitis;
Appendicitis
C. cochlearium
Isolated from human disease processes,
but role in disease unknown.
C. difficile Antimicrobial-associated diarrhea; Pseudo-
membranous enterocolitis; Bacteremia;
Pyogenic infections
C. fallax Soft tissue infections
C. ghnoii Soft tissue infections
C. glycolicum Wound infections; Abscesses; Peritonitis
C. hastiforme Infected war wounds; Bacteremia; Abscesses
C. histolyticum
Infected war wounds; Gas gangrene;
Gingival plaque isolate
C. indolis Gastrointestinal tract infections
C. innocuum Gastrointestinal tract infections; Empyema
C. irregulare Penile lesions
C. leptum Isolated from human disease processes, but
role in disease unknown.
C. limosum Bacteremia; Peritonitis; Pulmonary infections
C. malenominatum
Various infectious processes
C. novyi Infected wounds; Gas gangrene; Blackleg,
Big head (ovine); Redwater disease (bovine)
C. oroticum Urinary tract infections; Rectal abscesses
C. paraputrificum
Bacteremia; Peritonitis; Infected wounds;
Appendicitis
C. perfringens
Gas gangrene; Anaerobic cellulitis; Intra-
abdominal abscesses; Soft tissue infections;
Food poisoning; Necrotizing pneumonia;
Empyema; Meningitis; Bacteremia; Uterine
Infections; Enteritis necrotans; Lamb
dysentery; Struck; Ovine Enterotoxemia
C. putrefaciens
Bacteriuria (Pregnant women with
bacteremia)
C. putrificum Abscesses; Infected wounds; Bacteremia
C. ramosum Infections of the abdominal cavity, genital
tract, lung, and biliary tract; Bacteremia
C. sartagoforme
Isolated from human disease processes, but
role in disease unknown.
C. septicum Gas gangrene; Bacteremia; Suppurative
infections; Necrotizing enterocolitis; Braxy
C. sordellii Gas gangrene; Wound infections; Penile
lesions; Bacteremia; Abscesses; Abdominal
and vaginal infections
C. sphenoides Appendicitis; Bacteremia; Bone and soft
tissue infections; Intraperitoneal infections;
Infected war wounds; Visceral gas gangrene;
Renal abscesses
C. sporogenes Gas gangrene; Bacteremia; Endocarditis;
central nervous system and pleuropulmonary
infections; Penile lesions; Infected war
wounds; Other pyogenic infections
C. subterminale
Bacteremia; Empyema; Biliary tract, soft
tissue and bone infections
C. symbiosum Liver abscesses; Bacteremia; Infections
resulting due to bowel flora
C. tertium Gas gangrene; Appendicitis; Brain abscesses;
Intestinal tract and soft tissue infections;
Infected war wounds; Periodontitis;
Bacteremia
C. tetani Tetanus; Infected gums and teeth; Corneal
ulcerations; Mastoid and middle ear
infections; Intraperitoneal infections; Tetanus
neonatorum; Postpartum uterine infections;
Soft tissue infections, especially related to
trauma (including abrasions and lacerations);
Infections related to use of contaminated
needles
C. thermosaccharolyticum
Isolated from human disease processes,
but role in disease unknown.
______________________________________
*Compiled from P. G. Engelkirk et al. Classification, Principles and
Practice of Clinical Anaerobic Bacteriology, pp. 22-23, Star Publishing
Co., Belmont, CA (1992); J. Stephen and R. A. Petrowski, "Toxins Which
Traverse Membranes and Deregulate Cells," in Bacterial Toxins, 2d ed., pp
66-67, American Society for Microbiology (1986); R. Berkow and A. J.
Fletcher (eds.), "Bacterial Diseases," Merck Manual of Diagnosis and
Therapy, 16th ed., pp. 116-126, Merck Research Laboratories, Rahway, N.J.
(1992); and O. H. Sigmund and C. M. Fraser (eds.), "Clostridial
Infections," Merck Veterinary Manual, 5th ed., pp. 396-409, Merck & Co.,
Rahway, N.J. (1979).
Perhaps because of their significance for human and veterinary medicine,
much research has been conducted on these toxins, in particular those of
C. botulinum and C. difficile.
C. botulinum
Several strains of Clostridium botulinum produce toxins of significance to
human and animal health. ›C. L. Hatheway, Clin. Microbiol. Rev. 3:66-98
(1990).! The effects of these toxins range from diarrheal diseases that
can cause destruction of the colon, to paralytic effects that can cause
death. Particularly at risk for developing clostridial diseases are
neonates and humans and animals in poor health (e.g., those suffering from
diseases associated with old age or immunodeficiency diseases).
Clostridium botulinum produces the most poisonous biological toxin known.
The lethal human dose is a mere 10.sup.-9 mg/kg bodyweight for toxin in
the bloodstream. Botulinal toxin blocks nerve transmission to the muscles,
resulting in flaccid paralysis. When the toxin reaches airway and
respiratory muscles, it results in respiratory failure that can cause
death. ›S. Arnon, J. Infect. Dis. 154:201-206 (1986).!
C. botulinum spores are carried by dust and are found on vegetables taken
from the soil, on fresh fruits, and on agricultural products such as
honey. Under conditions favorable to the organism, the spores germinate to
vegetative cells which produces toxin. ›S. Arnon, Ann. Rev. Med. 31:541
(1980).!
Botulism disease may be grouped into three types, based on the method of
introduction of toxin into the bloodstream. Food-borne botulism results
from ingesting improperly preserved and inadequately heated food that
contains botulinal toxin. There were 355 cases of food-borne botulism in
the United States between 1976 and 1984. ›K. L. MacDonald et al., Am. J.
Epidemiol. 124:794 (1986).! The death rate due to botulinal toxin is 12%
and can be higher in particular risk groups. ›C. O. Tacket et al., Am. J.
Med. 76:794 (1984).! Wound-induced botulism results from C. botulinum
penetrating traumatized tissue and producing toxin that is absorbed into
the bloodstream. Since 1950, thirty cases of wound botulism have been
reported. ›M. N. Swartz, "Anaerobic Spore-Forming Bacilli: The
Clostridia," pp. 633-646, in B. D. Davis et al.,(eds.), Microbiology, 4th
edition, J. B. Lippincott Co. (1990).! Infectious infant botulism results
from C. botulinum colonization of the infant intestine with production of
toxin and its absorption into the bloodstream. It is likely that the
bacterium gains entry when spores are ingested and subsequently germinate.
›S. Arnon, J. Infect. Dis. 154:201 (1986).! There have been 500 cases
reported since it was first recognized in 1976. ›M. N. Swartz, supra.!
Infant botulism strikes infants who are three weeks to eleven months old
(greater than 90% of the cases are infants less than six months). ›S.
Arnon, J. Infect. Dis. 154:201 (1986).! It is believed that infants are
susceptible, due, in large part, to the absence of the full adult
complement of intestinal microflora. The benign microflora present in the
adult intestine provide an acidic environment that is not favorable to
colonization by C. botulinum. Infants begin life with a sterile intestine
which is gradually colonized by microflora. Because of the limited
microflora present in early infancy, the intestinal environment is not as
acidic, allowing for C. bolulinum spore germination, growth, and toxin
production. In this regard, some adults who have undergone antibiotic
therapy which alters intestinal microflora become more susceptible to
botulism.
An additional factor accounting for infant susceptibility to infectious
botulism is the immaturity of the infant immune system. The mature immune
system is sensitized to bacterial antigens and produces protective
antibodies. Secretory IgA produced in the adult intestine has the ability
to agglutinate vegetative cells of C. botulinum. ›S. Arnon, J. Infect.
Dis. 154:201 (1986).! Secretory IgA may also act by preventing intestinal
bacteria and their products from crossing the cells of the intestine. ›S.
Arnon, Epidemiol. Rev. 3:45 (1981).! The infant immune system is not
primed to do this.
Clinical symptoms of infant botulism range from mild paralysis, to moderate
and severe paralysis requiring hospitalization, to fulminant paralysis,
leading to sudden death. ›S. Arnon, Epidemiol. Rev. 3:45 (1981).!
The chief therapy for severe infant botulism is ventilatory assistance
using a mechanical respirator and concurrent elimination of toxin and
bacteria using cathartics, enemas, and gastric lavage. There were 68
hospitalizations in California for infant botulism in a single year with a
total cost of over $4 million for treatment. ›T. L. Frankovich and S.
Arnon, West. J. Med. 154:103 (1991).!
Different strains of Clostridium botulinum each produce antigenically
distinct toxin designated by the letters A-G. Nearly all cases of infant
botulism have been caused by bacteria producing either type A or type B
toxin. (Exceptionally, one New Mexico case was caused by Clostridium
botulinum producing type F toxin and another by Clostridium botulinum
producing a type B-type F hybrid.) ›S. Arnon, Epidemiol. Rev. 3:45
(1981).! Type C toxin affects waterfowl, type D toxin affects cattle, and
type E toxin affects both humans and birds.
A trivalent antitoxin derived from horse plasma is commercially available
from Connaught Industries Ltd. as a therapy for toxin types A, B, and E.
However, the antitoxin has several disadvantages. First, extremely large
dosages must be injected intravenously and/or intramuscularly. Second, the
antitoxin has serious side effects such as acute anaphylaxis which can
lead to death, and serum sickness. Finally, the efficacy of the antitoxin
is uncertain and the treatment is costly. ›T. O. Tacket et al., Am. J.
Med. 76:794 (1984).!
A heptavalent equine botulinal antitoxin which uses only the F(ab')2
portion of the antibody molecule has been tested by the United States
Military. ›M. Balady, USAMRDC Newsletter, p. 6 (1991).! This was raised
against impure toxoids in those large animals and is not a high titer
preparation.
A pentavalent human antitoxin has been collected from immunized human
subjects for use as a treatment for infant botulism. The supply of this
antitoxin is limited and cannot be expected to meet the needs of all
individuals stricken with botulism disease. In addition, collection of
human sera must involve screening out HIV and other potentially serious
human pathogens. ›P. J. Schwarz and S. S. Arnon, Western J. Med. 156:197
(1992).!
Infant botulism has been implicated as the cause of mortality in some cases
of Sudden Infant Death Syndrome (SIDS, also known as crib death). SIDS is
officially recognized as infant death that is sudden and unexpected and
that remained unexplained despite complete post-mortem examination. The
link of SIDS to infant botulism came when fecal or blood specimens taken
at autopsy from SIDS infants were found to contain C. botulinum organisms
and/or toxin in 3-4% of cases analyzed. ›D. R. Peterson et al., Rev.
Infect. Dis. 1:630 (1979).! In contrast, only 1 of 160 healthy infants
(0.6%) had C. botulinum organisms in the feces and no botulinal toxin. (S.
Arnon et al, Lancet, pp. 1273-77, Jun. 17, 1978.)
In developed countries, SIDS is the number one cause of death in children
between one month and one year old. (S. Arnon et al., Lancet, pp. 1273-77,
Jun. 17, 1978.) More children die from SIDS in the first year than from
any other single cause of death in the first fourteen years of life. In
the United States, there are 8,000-10,000 SIDS victims annually. Id.
What is needed is an effective therapy against infant botulism that is free
of dangerous side effects, is available in large supply at a reasonable
price, and can be safely and gently delivered so that prophylactic
application to infants is feasible.
C. difficile
C. difficile, an organism which gained its name due to difficulties
encountered in its isolation, has recently been proven to be an etiologic
agent of diarrheal disease. (Sneath et al., p. 1165.). C. difficile is
present in the gastrointestinal tract of approximately 3% of healthy
adults, and 10-30% of neonates without adverse effect (Swartz, at p. 644);
by other estimates, C. difficile is a part of the normal gastrointestinal
flora of 2-10% of humans. ›G. F. Brooks et al., (eds.) "Infections Caused
by Anaerobic Bacteria," Jawetz, Melnick, & Adelberg's Medical
Microbiology, 19th ed., pp. 257-262, Appleton & Lange, San Mateo, Calif.
(1991).! As these organisms are relatively resistant to most commonly used
antimicrobials, when a patient is treated with antibiotics, the other
members of the normal gastrointestinal flora are suppressed and C.
difficile flourishes, producing cytopathic toxins and enterotoxins. It has
been found in 25% of cases of moderate diarrhea resulting from treatment
with antibiotics, especially the cephalosporins, clindamycin, and
ampicillin. ›M. N. Swartz at 644.!
Importantly, C. difficile is commonly associated with nosocomial
infections. The organism is often present in the hospital and nursing home
environments and may be carried on the hands and clothing of hospital
personnel who care for debilitated and immunocompromised patients. As many
of these patients are being treated with antimicrobials or other
chemotherapeutic agents, such transmission of C. difficile represents a
significant risk factor for disease. (Engelkirk et al., pp. 64-67.)
C. difficile is associated with a range of diarrhetic illness, ranging from
diarrhea alone to marked diarrhea and necrosis of the gastrointestinal
mucosa with the accumulation of inflammatory cells and fibrin, which forms
a pseudomembrane in the affected area. (Brooks et al.) It has been found
in over 95% of pseudomembranous enterocolitis cases. (Swartz, at p. 644.)
This occasionally fatal disease is characterized by diarrhea, multiple
small colonic plaques, and toxic megacolon. (Swartz, at p. 644.) Although
stool cultures are sometimes used for diagnosis, diagnosis is best made by
detection of the heat labile toxins present in fecal filtrates from
patients with enterocolitis due to C. difficile. (Swartz, at p. 644-645;
and Brooks et al., at p. 260.) C. difficile toxins are cytotoxic for
tissue/cell cultures and cause enterocolitis when injected intracecally
into hamsters. (Swartz, at p. 644.)
The enterotoxicity of C. difficile is primarily due to the action of two
toxins, designated A and B, each of approximately 300,000 in molecular
weight. Both are potent cytotoxins, with toxin A possessing direct
enterocytotoxic activity. ›Lyerly et al., Infect. Immun. 60:4633 (1992).!
Unlike toxin A of C. perfringens, an organism rarely associated with
antimicrobial-associated diarrhea, the toxin of C. difficile is not a
spore coat constituent and is not produced during sporulation. (Swartz, at
p. 644.) C. difficile toxin A causes fluid accumulation and mucosal damage
in rabbit ileal loops and appears to increase the uptake of toxin B by the
intestinal mucosa. Toxin B does not cause intestinal fluid accumulation,
but it is 1000 times more toxic than toxin A to tissue culture cells and
causes membrane damage. Both toxins are important in disease. ›Borriello
et al., Rev. Infect. Dis., 12(suppl. 2):S185 (1990); Lyerly et al.,
Infect. Immun., 47:349 (1985); and Rolfe, Infect. Immun., 59:1223 (1990).!
C. difficile has also been reported to produce other toxins such as an
enterotoxin different from toxins A and B ›Banno et al., Rev. Infect.
Dis., 6(Suppl. 1:S11-S20 (1984)!, a low molecular weight toxin ›Rihn et
al., Biochem. Biophys. Res. Comm., 124:690-695 (1984)!, a motility
altering factor ›Justus et al., Gastroenterol., 83:836-843 (1982)!, and
perhaps other toxins. Regardless, C. difficile gastrointestinal disease is
of primary concern.
It is significant that due to its resistance to most commonly used
antimicrobials, C. difficile is associated with antimicrobial therapy with
virtually all antimicrobial agents (although most commonly ampicillin,
clindamycin and cephalosporins). It is also associated with disease in
patients undergoing chemotherapy with such compounds as methotrexate,
5-fluorouracil, cyclophosphamide, and doxorubicin. ›S. M. Finegold et al.,
Clinical Guide to Anaerobic Infections, pp. 88-89, Star Publishing Co.,
Belmont, Calif. (1992).!
Treatment of C. difficile disease is problematic, given the high resistance
of the organism. Oral metronidazole, bacitracin and vancomycin have been
reported to be effective. (Finegold et al., p. 89.) However there are
problems associated with treatment utilizing these compounds. Vancomycin
is very expensive, some patients are unable to take oral medication, and
the relapse rate is high (20-25%), although it may not occur for several
weeks. Id.
C. difficile disease would be prevented or treated by neutralizing the
effects of these toxins in the gastrointestinal tract. Thus, what is
needed is an effective therapy against C. difficile toxin that is free of
dangerous side effects, is available in large supply at a reasonable
price, and can be safely delivered so that prophylactic application to
patients at risk of developing pseudomembranous enterocolitis can be
effectively treated.
DESCRIPTION OF THE DRAWINGS
FIG. 1 shows the reactivity of anti-C. botulinum IgY by Western blot.
FIG. 2 shows the IgY antibody titer to C. botulinum type A toxoid in eggs,
measured by ELISA.
FIG. 3 shows the results of C. difficile toxin A neutralization assays.
FIG. 4 shows the results of C. difficile toxin B neutralization assays.
FIG. 5 shows the results of C. difficile toxin B neutralization assays.
FIG. 6 is a restriction map of C. difficile toxin A gene, showing sequences
of primers 1-4(SEQ ID NOS:1-4).
FIG. 7 is a Western blot of C. difficile toxin A reactive protein.
FIG. 8 shows C. difficile toxin A expression constructs.
FIG. 9 shows C. difficile toxin A expression constructs.
FIG. 10 shows the purification of recombinant C. difficile toxin A.
FIG. 11 shows the results of C. difficile toxin A neutralization assays
with antibodies reactive to recombinant toxin A.
FIG. 12 shows the results for a C. difficile toxin A neutralization plate.
FIG. 13 shows the results for a C. difficile toxin A neutralization plate.
FIG. 14 shows the results of recombinant C. difficile toxin A
neutralization assays.
SUMMARY OF THE INVENTION
The present invention contemplates treating humans and other animals
intoxicated with a bacterial toxin by oral administration of antitoxin
raised against the toxin. In one embodiment, the present invention
contemplates a method of treatment comprising: a) providing: i) a subject
exposed to at least one clostridial toxin; ii) an avian neutralizing
antitoxin in a therapeutic amount that is orally administrable; and b)
orally administering the antitoxin to the subject, wherein the subject has
not been previously treated with neutralizing antitoxin. In a preferred
embodiment, the antitoxin comprises Clostridium difficile antitoxin. In a
preferred embodiments, antitoxin is administered in an aqueous solution.
In another preferred embodiment, the aqueous solution is a nutritional
formula. In an alternative embodiment the nutritional formula comprises
infant formula.
The present invention further contemplates a method of prophylactic
treatment comprising: a) providing: i) an avian antibody capable of
neutralizing at least one Clostridium difficile toxin, the antibody being
in therapeutic amount that is orally administrable, ii) a subject; and b)
orally administering the antibody to the subject prior to exposure of the
subject to Clostridium difficile toxin. In one embodiment, the antitoxin
is administered in an aqueous solution. In a preferred embodiment, the
aqueous solution is a nutritional formula. In an alternative embodiment
the nutritional formula comprises infant formula.
The present invention also contemplates a method of treatment comprising:
a) providing: i) a purified Clostridium difficile toxin, and ii) an avian
host; b) immunizing the host with the purified Clostridium difficile toxin
so as to generate a neutralizing antitoxin; and c) orally administering
the neutralizing antitoxin in a therapeutic amount to a subject exposed to
the toxin. In one embodiment, the antitoxin is administered in an aqueous
solution. In a preferred embodiment, the aqueous solution is a nutritional
formula. In an alternative embodiment the nutritional formula comprises
infant formula.
The present invention also contemplates a composition comprising avian
antitoxin directed against at least one Clostridium difficile toxin in
therapeutic amounts. In one embodiment, the antitoxin is orally
administrable. In a preferred embodiment, the aqueous solution is a
nutritional formula. In an alternative embodiment the nutritional formula
comprises infant formula. In a preferred embodiment, the antitoxin
composition is directed against a portion of at least one Clostridium
difficile toxin.
The present invention further contemplates a method of producing
clostridial toxin comprising: a) providing a host cell overproducing a
portion of clostridial toxin, wherein the portion comprises one or more
intervals of the toxin; and b) purifying the toxin portion. In one
embodiment, the interval is interval 4. In another embodiment, the
interval further comprises a ligand-binding domain. In one preferred
embodiment, the host cell is Escherichia coli. In another preferred
embodiment, the clostridial toxin is a toxin produced by Clostridium
difficile.
The present invention also contemplates a method of immunizing a host to
produce antitoxin directed against clostridial toxin comprising: a)
providing in any order: i) a host, and ii) one or more intervals of
clostridial toxin; and b) immunizing the host with purified clostridial
toxin so as to generate antitoxin. It is also contemplated that the
antitoxin be collected from the host. It is further contemplated that the
collected antitoxin will be purified. In one preferred embodiment the host
is an avian species. In another preferred embodiment, the clostridial
toxin is a toxin produced by Clostridium difficile. In an additional
preferred embodiment, the antitoxin is capable of neutralizing clostridial
toxin.
The present invention also contemplates a method of treatment comprising:
a) providing: i) a subject exposed to at least one clostridial toxin, and
ii) at least one neutralizing antitoxin directed against one or more
intervals of clostridial toxin; and b) orally administering antitoxin to
the subject. In a preferred embodiment the neutralizing antitoxin is an
avian antitoxin. In another preferred embodiment, the clostridial toxin is
a toxin produced by Clostridium difficile. In an alternative embodiment,
the antitoxin is directed against interval 4 of Clostridium difficile
toxin A.
DESCRIPTION OF THE INVENTION
The present invention contemplates treating humans and other animals
intoxicated with at least one bacterial toxin. It is contemplated that
oral administration of antitoxin will be used to treat patients effected
by or at risk of symptoms due to the action of bacterial toxins. The
organisms, toxins and individual steps of the present invention are
described separately below.
I. Clostridium Species, Clostridial Diseases And Associated Toxins
A preferred embodiment of the method of the present invention is directed
toward obtaining antibodies against Clostridium species, their toxins,
enzymes or other metabolic by-products, cell wall components, or synthetic
or recombinant versions of any of these compounds. It is contemplated that
these antibodies will be produced by immunization of humans or other
animals. It is not intended that the present invention be limited to any
particular toxin or any species of organism. In one embodiment, toxins
from all Clostridium species are contemplated as immunogens. Examples of
these toxins include the neuraminidase toxin of C. butyricum, C. sordellii
toxins HT and LT, and the numerous C. perfringens toxins. In one preferred
embodiment, toxins A, B, C, D, E, F, and G of C. botulinum are
contemplated as immunogens. In another preferred embodiment, toxins A and
B of C. difficile are contemplated as immunogens. Table 2 above lists
various Clostridium species, their toxins and some antigens associated
with disease.
TABLE 2
______________________________________
Clostridial Toxins
Organism Toxins and Disease-Associated Antigens
______________________________________
C. botulinum
A, B, C.sub.1, C.sub.2, D, E, F, G
C. butyricum
Neuraminidase
C. difficile
A, B, Enterotoxin (not A nor B), Motility Altering
Factor, Low Molecular Weight Toxin, Others
C. perfringens
.alpha., .beta., .epsilon., .iota., .gamma., .delta., .nu.,
.theta., .kappa., .lambda., .mu., .upsilon.
C. sordelli/
HT, LT, .alpha., .beta., .gamma.
C. bifermentans
C. novyi .alpha., .beta., .gamma., .delta., .epsilon., .zeta., .nu.,
.theta.
C. septicum
.alpha., .beta., .gamma., .delta.
C. histolyticum
.alpha., .beta., .gamma., .delta., .epsilon., plus additional
enzymes
C. chauvoei
.alpha., .beta., .gamma., .delta.
______________________________________
It is not intended that antibodies produced against one toxin will only be
used against that toxin. It is contemplated that antibodies directed
against one toxin (e.g., C. perfringens type A enterotoxin) may be used as
an effective therapeutic against one or more toxin(s) produced by other
members of the genus Clostridium or other toxin producing organisms (e.g.,
Bacillus cereus, Staphylococcus aureus, Streptococcus mutans,
Acinetobacter calcoaceticus, Pseudomonas aeruginosa, other Pseudomonas
species, etc.). It is further contemplated that antibodies directed
against the portion of the toxin which binds to mammalian membranes (e.g.,
C. perfringens enterotoxin A) can also be used against other organism. It
is contemplated that these membrane binding domains are produced
synthetically and used as immunogens.
II. Obtaining Antibodies In Non-Mammals
A preferred embodiment of the method of the present invention for obtaining
antibodies involves immunization. However, it is also contemplated that
antibodies could be obtained from non-mammals without immunization. In the
case where no immunization is contemplated, the present invention may use
non-mammals with preexisting antibodies to toxins as well as non-mammals
that have antibodies to whole organisms by virtue of reactions with the
administered antigen. An example of the latter involves immunization with
synthetic peptides or recombinant proteins sharing epitopes with whole
organism components.
In a preferred embodiment, the method of the present invention contemplates
immunizing non-mammals with bacterial toxin(s). It is not intended that
the present invention be limited to any particular toxin. In one
embodiment, toxin from all clostridial bacteria sources (see Table 2) are
contemplated as immunogens. Examples of these toxins are C. butyricum
neuraminidase toxin, C. difficile toxins A and B, C. perfringens toxins
.alpha., .beta., .epsilon., and .iota., and C. sordellii toxins HT and LT.
In a preferred embodiment, toxins A, B, C, D, E, F, and G from C.
botulinum are contemplated as immunogens.
When immunization is used, the preferred non-mammal is from the class Aves.
All birds are contemplated (e.g., duck, ostrich, emu, turkey, etc.). A
preferred bird is a chicken. Importantly, chicken antibody does not fix
mammalian complement. ›See H. N. Benson et al., J. Immunol. 87:616
(1961).! Thus, chicken antibody will normally not cause a
complement-dependent reaction. ›A. A. Benedict and K. Yamaga,
"Immunoglobulins and Antibody Production in Avian Species," in Comparative
Immunology (J. J. Marchaloni, ed.), pp. 335-375, Blackwell, Oxford
(1966).! Thus, the preferred antitoxins of the present invention will not
exhibit complement-related side effects observed with antitoxins known
presently.
When birds are used, it is contemplated that the antibody will be obtained
from either the bird serum or the egg. A preferred embodiment involves
collection of the antibody from the egg. Laying hens transport
immunoglobulin to the egg yolk ("IgY") in concentrations equal to or
exceeding that found in serum. ›See R. Patterson et al., J. Immunol.
89:272 (1962); and S. B. Carroll and B. D. Stollar, J. Biol. Chem. 258:24
(1983).! In addition, the large volume of egg yolk produced vastly exceeds
the volume of serum that can be safely obtained from the bird over any
given time period. Finally, the antibody from eggs is purer and more
homogeneous; there is far less non-immunoglobulin protein (as compared to
serum) and only one class of immunoglobulin is transported to the yolk.
When considering immunization with toxins, one may consider modification of
the toxins to reduce the toxicity. In this regard, it is not intended that
the present invention be limited by immunization with modified toxin.
Unmodified ("native") toxin is also contemplated as an immunogen.
It is also not intended that the present invention be limited by the type
of modification--if modification is used. The present invention
contemplates all types of toxin modification, including chemical and heat
treatment of the toxin. The preferred modification, however, is
formaldehyde treatment.
It is not intended that the present invention be limited to a particular
mode of immunization; the present invention contemplates all modes of
immunization, including subcutaneous, intramuscular, intraperitoneal, and
intravenous or intravascular injection, as well as per os administration
of immunogen.
The present invention further contemplates immunization with or without
adjuvant. (Adjuvant is defined as a substance known to increase the immune
response to other antigens when administered with other antigens.) If
adjuvant is used, it is not intended that the present invention be limited
to any particular type of adjuvant--or that the same adjuvant, once used,
be used all the time. While the present invention contemplates all types
of adjuvant, whether used separately or in combinations, the preferred use
of adjuvant is the use of Complete Freund's Adjuvant followed sometime
later with Incomplete Freund's Adjuvant.
When immunization is used, the present invention contemplates a wide
variety of immunization schedules. In one embodiment, a chicken is
administered toxin(s) on day zero and subsequently receives toxin(s) in
intervals thereafter. It is not intended that the present invention be
limited by the particular intervals or doses. Similarly, it is not
intended that the present invention be limited to any particular schedule
for collecting antibody. The preferred collection time is sometime after
day 100.
Where birds are used and collection of antibody is performed by collecting
eggs, the eggs may be stored prior to processing for antibody. It is
preferred that eggs be stored at 4.degree. C. for less than one year.
It is contemplated that chicken antibody produced in this manner can be
buffer-extracted and used analytically. While unpurified, this preparation
can serve as a reference for activity of the antibody prior to further
manipulations (e.g., imunoaffinity purification).
III. Increasing The Effectiveness Of Antibodies
When purification is used, the present invention contemplates purifying to
increase the effectiveness of both non-mammalian antitoxins and mammalian
antitoxins. Specifically, the present invention contemplates increasing
the percent of toxin-reactive immunoglobulin. The preferred purification
approach for avian antibody is polyethylene glycol (PEG) separation.
The present invention contemplates that avian antibody be initially
purified using simple, inexpensive procedures. In one embodiment, chicken
antibody from eggs is purified by extraction and precipitation with PEG
(PEG). PEG purification exploits the differential solubility of lipids
(which are abundant in egg yolks) and yolk proteins in high concentrations
of PEG 8000. ›Polson et al., Immunol. Comm. 9:495 (1980).! The technique
is rapid, simple, and relatively inexpensive and yields an immunoglobulin
fraction that is significantly purer in terms of contaminating
non-immunoglobulin proteins than the comparable ammonium sulfate fractions
of mammalian sera and horse antibodies. Indeed, PEG-purified antibody is
sufficiently pure that the present invention contemplates the use of
PEG-purified antitoxins in the passive immunization of intoxicated humans
and animals.
IV. Treatment
The present invention contemplates antitoxin therapy for humans and other
animals intoxicated by bacterial toxins. A preferred method of treatment
is by oral administration of antitoxin.
A. Dosage Of Antitoxin
It was noted by way of background that a balance must be struck when
administering currently available antitoxin which is usually produced in
large animals such as horses; sufficient antitoxin must be administered to
neutralize the toxin, but not so much antitoxin as to increase the risk of
untoward side effects. These side effects are caused by: i) patient
sensitivity to foreign (e.g, horse) proteins; ii) anaphylactic or
immunogenic properties of non-immunoglobulin proteins; iii) the complement
fixing properties of mammalian antibodies; and/or iv) the overall burden
of foreign protein administered. It is extremely difficult to strike this
balance when, as noted above, the degree of intoxication (and hence the
level of antitoxin therapy needed) can only be approximated.
The present invention contemplates significantly reducing side effects so
that this balance is more easily achieved. Treatment according to the
present invention contemplates reducing side effects by using PEG-purified
antitoxin from birds.
In one embodiment, the treatment of the present invention contemplates the
use of PEG-purified antitoxin from birds. The use of yolk-derived,
PEG-purified antibody as antitoxin allows for the administration of: 1)
non(mammalian)-complement-fixing, avian antibody; 2) a less heterogeneous
mixture of non-immunoglobulin proteins; and 3) less total protein to
deliver the equivalent weight of active antibody present in currently
available antitoxins. The non-mammalian source of the antitoxin makes it
useful for treating patients who are sensitive to horse or other mammalian
sera.
B. Delivery Of Antitoxin
Although it is not intended to limit the route of delivery, the present
invention contemplates a method for antitoxin treatment of bacterial
intoxication in which delivery of antitoxin is oral. In one embodiment,
antitoxin is delivered in a solid form (e.g., tablets). In an alternative
embodiment antitoxin is delivered in an aqueous solution. When an aqueous
solution is used, the solution has sufficient ionic strength to solubilize
antibody protein, yet is made palatable for oral administration. In one
embodiment the delivery solution is an aqueous solution. In another
embodiment the delivery solution is a nutritional formula. Preferably, the
delivery solution is infant formula.
The invention contemplates a method of treatment which can be administered
for treatment of acute intoxication. In one embodiment, antitoxin is
administered orally in either a delivery solution or in tablet form, in
therapeutic dosage, to a subject intoxicated by the bacterial toxin which
served as immunogen for the antitoxin.
The invention also contemplates a method of treatment which can be
administered prophylactically. In one embodiment, antitoxin is
administered orally, in a delivery solution, in therapeutic dosage, to a
subject, to prevent intoxication of the subject by the bacterial toxin
which served as immunogen for the production of antitoxin. In another
embodiment, antitoxin is administered orally in solid form such as
tablets. In one preferred embodiment the subject is an infant. In another
embodiment, antibody raised against whole bacterial organism is
administered orally to a subject, in a delivery solution, in therapeutic
dosage.
V. Detection Of Toxin
The invention contemplates detecting bacterial toxin in a sample. The term
"sample" in the present specification and claims is used in its broadest
sense. On the one hand it is meant to include a specimen or culture. On
the other hand, it is meant to include both biological and environmental
samples.
Biological samples may be animal, including human, fluid or tissue; liquid
and solid food products and ingredients such as dairy items, vegetables,
meat and meat by-products, and waste. Environmental samples include
environmental material such as surface matter, soil, water and industrial
samples, as well as samples obtained from food and dairy processing
instruments, apparatus, equipment, disposable and non-deposable items.
These examples are not to be construed as limiting the sample types
applicable to the present invention.
The invention contemplates detecting bacterial toxin by a method that
utilizes antitoxin raised against the toxin and a reporter substance. The
reporter substance comprises an antibody with binding specificity for the
antitoxin attached to a molecule which is used to identify the presence of
the reporter substance. The biological tissue is first exposed to
antitoxin which binds to toxin and is then washed free of substantially
all unbound antitoxin. The biological tissue is next exposed to the
reporter substance, which binds to antitoxin and is then washed free of
substantially all unbound reporter substance. Identification of the
reporter substance in the biological tissue indicates the presence of the
bacterial toxin.
It is also contemplated that bacterial toxin be detected by pouring liquids
(e.g., soups and other fluid foods and feeds including nutritional
supplements for humans and other animals) over immobilized antibody which
is directed against the bacterial toxin. It is contemplated that the
immobilized antibody will be present in or on such supports as cartridges,
columns, beads, or any other solid support medium. In one embodiment,
following the exposure of the liquid to the immobilized antibody, unbound
toxin is substantially removed by washing. The exposure of the liquid is
then exposed to a reporter substance which detects the presence of bound
toxin. In a preferred embodiment the reporter substance is an enzyme,
fluorescent dye, or radioactive compound attached to an antibody which is
directed against the toxin (i.e., in a "sandwich" immunoassay). It is also
contemplated that the detection system will be developed as necessary
(e.g., the addition of enzyme substrate in enzyme systems; observation
using fluorescent light for fluorescent dye systems; and quantitation of
radioactivity for radioactive systems).
EXPERIMENTAL
The following examples serve to illustrate certain preferred embodiments
and aspects of the present invention and are not to be construed as
limiting the scope thereof.
In the disclosure which follows, the following abbreviations apply:
.degree.C. (degrees Centigrade); rpm (revolutions per minute); BBS-Tween
(borate buffered saline containing Tween); BSA (bovine serum albumin);
ELISA (enzyme-linked immunosorbent assay); CFA (complete Freund's
adjuvant); IFA (incomplete Freund's adjuvant); IgG (immunoglobulin G); IgY
(immunoglobulin Y); I.M. (intramuscular); I.V. (intravenous or
intravascular); H.sub.2 O (water); HCl (hydrochloric acid); LD.sub.100
(lethal dose for 100% of experimental animals); kD (kilodaltons); gm
(grams); .mu.g (micrograms); mg (milligrams); ng (nanograms); .mu.l
(microliters); ml (milliliters); mm (millimeters); nm (nanometers); .mu.m
(micrometer); M (molar); mM (millimolar); MW (molecular weight); sec
(seconds); min(s) (minute/minutes); hr(s) (hour/hours); MgCl.sub.2
(magnesium chloride); NaCl (sodium chloride); Na.sub.2 CO.sub.3 (sodium
carbonate); OD.sub.280 (optical density at 280 nm); OD.sub.600 (optical
density at 600 nm); PAGE (polyacrylamide gel electrophoresis); PBS
›phosphate buffered saline (150 mM NaCl, 10 mM sodium phosphate buffer, pH
7.2)!; PEG (polyethylene glycol); SDS (sodium dodecyl sulfate); Tris
(tris(hydroxymethyl)aminomethane); Ensure.RTM. (Ensure.RTM., Ross
Laboratories, Columbus Ohio); Enfamil.RTM. (Enfamil.RTM., Mead Johnson);
w/v (weight to volume); v/v (volume to volume); Amicon (Amicon, Inc.,
Beverly, Mass.); Amresco (Amresco, Inc., Solon, Ohio); ATCC (American Type
Culture Collection, Rockville, Md.); BBL (Baltimore Biologics Laboratory,
(a division of Becton Dickinson), Cockeysville, Md.); Becton Dickinson
(Becton Dickinson Labware, Lincoln Park, N.J.); BioRad (BioRad, Richmond,
Calif.); Charles River (Charles River Laboratories, Wilmington, Mass.);
Cocalico (Cocalico Biologicals Inc., Reamstown, Pa); CytRx (CytRx Corp.,
Norcross, Ga.); Falcon (e.g. Baxter Healthcare Corp., McGaw Park, Ill. and
Becton Dickinson); Fisher Biotech (Fisher Biotech, Springfield, N.J.);
GIBCO (Grand Island Biologic Company/BRL, Grand Island, N.Y.); Harlan
Sprague Dawley (Harlan Sprague Dawley, Inc., Madison, Wis.); Mallinckrodt
(a division of Baxter Healthcare Corp., McGaw Park, Ill.); Millipore
(Millipore Corp., Marlborough, Mass.); New England Biolabs (New England
Biolabs, Inc., Beverly, Mass.); Novagen (Novagen, Inc., Madison, Wis.);
Sigma (Sigma Chemical Co., St. Louis, Mo.); Pharmacia (Pharmacia, Inc.,
Piscataway, N.J.); Sterogene (Sterogene, Inc., Arcadia, Calif.); Tech Lab
(Tech Lab, Inc., Blacksburg, Va.).
EXAMPLE 1
Production Of High-Titer Antibodies To Clostridium difficile Organisms In A
Hen
Antibodies to certain pathogenic organisms have been shown to be effective
in treating diseases caused by those organisms. It has not been shown
whether antibodies can be raised, against Clostridium difficile, which
would be effective in treating infection by this organism. Accordingly, C.
difficile was tested as immunogen for production of hen antibodies.
To determine the best course for raising high-titer egg antibodies against
whole C. difficile organisms, different immunizing strains and different
immunizing concentrations were examined. The example involved (a)
preparation of the bacterial immunogen, (b) immunization, (c) purification
of anti-bacterial chicken antibodies, and (d) detection of anti-bacterial
antibodies in the purified IgY preparations.
(a) Preparation Of Bacterial Immunogen. C. difficile strains 43594
(serogroup A) and 43596 (serogroup C) were originally obtained from the
ATCC. These two strains were selected because they represent two of the
most commonly-occurring serogroups isolated from patients with
antibiotic-associated pseudomembranous colitis. ›Delmee et al., J. Clin.
Microbiol., 28(10):2210 (1990).! Additionally, both of these strains have
been previously characterized with respect to their virulence in the
Syrian hamster model for C. difficile infection. ›Delmee et al., J. Med
Microbiol., 33:85 (1990).!
The bacterial strains were separately cultured on brain heart infusion agar
for 48 hours at 37.degree. C. in a Gas Pack 100 Jar (BBL, Cockeysville,
Md.) equipped with a Gas Pack Plus anaerobic envelope (BBL). Forty-eight
hour cultures were used because they produce better growth and the
organisms have been found to be more cross-reactive with respect to their
surface antigen presentation. The greater the degree of cross-reactivity
of our IgY preparations, the better the probability of a broad range of
activity against different strains/serogroups. ›Toma et al., J. Clin.
Microbiol., 26(3):426 (1988).!
The resulting organisms were removed from the agar surface using a sterile
dacron-tip swab, and were suspended in a solution containing 0.4%
formaldehyde in PBS, pH 7.2. This concentration of formaldehyde has been
reported as producing good results for the purpose of preparing
whole-organism immunogen suspensions for the generation of polyclonal
anti-C. difficile antisera in rabbits. ›Delmee et al., J. Clin.
Microbiol., 21:323 (1985); Davies et al., Microbial Path., 9:141 (1990).!
In this manner, two separate bacterial suspensions were prepared, one for
each strain. The two suspensions were then incubated at 4.degree. C. for 1
hour. Following this period of formalin-treatment, the suspensions were
centrifuged at 4,200.times.g for 20 min., and the resulting pellets were
washed twice in normal saline. The washed pellets, which contained
formalin-treated whole organisms, were resuspended in fresh normal saline
such that the visual turbidity of cach suspension corresponded to a #7
McFarland standard. ›M.A.C. Edelstein, "Processing Clinical Specimens for
Anaerobic Bacteria: Isolation and Identification Procedures," in S. M.
Finegold et al (eds.)., Bailey and Scott's Diagnostic Microbiology, pp.
477-507, C. V. Mosby Co., (1990). The preparation of McFarland
nephelometer standards and the corresponding approximate number of
organisms for each tube are described in detail at pp. 172-173 of this
volume.! Each of the two #7 suspensions was then split into two separate
volumes. One volume of each suspension was volumetrically adjusted, by the
addition of saline, to correspond to the visual turbidity of a #1
McFarland standard. ›Id.! The #1 suspensions contained approximately
3.times.10.sup.8 organisms/ml, and the #7 suspensions contained
approximately 2.times.10.sup.9 organisms/ml. ›Id.! The four resulting
concentration-adjusted suspensions of formalin-treated C. difficile
organisms were considered to be "bacterial immunogen suspensions." These
suspensions were used immediately after preparation for the initial
immunization. ›See section (b).!
The formalin-treatment procedure did not result in 100% non-viable bacteria
in the immunogen suspensions. In order to increase the level of killing,
the formalin concentration and length of treatment were both increased for
subsequent immunogen preparations, as described below in Table 3.
(Although viability was decreased with the stronger formalin treatment,
100% inviability of the bacterial immunogen suspensions was not reached.)
Also, in subsequent immunogen preparations, the formalin solutions were
prepared in normal saline instead of PBS. At day 49, the day of the fifth
immunization, the excess volumes of the four previous bacterial immunogen
suspensions were stored frozen at -70.degree. C. for use during all
subsequent immunizations.
(b) Immunization. For the initial immunization, 1.0 ml volumes of each of
the four bacterial immunogen suspensions described above were separately
emulsified in 1.2 ml volumes of CFA (GIBCO). For each of the four
emulsified immunogen suspensions, two four-month old White Leghorn hens
(pre-laying) were immunized. (It is not necessary to use pre-laying hens;
actively-laying hens can also be utilized.) Each hen received a total
volume of approximately 1.0 ml of a single emulsified immunogen suspension
via four injections (two subcutaneous and two intramuscular) of
approximately 250 .mu.l per site. In this manner, a total of four
different immunization combinations, using two hens per combination, were
initiated for the purpose of evaluating both the effect of immunizing
concentration on egg yolk antibody (IgY) production, and interstrain
cross-reactivity of IgY raised against heterologous strains. The four
immunization groups are summarized in Table 3.
TABLE 3
______________________________________
Immunization Groups
GROUP IMMUNIZING APPROXIMATE
DESIGNATION STRAIN IMMUNIZING DOSE
______________________________________
CD 43594, #1 C. difficile
1.5 .times. 10.sup.8 organisms/hen
strain 43594
CD 43594, #7 C. difficile
1.0 .times. 10.sup.9 organisms/hen
strain 43594
CD 43596, #1 C. difficile
1.5 .times. 10.sup.8 organisms/hen
strain 43596
CD 43596, #7 C. difficile
1.0 .times. 10.sup.9 organisms/hen
strain 43596
______________________________________
The time point for the first series of immunizations was designated as "day
zero." All subsequent immunizations were performed as described above
except that the bacterial immunogen suspensions were emulsified using IFA
(GIBCO) instead of CFA, and for the later time point immunization, the
stored frozen suspensions were used instead of freshly-prepared
suspensions. The immunization schedule used is listed in Table 4.
TABLE 4
______________________________________
Immunization Schedule
DAY OF FORMALIN- IMMUNOGEN
IMMUNIZATION TREATMENT PREPARATION USED
______________________________________
0 1%, 1 hr. freshly-prepared
14 1%, overnight
"
21 1%, overnight
"
35 1%, 48 hrs.
"
49 1%, 72 hrs.
"
70 " stored frozen
85 " "
105 " "
______________________________________
(c) Purification Of Anti-Bacterial Chicken Antibodies. Groups of four eggs
were collected per immunization group between days 80 and 84 post-initial
immunization, and chicken immunoglobulin (IgY) was extracted according to
a modification of the procedure of A. Polson et al., Immunol. Comm., 9:495
(1980). A gentle stream of distilled water from a squirt bottle was used
to separate the yolks from the whites, and the yolks were broken by
dropping them through a funnel into a graduated cylinder. The four
individual yolks were pooled for each group. The pooled, broken yolks were
blended with 4 volumes of egg extraction buffer to improve antibody yield
(egg extraction buffer is 0.01M sodium phosphate, 0.1M NaCl, pH 7.5,
containing 0.005% thimerosal), and PEG 8000 (Amresco) was added to a
concentration of 3.5%. When all the PEG dissolved, the protein
precipitates that formed were pelleted by centrifugation at 13,000.times.g
for 10 minutes. The supernatants were decanted and filtered through
cheesecloth to remove the lipid layer, and the PEG was added to the
supernatants to a final concentration of 12% (the supernatants were
assumed to contain 3.5% PEG). After a second centrifugation, the
supernatants were discarded and the pellets were centrifuged a final time
to extrude the remaining PEG. These crude IgY pellets were then dissolved
in the original yolk volume of egg extraction buffer and stored at
4.degree. C. As an additional control, a preimmune IgY solution was
prepared as described above, using eggs collected from unimmunized hens.
(d) Detection Of Anti-Bacterial Antibodies In The Purified IgY
Preparations. In order to evaluate the relative levels of specific anti-C.
difficile activity in the IgY preparations described above, a modified
version of the whole-organism ELISA procedure of N. V. Padhye et al., J.
Clin. Microbiol. 29:99-103 (1990) was used. Frozen organisms of both C.
difficile strains described above were thawed and diluted to a
concentration of approximately 1.times.10.sup.7 organisms/ml using PBS, pH
7.2. In this way, two separate coating suspensions were prepared, one for
each immunizing strain. Into the wells of 96-well microtiter plates
(Falcon, Pro-Bind Assay Plates) were placed 100 .mu.l volumes of the
coating suspensions. In this manner, each plate well received a total of
approximately 1.times.10.sup.6 organisms of one strain or the other. The
plates were then incubated at 4.degree. C. overnight. The next morning,
the coating suspensions were decanted, and all wells were washed three
times using PBS. In order to block non-specific binding sites, 100 .mu.l
of 0.5% BSA (Sigma) in PBS was then added to each well, and the plates
were incubated for 2 hours at room temperature. The blocking solution was
decanted, and 100 .mu.l volumes of the IgY preparations described above
were initially diluted 1:500 with a solution of 0.1% BSA in PBS, and then
serially diluted in 1:5 steps. The following dilutions were placed in the
wells: 1:500, 1:2,500, 1:62,5000, 1:312,500, and 1:1,562,500. The plates
were again incubated for 2 hours at room temperature. Following this
incubation, the IgY-containing solutions were decanted, and the wells were
washed three times using BBS-Tween (0.1M boric acid, 0.025M sodium borate,
1.0M NaCl, 0.1% Tween-20), followed by two washes using PBS-Tween (0.1%
Tween-20), and finally, two washes using PBS only. To each well, 100 .mu.l
of a 1:750 dilution of rabbit anti-chicken IgG (whole-molecule)-alkaline
phosphatase conjugate (Sigma) (diluted in 0.1% BSA in PBS) was added. The
plates were again incubated for 2 hours at room temperature. The conjugate
solutions were decanted and the plates were washed as described above,
substituting 50 mM Na.sub.2 CO.sub.3, pH 9.5 for the PBS in the final
wash. The plates were developed by the addition of 100 .mu.l of a solution
containing mg/ml para-nitrophenyl phosphate (Sigma) dissolved in 50 mM
Na.sub.2 CO.sub.3, 10 mM MgCl.sub.2, pH 9.5 to each well, and incubating
the plates at room temperature in the dark for 45 minutes. The absorbance
of each well was measured at 410 nm using a Dynatech MR 700 plate reader.
In this manner, each of the four IgY preparations described above was
tested for reactivity against both of the immunizing C. difficile strains;
strain-specific, as well as cross-reactive activity was determined.
TABLE 5
______________________________________
Results Of The Anti-C. difficile Whole-Organism ELISA
IgY DILUTION OF
43594-COATED
43596-COATED
PREPARATION
IgY PREP WELLS WELLS
______________________________________
CD 43594, #1
1:500 1.746 1.801
1:2,500 1.092 1.670
1:12,500 0.202 0.812
1:62,500 0.136 0.179
1:312,500 0.012 0.080
1:1,562,500
0.002 0.020
CD 43594, #7
1:500 1.780 1.771
1:2,500 1.025 1.078
1:12,500 0.188 0.382
1:62,500 0.052 0.132
1:312,500 0.022 0.043
1:1,562,500
0.005 0.024
CD 43596, #1
1:500 1.526 1.790
1:2,500 0.832 1.477
1:12,500 0.247 0.452
1:62,500 0.050 0.242
1:312,500 0.010 0.067
1:1,562,500
0.000 0.036
CD 43596, #7
1:500 1.702 1.505
1:2,500 0.706 0.866
1:12,500 0.250 0.282
1:62,500 0.039 0.078
1:312,500 0.002 0.017
1:1,562,500
0.000 0.010
Preimmune IgY
1:500 0.142 0.309
1:2,500 0.032 0.077
1:12,500 0.006 0.024
1:62,500 0.002 0.012
1:312,500 0.004 0.010
1:1,562,500
0.002 0.014
______________________________________
Table 5 shows the results of the whole-organism ELISA. All four IgY
preparations demonstrated significant levels of activity, to a dilution of
1:62,500 or greater against both of the immunizing organism strains.
Therefore, antibodies raised against one strain were highly cross-reactive
with the other strain, and vice versa. The immunizing concentration of
organisms did not have a significant effect on organism-specific IgY
production, as both concentrations produced approximately equivalent
responses. Therefore, the lower immunizing concentration of approximately
1.5.times.10.sup.8 organisms/hen is the preferred immunizing concentration
of the two tested. The preimmune IgY preparation appeared to possess
relatively low levels of C. difficile-reactive activity to a dilution of
1:500, probably due to prior exposure of the animals to environmental
clostridia.
An initial whole-organism ELISA was performed using IgY preparations made
from single CD 43594, #1 and CD 43596, #1 eggs collected around day 50
(data not shown). Specific titers were found to be 5 to 10-fold lower than
those reported in Table 5. These results demonstrate that it is possible
to begin immunizing hens prior to the time that they begin to lay eggs,
and to obtain high titer specific IgY from the first eggs that are laid.
In other words, it is not necessary to wait for the hens to begin laying
before the immunization schedule is started.
EXAMPLE 2
Treatment Of C. difficile Infection With Anti-C. difficile Antibody
In order to determine whether the immune IgY antibodies raised against
whole C. difficile organisms were capable of inhibiting the infection of
hamsters by C. difficile, hamsters infected by these bacteria were
utilized. ›Lyerly et al., Infect. Immun., 59:2215-2218 (1991).! This
example involved: (a) determination of the lethal dose of C. difficile
organisms; and (b) treatment of infected animals with immune antibody or
control antibody in nutritional solution.
(a) Determination Of The Lethal Dose Of C. difficile Organisms.
Determination of the lethal dose of C. difficile organisms was carried out
according to the model described by D. M. Lyerly et al., Infect. Immun.,
59:2215-2218 (1991). C. difficile strain ATCC 43596 (serogroup C, ATCC)
was plated on BHI agar and grown anaerobically (BBL Gas Pak 100 system) at
37.degree. C. for 42 hours. Organisms were removed from the agar surface
using a sterile dacron-tip swab and suspended in sterile 0.9% NaCl
solution to a density of 10.sup.8 organisms/ml.
In order to determine the lethal dose of C. difficile in the presence of
control antibody and nutritional formula, non-immune eggs were obtained
from unimmunized hens and a 12% PEG preparation made as described in
Example 1(c). This preparation was redissolved in one fourth the original
yolk volume of vanilla flavor Ensure.RTM..
Starting on day one, groups of female Golden Syrian hamsters (Harlan
Sprague Dawley), 8-9 weeks old and weighing approximately 100 gm, were
orally administered 1 ml of the preimmune/Ensure.RTM. formula at time
zero, 2 hours, 6 hours, and 10 hours. At 1 hour, animals were orally
administered 3.0 mg clindamycin HCl (Sigma) in 1 ml of water. This drug
predisposes hamsters to C. difficile infection by altering the normal
intestinal flora. On day two, the animals were given 1 ml of the preimmune
IgY/Ensure.RTM. formula at time zero, 2 hours, 6 hours, and 10 hours. At 1
hour on day two, different groups of animals were inoculated orally with
saline (control), or 10.sup.2, 10.sup.4, 10.sup.6, or 10.sup.8 C.
difficile organisms in 1 ml of saline. From days 3-12, animals were given
1 ml of the preimmune IgY/Ensure.RTM. formula three times daily and
observed for the onset of diarrhea and death. Each animal was housed in an
individual cage and was offered food and water ad libitum.
Administration of 10.sup.6 -10.sup.8 organisms resulted in death in 3-4
days while the lower doses of 10.sup.2 -10.sup.4 organisms caused death in
5 days. Cecal swabs taken from dead animals indicated the presence of C.
difficile. Given the effectiveness of the 10.sup.2 dose, this number of
organisms was chosen for the following experiment to see if hyperimmune
anti-C. difficile antibody could block infection.
(b) Treatment Of Infected Animals With Immune Antibody Or Control Antibody
In Nutritional Formula. The experiment in (a) was repeated using three
groups of seven hamsters each. Group A received no clindamycin or C.
difficile and was the survival control. Group B received clindamycin,
10.sup.2 C. difficile organisms and preimmune IgY on the same schedule as
the animals in (a) above. Group C received clindamycin, 10.sup.2 C.
difficile organisms, and hyperimmune anti-C. difficile IgY on the same
schedule as Group B. The anti-C. difficile IgY was prepared as described
in Example 1 except that the 12% PEG preparation was dissolved in one
fourth the original yolk volume of Ensure.RTM..
All animals were observed for the onset of diarrhea or other disease
symptoms and death. Each animal was housed in an individual cage and was
offered food and water ad libitum. The results are shown in Table 6.
TABLE 6
______________________________________
The Effect Of Oral Feeding Of Hyperimmune IgY Antibody
on C. difficile Infection
TIME TO TIME TO
ANIMAL GROUP DIARRHEA.sup.a
DEATH.sup.a
______________________________________
A pre-immune IgY only
no diarrhea
no deaths
B Clindamycin, C. difficile,
30 hrs. 49 hrs.
preimmune IgY
C Clindamycin, C. difficile,
33 hrs. 56 hrs.
immune IgY
______________________________________
.sup.a mean of seven animals.
Hamsters in the control group A did not develop diarrhea and remained
healthy during the experimental period. Hamsters in groups B and C
developed diarrheal disease. Anti-C. difficile IgY did not protect the
animals from diarrhea or death, all animals succumbed in the same time
interval as the animals treated with preimmune IgY. Thus, while
immunization with whole organisms apparently can improve sub-lethal
symptoms with particular bacteria (see U.S. Pat. No. 5,080,895 to H.
Tokoro), such an approach does not prove to be productive to protect
against the lethal effects of C. difficile.
EXAMPLE 3
Production of C. botulinum Type A Antitoxin in Hens
In order to determine whether antibodies could be raised against the toxin
produced by clostridial pathogens, which would be effective in treating
clostridial diseases, antitoxin to C. botulinum type A toxin was produced.
This example involves: (a) toxin modification; (b) immunization; (c)
antitoxin collection; (d) antigenicity assessment; and (e) assay of
antitoxin titer.
(a) Toxin Modification. C. botulinum type A toxoid was obtained from B. R.
DasGupta. From this, the active type A neurotoxin (M.W. approximately 150
kD) was purified to greater than 99% purity, according to published
methods. ›B. R. DasGupta & V. Sathyamoorthy, Toxicon, 22:415 (1984).! The
neurotoxin was detoxified with formaldehyde according to published
methods. ›B. R. Singh & B. R. DasGupta, Toxicon, 27:403 (1989).!
(b) Immunization. C. botulinum toxoid for immunization was dissolved in PBS
(1 mg/ml) and was emulsified with an approximately equal volume of CFA
(GIBCO) for initial immunization or IFA for booster immunization. On day
zero, two white leghorn hens, obtained from local breeders, were each
injected at multiple sites (intramuscular and subcutaneous) with 1 ml
inactivated toxoid emulsified in 1 ml CFA. Subsequent booster
immunizations were made according to the following schedule for day of
injection and toxoid amount: days 14 and 21-0.5 mg; day 171-075 mg; days
394, 401, 409-0.25 mg. One hen received an additional booster of 0.150 mg
on day 544.
(c) Antitoxin Collection. Total yolk immunoglobulin (IgY) was extracted as
described in Example 1(c) and the IgY pellet was dissolved in the original
yolk volume of PBS with thimerosal.
(d) Antigenicity Assessment. Eggs were collected from day 409 through day
423 to assess whether the toxoid was sufficiently immunogenic to raise
antibody. Eggs from the two hens were pooled and antibody was collected as
described in the standard PEG protocol. ›Example 1(c).! Antigenicity of
the botulinal toxin was assessed on Western blots. The 150 kD detoxified
type A neurotoxin and uumodified, toxic, 300 kD botulinal type A complex
(toxin used for intragastric route administration for animal gut
neutralization experiments; see Example 6) were separated on a
SDS-polyacrylamide reducing gel. The Western blot technique was performed
according to the method of Towbin. ›H. Towbin et al., Proc. Nat'l Acad.
Sci. USA, 76:4350 (1979).! Ten .mu.g samples of C. botulinum complex and
toxoid were dissolved in SDS reducing sample buffer (1% SDS, 0.5%
2-mercaptoethanol, 50 mM Tris, pH 6.8, 10% glycerol, 0.025% w/v bromphenol
blue, 10% .beta.-mercaptoethanol), heated at 95.degree. C. for 10 min and
separated on a 1 mm thick 5% SDS-polyacrylamide gel. ›K. Weber and M.
Osborn, "Proteins and Sodium Dodecyl Sulfate: Molecular Weight
Determination on Polyacrylamide Gels and Related Procedures," in The
Proteins, 3d Edition (H. Neurath & R. L. Hill, eds), pp. 179-223,
(Academic Press, N.Y., 1975).! Part of the gel was cut off and the
proteins were stained with Coomassie Blue. The proteins in the remainder
of the gel were transferred to nitrocellulose using the Milliblot-SDE
electro-blotting system (Millipore) according to manufacturer's
directions. The nitrocellulose was temporarily stained with 10% Ponceau S
›S. B. Carroll and A. Laughon, "Production and Purification of Polyclonal
Antibodies to the Foreign Segment of .beta.-galactosidase Fusion
Proteins," in DNA Cloning: A Practical Approach, Vol.III, (D. Glover,
ed.), pp. 89-111, IRL Press, Oxford, (1987)! to visualize the lanes, then
destained by running a gentle stream of distilled water over the blot for
several minutes. The nitrocellulose was immersed in PBS containing 3% BSA
overnight at 4.degree. C. to block any remaining protein binding sites.
The blot was cut into strips and each strip was incubated with the
appropriate primary antibody. The avian anti-C. botulinum antibodies
›described in (c)! and pre-immune chicken antibody (as control) were
diluted 1:125 in PBS containing 1 mg/ml BSA for 2 hours at room
temperature. The blots were washed with two changes each of large volumes
of PBS, BBS-Tween and PBS, successively (10 min/wash). Goat anti-chicken
IgG alkaline phosphatase conjugated secondary antibody (Fisher Biotech)
was diluted 1:500 in PBS containing 1 mg/ml BSA and incubated with the
blot for 2 hours at room temperature. The blots were washed with two
changes each of large volumes of PBS and BBS-Tween, followed by one change
of PBS and 0.1M Tris-HCl, pH 9.5. Blots were developed in freshly prepared
alkaline phosphatase substrate buffer (100 .mu.g/ml nitroblue tetrazolium
(Sigma), 50 .mu.g/ml 5-bromo-4-chloro-3-indolyl phosphate (Sigma), 5 mM
MgCI.sub.2 in 50 mM Na.sub.2 CO.sub.3, pH 9.5).
The Western blots are shown in FIG. 1. The anti-C. botulinum IgY reacted to
the toxoid to give a broad immunoreactive band at about 145-150 kD on the
reducing gel. This toxoid is refractive to disulfide cleavage by reducing
agents due to formalin crosslinking. The immune IgY reacted with the
active toxin complex, a 97 kD C. botulinum type A heavy chain and a 53 kD
light chain. The preimmune IgY was unreactive to the C. botulinum complex
or toxoid in the Western blot.
(e) Antitoxin Antibody Titer. The IgY antibody titer to C. botulinum type A
toxoid of eggs harvested between day 409 and 423 evaluated by ELISA, was
prepared as follows. Ninety-six-well Falcon Pro-bind plates were coated
overnight at 4.degree. C. with 100 .mu.l/well toxoid ›B. R. Singh & B. R.
Das Gupta, Toxicon 27:403 (1989)! at 2.5 .mu.g/ml in PBS, pH 7.5
containing 0.005% thimerosal. The following day the wells were blocked
with PBS containing 1% BSA for 1 hour at 37.degree. C. The IgY from immune
or preimmune eggs was diluted in PBS containing 1% BSA and 0.05% Tween 20
and the plates were incubated for 1 hour at 37.degree. C. The plates were
washed three times with PBS containing 0.05% Tween 20 and three times with
PBS alone. Alkaline phosphatase-conjugated goat-anti-chicken IgG (Fisher
Biotech) was diluted 1:750 in PBS containing 1% BSA and 0.05% Tween 20,
added to the plates, and incubated 1 hour at 37.degree. C. The plates were
washed as before, and p-nitrophenyl phosphate (Sigma) at 1 mg/ml in 0.05M
Na.sub.2 CO.sub.3, pH 9.5, 10 mM MgCl.sub.2 was added.
The results are shown in FIG. 2. Chickens immunized with the toxoid
generated high titers of antibody to the immunogen. Importantly, eggs from
both immunized hens had significant anti-immunogen antibody titers as
compared to preimmune control eggs. The anti-C. botulinum IgY possessed
significant activity, to a dilution of 1:93,750 or greater.
EXAMPLE 4
Preparation Of Avian Egg Yolk Immunoglobulin In An Orally Administrable
Form
In order to administer avian IgY antibodies orally to experimental mice, an
effective delivery formula for the IgY had to be determined. The concern
was that if the crude IgY were dissolved in PBS, the saline in PBS would
dehydrate the mice, which might prove harmful over the duration of the
study. Therefore, alternative methods of oral administration of IgY were
tested. The example involved: (a) isolation of immune IgY; (b)
solubilization of IgY in water or PBS, including subsequent dialysis of
the IgY-PBS solution with water to eliminate or reduce the salts (salt and
phosphate) in the buffer; and (c) comparison of the quantity and activity
of recovered IgY by absorbance at 280 nm and PAGE, and enzyme-linked
immunoassay (ELISA).
(a) Isolation Of Immune IgY. In order to investigate the most effective
delivery formula for IgY, we used IgY which was raised against Crotalus
durissus terrificus venom. Three eggs were collected from hens immunized
with the C. durissus terrificus venom and IgY was extracted from the yolks
using the modified Polson procedure described by Thalley and Carroll
›Bio/Technology, 8:934-938 (1990)! as described in Example 1(c).
The egg yolks were separated from the whites, pooled, and blended with four
volumes of PBS. Powdered PEG 8000 was added to a concentration of 3.5%.
The mixture was centrifuged at 10,000 rpm for 10 minutes to pellet the
precipitated protein, and the supernatant was filtered through cheesecloth
to remove the lipid layer. Powdered PEG 8000 was added to the supernatant
to bring the final PEG concentration to 12% (assuming a PEG concentration
of 3.5% in the supernatant). The 12% PEG/IgY mixture was divided into two
equal volumes and centrifuged to pellet the IgY.
(b) Solubilization Of The IgY In Water Or PBS. One pellet was resuspended
in 1/2 the original yolk volume of PBS, and the other pellet was
resuspended in 1/2 the original yolk volume of water. The pellets were
then centrifuged to remove any particles or insoluble material. The IgY in
PBS solution dissolved readily but the fraction resuspended in water
remained cloudy.
In order to satisfy anticipated sterility requirements for orally
administered antibodies, the antibody solution needs to be
filter-sterilized (as an alternative to heat sterilization which would
destroy the antibodies). The preparation of IgY resuspended in water was
too cloudy to pass through either a 0.2 or 0.45 .mu.m membrane filter, so
10 ml of the PBS resuspended fraction was dialyzed overnight at room
temperature against 250 ml of water. The following morning the dialysis
chamber was emptied and refilled with 250 ml of fresh H.sub.2 O for a
second dialysis. Thereafter, the yields of soluble antibody were
determined at OD.sub.280 and are compared in Table 7.
TABLE 7
______________________________________
Dependence of IgY Yield On Solvents
ABSORBANCE OF 1:10
PERCENT
FRACTION DILUTION AT 280 nm
RECOVERY
______________________________________
PBS dissolved 1.149 100%
H.sub.2 O dissolved
0.706 61%
PBS dissolved/H.sub.2 O dialyzed
0.885 77%
______________________________________
Resuspending the pellets in PBS followed by dialysis against water
recovered more antibody than directly resuspending the pellets in water
(77% versus 61%). Equivalent volumes of the IgY preparation in PBS or
water were compared by PAGE, and these results were in accordance with the
absorbance values (data not shown).
(c) Activity Of IgY Prepared With Different Solvents. An ELISA was
performed to compare the binding activity of the IgY extracted by each
procedure described above. C. durissus terrificus (C.d.t.) venom at 2.5
.mu.g/ml in PBS was used to coat each well of a 96-well microtiter plate.
The remaining protein binding sites were blocked with PBS containing 5
mg/ml BSA. Primary antibody dilutions (in PBS containing 1 mg/ml BSA) were
added in duplicate. After 2 hours of incubation at room temperature, the
unbound primary antibodies were removed by washing the wells with PBS,
BBS-Tween, and PBS. The species specific secondary antibody (goat
anti-chicken immunoglobulin alkaline-phosphatase conjugate (Sigma) was
diluted 1:750 in PBS containing 1 mg/ml BSA and added to each well of the
microtiter plate. After 2 hours of incubation at room temperature, the
unbound secondary antibody was removed by washing the plate as before, and
freshly prepared alkaline phosphatase substrate (Sigma) at 1 mg/ml in 50
mM Na.sub.2 CO.sub.3, 10 mM MgCl.sub.2, pH 9.5 was added to each well. The
color development was measured on a Dynatech MR 700 microplate reader
using a 412 nm filter. The results are shown in Table 8.
The binding assay results parallel the recovery values in Table 7, with
PBS-dissolved IgY showing slightly more activity than the
PBS-dissolved/H.sub.2 O dialyzed antibody. The water-dissolved antibody
had considerably less binding activity than the other preparations.
EXAMPLE 5
Survival Of Antibody Activity After Passage Through The Gastrointestinal
Tract
In order to determine the feasibility of oral administration of antibody,
it was of interest to determine whether orally administered IgY survived
passage through the gastrointestinal tract. The example involved: (a) oral
administration of specific immune antibody mixed with a nutritional
formula; and (b) assay of antibody activity extracted from feces.
TABLE 8
______________________________________
Antigen-Binding Activity of IgY Prepared with Different Solvents
PBS H.sub.2 O
PBS/
DILUTION PREIMMUNE DISSOLVED DISSOLVED
H.sub.2 O
______________________________________
1:500 0.005 1.748 1.577 1.742
1:2,500 0.004 0.644 0.349 0.606
1:12,500 0.001 0.144 0.054 0.090
1:62,500 0.001 0.025 0.007 0.016
1:312,500
0.010 0.000 0.000 0.002
______________________________________
(a) Oral Administration Of Antibody. The IgY preparations used in this
example are the same PBS-dissolved/H.sub.2 O dialyzed antivenom materials
obtained in Example 4 above, mixed with an equal volume of Enfamil.RTM..
Two mice were used in this experiment, each receiving a different diet as
follows:
1) water and food as usual;
2) immune IgY preparation dialyzed against water and mixed 1:1 with
Enfamil.RTM.. (The mice were given the corresponding mixture as their only
source of food and water).
(b) Antibody Activity After Ingestion. After both mice had ingested their
respective fluids, each tube was refilled with approximately 10 ml of the
appropriate fluid first thing in the morning. By mid-morning there was
about 4 to 5 ml of liquid left in each tube. At this point stool samples
were collected from each mouse, weighed, and dissolved in approximately
500 .mu.l PBS per 100 mg stool sample. One hundred and sixty mg of control
stools (no antibody) and 99 mg of experimental stools (specific antibody)
in 1.5 ml microfuge tubes were dissolved in 800 and 500 .mu.l PBS,
respectively. The samples were heated at 37.degree. C. for 10 minutes and
vortexed vigorously. The experimental stools were also broken up with a
narrow spatula. Each sample was centrifuged for 5 minutes in a microfuge
and the supernatants, presumably containing the antibody extracts, were
collected. The pellets were saved at 2.degree.-8.degree. C. in case future
extracts were needed. Because the supernatants were tinted, they were
diluted five-fold in PBS containing 1 mg/ml BSA for the initial dilution
in the enzyme immunoassay (ELISA). The primary extracts were then diluted
five-fold serially from this initial dilution. The volume of primary
extract added to each well was 190 .mu.l. The ELISA was performed exactly
as described in Example 4.
TABLE 9
______________________________________
Specific Antibody Activity After Passage
Through the Gastrointestinal Tract
CONTROL
FECAL EXP. FECAL
DILUTION
PREIMMUNE IgY EXTRACT EXTRACT
______________________________________
1:5 <0 0.000 0.032
1:25 0.016 <0 0.016
1:125 <0 <0 0.009
1:625 <0 0.003 0.001
1:3125 <0 <0 0.000
______________________________________
There was some active antibody in the fecal extract from the mouse given
the specific antibody in Enfamil.RTM. formula, but it was present at a
very low level. Since the samples were assayed at an initial 1:5 dilution,
the binding observed could have been higher with less dilute samples.
Consequently, the mice were allowed to continue ingesting either regular
food and water or the specific IgY in Enfamil.RTM. formula, as
appropriate, so the assay could be repeated. Another ELISA plate was
coated overnight with 5 .mu.g/ml of C.d.t. venom in PBS.
The following morning the ELISA plate was blocked with 5 mg/ml BSA, and the
fecal samples were extracted as before, except that instead of heating the
extracts at 37.degree. C., the samples were kept on ice to limit
proteolysis. The samples were assayed undiluted initially, and in 5.times.
serial dilutions thereafter. Otherwise the assay was carried out as
before.
TABLE 10
______________________________________
Specific Antibody Survives Passage Through
The Gastrointestinal Tract
CONTROL
DILUTION PREIMMUNE IgY
EXTRACT EXP. EXTRACT
______________________________________
undiluted
0.003 <0 0.379
1:5 <0 <0 0.071
1:25 0.000 <0 0.027
1:125 0.003 <0 0.017
1:625 0.000 <0 0.008
1:3125 0.002 <0 0.002
______________________________________
The experiment confirmed the previous results, with the antibody activity
markedly higher. The control fecal extract showed no anti-C.d.t. activity,
even undiluted, while the fecal extract from the anti-C.d.t.
IgY/Enfamil.RTM.-fed mouse showed considerable anti-C.d.t. activity. This
experiment (and the previous experiment) clearly demonstrate that active
IgY antibody survives passage through the mouse digestive tract, a finding
with favorable implications for the success of IgY antibodies administered
orally as a therapeutic or prophylactic.
EXAMPLE 6
In Vivo Neutralization Of Type C. botulinum
Type A Neurotoxin By Avian Antitoxin Antibody
This example demonstrated the ability of PEG-purified antitoxin, collected
as described in Example 3, to neutralize the lethal effect of C. botulinum
neurotoxin type A in nice. To determine the oral lethal dose (LD.sub.100)
of toxin A, groups of BALB/c mice were given different doses of toxin per
unit body weight (average body weight of 24 grams). For oral
administration, toxin A complex, which contains the neurotoxin associated
with other non-toxin proteins was used. This complex is markedly more
toxic than purified neurotoxin when given by the oral route. ›I. Ohishi et
al., Infect. Immun., 16:106 (1977).! C. botulinum toxin type A complex,
obtained from Eric Johnson (University Of Wisconsin, Madison) was 250
.mu.g/ml in 50 mM sodium citrate, pH 5.5, specific toxicity
3.times.10.sup.7 mouse LD.sub.50 /mg with parenteral administration.
Approximately 40-50 ng/gm body weight was usually fatal within 48 hours in
mice maintained on conventional food and water. When mice were given a
diet ad libitum of only Enfamil.RTM. the concentration needed to produce
lethality was approximately 2.5 times higher (125 ng/gm body weight).
Botulinal toxin concentrations of approximately 200 ng/gm body weight were
fatal in mice fed Enfamil.RTM. containing preimmune IgY (resuspended in
Enfamil.RTM. at the original yolk volume).
The oral LD.sub.100 of C. botulinum toxin was also determined in mice that
received known amounts of a mixture of preimmune IgY-Ensure.RTM. delivered
orally through feeding needles. Using a 22 gauge feeding needle, mice were
given 250 .mu.l each of a preimmune IgY-Ensure.RTM. mixture (preimmune IgY
dissolved in 1/4 original yolk volume) 1 hour before and 1/2 hour and 5
hours after administering botulinal toxin. Toxin concentrations given
orally ranged from approximately 12 to 312 ng/gm body weight (0.3 to 7.5
.mu.g per mouse). Botulinal toxin complex concentration of approximately
40 ng/gm body weight (1 .mu.g per mouse) was lethal in all mice in less
than 36 hours.
Two groups of BALB/c mice, 10 per group, were each given orally a single
dose of 1 .mu.g each of botulinal toxin complex in 100 .mu.l of 50 mM
sodium citrate pH 5.5. The mice received 250 .mu.l treatments of a mixture
of either preimmune or immune IgY in Ensure.RTM. (1/4 original yolk
volume) 1 hour before and 1/2 hour, 4 hours, and 8 hours after botulinal
toxin administration. The mice received three treatments per day for two
more days. The mice were observed for 96 hours. The survival and mortality
are shown in Table 11.
TABLE 11
______________________________________
Neutralization of Botulinal Toxin A In Vivo
TOXIN DOSE NUMBER OF NUMBER OF
ng/gm ANTIBODY TYPE
MICE ALIVE MICE DEAD
______________________________________
41.6 non-immune 0 10
41.6 anti-botulinal toxin
10 0
______________________________________
All mice treated with the preimmune IgY-Ensure.RTM. mixture died within 46
hours post-toxin administration. The average time of death in the mice was
32 hours post toxin administration. Treatments of preimmune
IgY-Ensure.RTM. mixture did not continue beyond 24 hours due to extensive
paralysis of the mouth in mice of this group. In contrast, all ten mice
treated with the immune anti-botulinal toxin IgY-Ensure.RTM. mixture
survived past 96 hours. Only 4 mice in this group exhibited symptoms of
botulism toxicity (two mice about 2 days after and two mice 4 days after
toxin administration). These mice eventually died 5 and 6 days later. Six
of the mice in this immune group displayed no adverse effects to the toxin
and remained alive and healthy long term. Thus, the avian anti-botulinal
toxin antibody demonstrated very good protection from the lethal effects
of the toxin in the experimental mice.
EXAMPLE 7
Production Of An Avian Antitoxin Against Clostridium difficile Toxin A
Toxin A is a potent cytotoxin secreted by pathogenic strains of C.
difficile, that plays a direct role in damaging gastrointestinal tissues.
In more severe cases of C difficile intoxication, pseudomembranous colitis
can develop which may be fatal. This would be prevented by neutralizing
the effects of this toxin in the gastrointestinal tract. As a first step,
antibodies were produced against a portion of the toxin. The example
involved: (a) conjugation of a synthetic peptide of toxin A to bovine
serum albumin; (b) immunization of hens with the peptide-BSA conjugate;
and (c) detection of antitoxin peptide antibodies by ELISA.
(a) Conjugation Of A Synthetic Peptide Of Toxin A To Bovine Serum Albumin.
The synthetic peptide CQTIDGKKYYFN-NH.sub.2 (SEQ ID NO:5) was prepared
commercially (Multiple Peptide Systems, San Diego, Calif.) and validated
to be >80% pure by high-pressure liquid chromatography. The eleven amino
acids following the cysteine residue represent a consensus sequence of a
repeated amino acid sequence found in Toxin A. ›Wren et al., Infect.
Immun., 59:3151-3155 (1991).! The cysteine was added to facilitate
conjugation to carrier protein.
In order to prepare the carrier for conjugation, BSA (Sigma) was dissolved
in 0.01M NaPO.sub.4, pH 7.0 to a final concentration of 20 mg/ml and
n-maleimidobenzoyl-N-hydroxysuccinimide ester (MBS; Pierce) was dissolved
in N,N-dimethyl formamide to a concentration of 5 mg/ml. MBS solution,
0.51 ml, was added to 3.25 ml of the BSA solution and incubated for 30
minutes at room temperature with stirring every 5 minutes. The
MBS-activated BSA was then purified by chromatography on a Bio-Gel P-10
column (Bio-Rad; 40 ml bed volume) equilibrated with 50 mM NaPO.sub.4, pH
7.0 buffer. Peak fractions were pooled (6.0 ml).
Lyophilized toxin A peptide (20 mg) was added to the activated BSA mixture,
stirred until the peptide dissolved and incubated 3 hours at room
temperature. Within 20 minutes, the reaction mixture became cloudy and
precipitates formed. After 3 hours, the reaction mixture was centrifuged
at 10,000.times.g for 10 min and the supernatant analyzed for protein
content. No significant protein could be detected at 280 nm. The conjugate
precipitate was washed three times with PBS and stored at 4.degree. C. A
second conjugation was performed with 15 mg of activated BSA and 5 mg of
peptide and the conjugates pooled and suspended at a peptide concentration
of 10 mg/ml in 10 mM NaPO.sub.4, pH 7.2.
(b) Immunization Of Hens With Peptide Conjugate. Two hens were each
initially immunized on day zero by injection into two subcutaneous and two
intramuscular sites with 1 mg of peptide conjugate that was emulsified in
CFA (GIBCO). The hens were boosted on day 14 and day 21 with 1 mg of
peptide conjugate emulsified in IFA (GIBCO).
(c) Detection Of Antitoxin Peptide Antibodies By ELISA. IgY was purified
from two eggs obtained before immunization (pre-immune) and two eggs
obtained 31 and 32 days after the initial immunization using PEG
fractionation as described in Example 1.
Wells of a 96-well microtiter plate (Falcon Pro-Bind Assay Plate) were
coated overnight at 4.degree. C. with 100 .mu.g/ml solution of the toxin A
synthetic peptide in PBS, pH 7.2 prepared by dissolving 1 mg of the
peptide in 1.0 ml of H.sub.2 O and dilution of PBS. The pre-immune and
immune IgY preparations were diluted in a five-fold series in a buffer
containing 1% PEG 8000 and 0.1% Tween-20 (v/v) in PBS, pH 7.2. The wells
were blocked for 2 hours at room temperature with 150 .mu.l of a solution
containing 5% (v/v) Carnation.RTM. nonfat dry milk and 1% PEG 8000 in PBS,
pH 7.2. After incubation for 2 hours at room temperature, the wells were
washed, secondary rabbit anti-chicken IgG-alkaline phosphatase (1:750)
added, the wells washed again and the color development obtained as
described in Example 1. The results are shown in Table 12.
TABLE 12
______________________________________
Reactivity Of IgY With Toxin Peptide
ABSORBANCE AT 410 nm
IMMUNE ANTI-
DILUTION OF PEG PREP
PREIMMUNE PEPTIDE
______________________________________
1:100 0.013 0.253
1:500 0.004 0.039
1:2500 0.004 0.005
______________________________________
Clearly, the immune antibodies contain titers against this repeated epitope
of toxin A.
EXAMPLE 8
Production Of Avian Antitoxins Against Clostridium difficile Native Toxins
A And B
To determine whether avian antibodies are effective for the neutralization
of C. difficile toxins, hens were immunized using native C. difficile
toxins A and B. The resulting egg yolk antibodies were then extracted and
assessed for their ability to neutralize toxins A and B in vitro. The
Example involved (a) preparation of the toxin immunogens, (b)
immunization, (c) purification of the antitoxins, and (d) assay of toxin
neutralization activity.
(a) Preparation Of The Toxin Immunogens. Both C. difficile native toxins A
and B, and C. difficile toxoids, prepared by the treatment of the native
toxins with formaldehyde, were employed as immunogens. C. difficile
toxoids A and B were prepared by a procedure which was modified from
published methods (Ehrich et al., Infect. Immun. 28:1041 (1980). Separate
solutions (in PBS) of native C. difficile toxin A and toxin B (Tech Lab)
were each adjusted to a concentration of 0.20 mg/ml, and formaldehyde was
added to a final concentration of 0.4%. The toxin/formaldehyde solutions
were then incubated at 37.degree. C. for 40 hrs. Free formaldehyde was
then removed from the resulting toxoid solutions by dialysis against PBS
at 4.degree. C. In previously published reports, this dialysis step was
not performed. Therefore, free formaldehyde must have been present in
their toxoid preparations. The toxoid solutions were concentrated, using a
Centriprep concentrator unit (Amicon), to a final toxoid concentration of
4.0 mg/ml. The two resulting preparations were designated as toxoid A and
toxoid B.
C. difficile native toxins were prepared by concentrating stock solutions
of toxin A and toxin B (Tech Lab, Inc), using Centriprep concentrator
units (Amicon), to a final concentration of 4.0 mg/ml.
(b) Immunization. The first two immunizations were performed using the
toxoid A and toxoid B immunogens described above. A total of 3 different
immunization combinations were employed. For the first immunization group,
0.2 ml of toxoid A was emulsified in an equal volume of Titer Max adjuvant
(CytRx). Titer Max was used in order to conserve the amount of immunogen
used, and to simplify the immunization procedure. This immunization group
was designated "CTA." For the second immunization group, 0.1 ml of toxoid
B was emulsified in an equal volume of Titer Max adjuvant. This group was
designated "CTB." For the third immunization group, 0.2 ml of toxoid A was
first mixed with 0.2 ml of toxoid B, and the resulting mixture was
emulsified in 0.4 ml of Titer Max adjuvant. This group was designated
"CTAB." In this way, three separate immunogen emulsions were prepared,
with each emulsion containing a final concentration of 2.0 mg/ml of toxoid
A (CTA) or toxoid B (CTB) or a mixture of 2.0 mg/ml toxoid A and 2.0 mg/ml
toxoid B (CTAB).
On day 0, White Leghorn hens, obtained from a local breeder, were immunized
as follows: Group CTA. Four hens were immunized, with each hen receiving
200 .mu.g of toxoid A, via two intramuscular (I.M.) injections of 50 .mu.l
of CTA emulsion in the breast area. Group CTB. One hen was immunized with
200 .mu.g of toxoid B, via two I.M. injections of 50 .mu.l of CTB emulsion
in the breast area. Group CTAB. Four hens were immunized, with each hen
receiving a mixture containing 200 .mu.g of toxoid A and 200 .mu.g of
toxoid B, via two I.M. injections of 100 .mu.l of CTAB emulsion in the
breast area. The second immunization was performed 5 weeks later, on day
35, exactly as described for the first immunization above.
In order to determine whether hens previously immunized with C. difficile
toxoids could tolerate subsequent booster immunizations using native
toxins, a single hen from group CTAB was immunized for a third time, this
time using a mixture of the native toxin A and native toxin B described in
section (a) above (these toxins were not formaldehyde-treated, and were
used in their active form). This was done in order to increase the amount
(titer) and affinity of specific antitoxin antibody produced by the hen
over that achieved by immunizing with toxoids only. On day 62, 0.1 ml of a
toxin mixture was prepared which contained 200 .mu.g of native toxin A and
200 .mu.g of native toxin B. This toxin mixture was then emulsified in 0.1
ml of Titer Max adjuvant. A single CTAB hen was then immunized with the
resulting immunogen emulsion, via two I.M. injections of 100 .mu.l each,
into the breast area. This hen was marked with a wing band, and observed
for adverse effects for a period of approximately 1 week, after which time
the hen appeared to be in good health.
Because the CTAB hen described above tolerated the booster immunization
with native toxins A and B with no adverse effects, it was decided to
boost the remaining hens with native toxin as well. On day 70, booster
immunizations were performed as follows: Group CTA. A 0.2 ml volume of the
4 mg/ml native toxin A solution was emulsified in an equal volume of Titer
Max adjuvant. Each of the 4 hens was then immunized with 200 .mu.g of
native toxin A, as described for the toxoid A immunizations above. Group
CTB. A 50 .mu.l volume of the 4 mg/ml native toxin B solution was
emulsified in an equal volume of Titer Max adjuvant. The hen was then
immunized with 200 .mu.g of native toxin B, as described for the toxoid B
immunizations above. Group CTAB. A 0.15 ml volume of the 4 mg/ml native
toxin A solution was first mixed with a 0.15 ml volume the 4 mg/ml native
toxin B solution. The resulting toxin mixture was then emulsified in 0.3
ml of Titer Max adjuvant. The 3 remaining hens (the hen with the wing band
was not immunized this time) were then immunized with 200 .mu.g of native
toxin A and 200 .mu.g of native toxin B as described for the toxoid A+
toxoid B immunizations (CTAB) above. On day 85, all hens received a second
booster immunization using native toxins, done exactly as described for
the first boost with native toxins above.
All hens tolerated both booster immunizations with native toxins with no
adverse effects. As previous literature references describe the use of
formaldehyde-treated toxoids, this is apparently the first time that any
immunizations have been performed using native C. difficile toxins.
(c) Purification Of Antitoxins. Eggs were collected from the hen in group
CTB 10-12 days following the second immunization with toxoid (day 35
immunization described in section (b) above), and from the hens in groups
CTA and CTAB 20-21 days following the second immunization with toxoid. To
be used as a pre-immune (negative) control, eggs were also collected from
unimmunized hens from the same flock. Egg yolk immunoglobulin (IgY) was
extracted from the 4 groups of eggs as described in Example 1(c), and the
final IgY pellets were solubilized in the original yolk volume of PBS
without thimerosal. Importantly, thimerosal was excluded because it would
have been toxic to the CHO cells used in the toxin neutralization assays
described in section (d) below.
(d) Assay Of Toxin Neutralization Activity. The toxin neutralization
activity of the IgY solutions prepared in section (c) above was determined
using an assay system that was modified from published methods. ›Ehrich et
al., Infect. Immun. 28:1041-1043 (1992); and McGee et al. Microb. Path.
12:333-341 (1992).! As additional controls, affinity-purified goat anti-C.
difficile toxin A (Tech Lab) and affinity-purified goat anti-C. difficile
toxin B (Tech Lab) were also assayed for toxin neutralization activity.
The IgY solutions and goat antibodies were serially diluted using F 12
medium (GIBCO) which was supplemented with 2% FCS (GIBCO)(this solution
will be referred to as "medium" for the remainder of this Example). The
resulting antibody solutions were then mixed with a standardized
concentration of either native C. difficile toxin A (Tech Lab), or native
C. difficile toxin B (Tech Lab), at the concentrations indicated below.
Following incubation at 37.degree. C. for 60 min., 100 .mu.l volumes of
the toxin+antibody mixtures were added to the wells of 96-well microtiter
plates (Falcon Microtest III) which contained 2.5.times.10.sup.4 Chinese
Hamster Ovary (CHO) cells per well (the CHO cells were plated on the
previous day to allow them to adhere to the plate wells). The final
concentration of toxin, or dilution of antibody indicated below refers to
the final test concentration of each reagent present in the respective
microtiter plate wells. Toxin reference wells were prepared which
contained CHO cells and toxin A or toxin B at the same concentration used
for the toxin+antibody mixtures (these wells contained no antibody).
Separate control wells were also prepared which contained CHO cells and
medium only. The assay plates were then incubated for 18-24 hrs. in a
37.degree. C., humidified, 5% CO.sub.2 incubator. On the following day,
the remaining adherent (viable) cells in the plate wells were stained
using 0.2% crystal violet (Mallinckrodt) dissolved in 2% ethanol, for 10
min. Excess stain was then removed by rinsing with water, and the stained
cells were solubilized by adding 100 .mu.l of 1% SDS (dissolved in water)
to each well. The absorbance of each well was then measured at 570 nm, and
the percent cytotoxicity of each test sample or mixture was calculated
using the following formula:
##EQU1##
Unlike previous reports which quantitate results visually by counting cell
rounding by microscopy, this Example utilized spectrophotometric methods
to quantitate the C. difficile toxin bioassay. In order to determine the
toxin A neutralizing activity of the CTA, CTAB, and pre-immune IgY
preparations, as well as the affinity-purified goat antitoxin A control,
dilutions of these antibodies were reacted against a 0.1 .mu.g/ml
concentration of native toxin A (this is the approx. 50% cytotoxic dose of
toxin A in this assay system). The results are shown in FIG. 3.
Complete neutralization of toxin A occurred with the CTA IgY (antitoxin A,
above) at dilutions of 1:80 and lower, while significant neutralization
occurred out to the 1:320 dilution. The CTAB IgY (antitoxin A+toxin B,
above) demonstrated complete neutralization at the 1:320-1:160 and lower
dilutions, and significant neutralization occurred out to the 1:1280
dilution. The commercially available affinity-purified goat antitoxin A
did not completely neutralize toxin A at any of the dilutions tested, but
demonstrated significant neutralization out to a dilution of 1:1,280. The
preimmune IgY did not show any toxin A neutralizing activity at any of the
concentrations tested. These results demonstrate that IgY purified from
eggs laid by hens immunized with toxin A alone, or simultaneously with
toxin A and toxin B, is an effective toxin A antitoxin.
The toxin B neutralizing activity of the CTAB and pre-immune IgY
preparations, and also the affinity-purified goat antitoxin B control was
determined by reacting dilutions of these antibodies against a
concentration of native toxin B of 0.1 ng/ml (approximately the 50%
cytotoxic dose of toxin B in the assay system). The results are shown in
FIG. 4.
Complete neutralization of toxin B occurred with the CTAB IgY (antitoxin
A+toxin B, above) at the 1:40 and lower dilutions, and significant
neutralization occurred out to the 1:320 dilution. The affinity-purified
goat antitoxin B demonstrated complete neutralization at dilutions of
1:640 and lower, and significant neutralization occurred out to a dilution
of 1:2,560. The preimmune IgY did not show any toxin B neutralizing
activity at any of the concentrations tested. These results demonstrate
that IgY purified from eggs laid by hens immunized simultaneously with
toxin A and toxin B is an effective toxin B antitoxin.
In a separate study, the toxin B neutralizing activity of CTB, CTAB, and
preimmune IgY preparations was determined by reacting dilutions of these
antibodies against a native toxin B concentration of 0.1 .mu.g/ml
(approximately 100% cytotoxic dose of toxin B in this assay system). The
results are shown in FIG. 5.
Significant neutralization of toxin B occurred with the CTB IgY (antitoxin
B, above) at dilutions of 1:80 and lower, while the CTAB IgY (antitoxin
A+toxin B, above) was found to have significant neutralizing activity at
dilutions of 1:40 and lower. The preimmune IgY did not show any toxin B
neutralizing activity at any of the concentrations tested. These results
demonstrate that IgY purified from eggs laid by hens immunized with toxin
B alone, or simultaneously with toxin A and toxin B, is an effective toxin
B antitoxin.
EXAMPLE 9
In Vivo Protection Of Golden Syrian Hamsters From C. difficile Disease By
Avian Antitoxins Against C. difficile Toxins A And B
The most extensively used animal model to study C. difficile disease is the
hamster. ›Lyerly et al., Infect. Immun. 47:349-352 (1992).! Several other
animal models for antibiotic-induced diarrhea exist, but none mimic the
human form of the disease as closely as the hamster model. ›R Fekety,
"Animal Models of Antibiotic-Induced Colitis," in O. Zak and M. Sande
(eds.), Experimental Models in Antimicrobial Chemotherapy, Vol. 2,
pp.61-72, (1986).! In this model, the animals are first predisposed to the
disease by the oral administration of an antibiotic, such as clindamycin,
which alters the population of normally-occurring gastrointestinal flora
(Fekety, at 61-72). Following the oral challenge of these animals with
viable C. difficile organisms, the hamsters develop cecitis, and
hemorrhage, ulceration, and inflammation are evident in the intestinal
mucosa. ›Lyerly et al., Infect. Immun. 47:349-352 (1985).! The animals
become lethargic, develop severe diarrhea, and a high percentage of them
die from the disease. ›Lyerly et al., Infect. Immun. 47:349-352 (1985).!
This model is therefore ideally suited for the evaluation of therapeutic
agents designed for the treatment or prophylaxis of C. difficile disease.
The ability of the avian C. diffcile antitoxins, described in Example 1
above, to protect hamsters from C. difficile disease was evaluated using
the Golden Syrian hamster model of C. difficile infection. The Example
involved (a) preparation of the avian C. difficile antitoxins, (b) in vivo
protection of hamsters from C. difficile disease by treatment with avian
antitoxins, and (c) long-term survival of treated hamsters.
(a) Preparation Of The Avian C. difficile Antitoxins. Eggs were collected
from hens in groups CTA and CTAB described in Example 1(b) above. To be
used as a pre-immune (negative) control, eggs were also purchased from a
local supermarket. Egg yolk immunoglobulin (IgY) was extracted from the 3
groups of eggs as described in Example 1(c), and the final IgY pellets
were solubilized in one fourth the original yolk volume of Ensure.RTM.
nutritional formula.
(b) In vivo Protection Of Hamsters Against C. difficile Disease By
Treatment With Avian Antitoxins. The avian C. difficile antitoxins prepared
in section (a) above were evaluated for their ability to protect hamsters
from C. difficile disease using an animal model system which was modified
from published procedures. ›Fekety, at 61-72; Borriello et al., J. Med.
Microbiol., 24:53-64 (1987); Kim et al., Infect. Immun., 55:2984-2992
(1987); Borriello et al., J. Med. Microbiol., 25:191-196 (1988); Delmee
and Avesani, J. Med. Microbiol., 33:85-90 (1990); and Lyerly et al.,
Infect. Immun., 59:2215-2218 (1991).! For the study, three separate
experimental groups were used, with each group consisting of 7 female
Golden Syrian hamsters (Charles River), approximately 10 weeks old and
weighing approximately 100 gms. each. The three groups were designated
"CTA," "CTAB" and "Pre-immune." These designations corresponded to the
antitoxin preparations with which the animals in each group were treated.
Each animal was housed in an individual cage, and was offered food and
water ad libitum through the entire length of the study. On day 1, each
animal was orally administered 1.0 ml of one of the three antitoxin
preparations (prepared in section (a) above) at the following timepoints:
0 hrs., 4 hrs., and 8 hrs. On day 2, the day 1 treatment was repeated. On
day 3, at the 0 hr. timepoint, each animal was again administered
antitoxin, as described above. At 1 hr., each animal was orally
administered 3.0 mg of clindamycin-HCl (Sigma) in 1 ml of water. This
treatment predisposed the animals to infection with C. difficile. As a
control for possible endogenous C. difficile colonization, an additional
animal from the same shipment (untreated) was also administered 3.0 mg of
clindamycin-HCl in the same manner. This clindamycin control animal was
left untreated (and uninfected) for the remainder of the study. At the 4
hr. and 8 hr. timepoints, the animals were administered antitoxin as
described above. On day 4, at the 0 hr. timepoint, each animal was again
administered antitoxin as described above. At 1 hr., each animal was
orally challenged with 1 ml of C. difficile inoculum, which contained
approx. 100 C. difficile strain 43596 organisms in sterile saline. C.
difficile strain 43596, which is a serogroup C strain, was chosen because
it is representative of one of the most frequently-occurring serogroups
isolated from patients with antibiotic-associated pseudomembranous
colitis. ›Delmee et al., J. Clin. Microbiol., 28:2210-2214 (1985).! In
addition, this strain has been previously demonstrated to be virulent in
the hamster model of infection. ›Delmee and Avesani, J. Med. Microbiol.,
33:85-90 (1990).! At the 4 hr. and 8 hr. timepoints, the animals were
administered antitoxin as described above. On days 5 through 13, the
animals were administered antitoxin 3.times. per day as described for day
1 above, and observed for the onset of diarrhea and death. On the morning
of day 14, the final results of the study were tabulated. These results
are shown in Table 13.
TABLE 13
______________________________________
Treatment Results
No. Animals
Treatment Group Surviving No. Animals Dead
______________________________________
Pre-Immune 1 6
CTA (Antitoxin A only)
5 2
CTAB (Antitoxin A + Antitoxin B)
7 0
______________________________________
Representative animals from those that died in the Pre-Immune and CTA
groups were necropsied. Viable C. difficile organisms were cultured from
the ceca of these animals, and the gross pathology of the gastrointestinal
tracts of these animals was consistent with that expected for C. difficile
disease (inflamed, distended, hemorrhagic cecum, filled with watery
diarrhea-like material). In addition, the clindamycin control animal
remained healthy throughout the entire study period, therefore indicating
that the hamsters used in the study had not previously been colonized with
endogenous C. difficile organisms prior to the start of the study.
Following the final antitoxin treatment on day 13, a single surviving
animal from the CTA group, and also from the CTAB group, was sacrificed
and necropsied. No pathology was noted in either animal.
Treatment of hamsters with orally-administered toxin A and toxin B
antitoxin (group CTAB) successfully protected 7 out of 7 (100%) of the
animals from C. difficile disease. Treatment of hamsters with
orally-administered toxin A antitoxin (group CTA) protected 5 out of 7
(71%) of these animals from C. difficile disease. Treatment using
pre-immune IgY was not protective against C. difficile disease, as only 1
out of 7 (14%) of these animals survived. These results demonstrate that
the avian toxin A antitoxin and the avian toxin A+toxin B antitoxin
effectively protected the hamsters from C. difficile disease. These
results also suggest that although the neutralization of toxin A alone
confers some degree of protection against C. difficile disease, in order
to achieve maximal protection, simultaneous antitoxin A and antitoxin B
activity is necessary.
(c) Long-Term Survival Of Treated Hamsters. It has been previously reported
in the literature that hamsters treated with orally-administered bovine
antitoxin IgG concentrate are protected from C. difficile disease as long
as the treatment is continued, but when the treatment is stopped, the
animals develop diarrhea and subsequently die within 72 hrs. ›Lyerly et
al., Infect. Immun., 59(6):2215-2218 (1991).!
In order to determine whether treatment of C. difficile disease using avian
antitoxins promotes long-term survival following the discontinuation of
treatment, the 4 surviving animals in group CTA, and the 6 surviving
animals in group CTAB were observed for a period of 11 days (264 hrs.)
following the discontinuation of antitoxin treatment described in section
(b) above. All hamsters remained healthy through the entire post-treatment
period. This result demonstrates that not only does treatment with avian
antitoxin protect against the onset of C. difficile disease (i.e., it is
effective as a prophylactic), it also promotes long-term survival beyond
the treatment period, and thus provides a lasting cure.
EXAMPLE 10
In Vivo Treatment Of Established C. difficile Infection In Golden Syrian
Hamsters With Avian Antitoxins Against C. difficile Toxins A And B
The ability of the avian C. difficile antitoxins, described in Example 8
above, to treat an established C. difficile infection was evaluated using
the Golden Syrian hamster model. The Example involved (a) preparation of
the avian C. difficile antitoxins, (b) in vivo treatment of hamsters with
established C. difficile infection, and (c) histologic evaluation of cecal
tissue.
(a) Preparation Of The Avian C. difficile Antitoxins. Eggs were collected
from hens in group CTAB described in Example 8(b) above, which were
immunized with C. difficile toxoids and native toxins A and B. Eggs
purchased from a local supermarket were used as a pre-immune (negative)
control. Egg yolk immunoglobulin (IgY) was extracted from the 2 groups of
eggs as described in Example 1(c), and the final IgY pellets were
solubilized in one-fourth the original yolk volume of Ensure.RTM.
nutritional formula.
(b) In vivo Treatment Of Hamsters With Established C. difficile Infection.
The avian C. difficile antitoxins prepared in section (a) above were
evaluated for the ability to treat established C. difficile infection in
hamsters using an animal model system which was modified from the
procedure which was described for the hamster protection study in Example
8(b) above.
For the study, four separate experimental groups were used, with each group
consisting of 7 female Golden Syrian hamsters (Charles River), approx. 10
weeks old, weighing approximately 100 gms. each. Each animal was housed
separately, and was offered food and water ad libitum through the entire
length of the study.
On day 1 of the study, the animals in all four groups were each predisposed
to C. difficile infection by the oral administration of 3.0 mg of
clindamycin-HCl (Sigma) in 1 ml of water.
On day 2, each animal in all four groups was orally challenged with 1 ml of
C. difficile inoculum, which contained approximately 100 C. difficile
strain 43596 organisms in sterile saline. C. difficile strain 43596 was
chosen because it is representative of one of the most
frequently-occurring serogroups isolated from patients with
antibiotic-associated pseudomembranous colitis. ›Delmee et al., J. Clin.
Microbiol., 28:2210-2214 (1990).! In addition, as this was the same C.
difficile strain used in all of the previous Examples above, it was again
used in order to provide experimental continuity.
On day 3 of the study (24 hrs. post-infection), treatment was started for
two of the four groups of animals. Each animal of one group was orally
administered 1.0 ml of the CTAB IgY preparation (prepared in section (a)
above) at the following timepoints: 0 hrs., 4 hrs., and 8 hrs. The animals
in this group were designated "CTAB-24." The animals in the second group
were each orally administered 1.0 ml of the pre-immune IgY preparation
(also prepared in section (a) above) at the same timepoints as for the
CTAB group. These animals were designated "Pre-24." Nothing was done to
the remaining two groups of animals on day 3.
On day 4, 48 hrs. post-infection, the treatment described for day 3 above
was repeated for the CTAB-24 and Pre-24 groups, and was initiated for the
remaining two groups at the same timepoints. The final two groups of
animals were designed "CTAB-48" and "Pre-48" respectively.
On days 5 through 9, the animals in all four groups were administered
antitoxin or pre-immune IgY, 3.times. per day, as described for day 4
above. The four experimental groups are summarized in Table 14.
TABLE 14
______________________________________
Experimental Treatment Groups
Group Designation
Experimental Treatment
______________________________________
CTAB-24 Infected, treatment w/antitoxin IgY started
@ 24 hrs. post-infection.
Pre-24 Infected, treatment w/pre-immune IgY started
@ 24 hrs. post-infection.
CTAB-48 Infected, treatment w/antitoxin IgY started
@ 48 hrs. post-infection.
Pre-48 Infected, treatment w/pre-immune IgY started @ 48
hrs. post-infection.
______________________________________
All animals were observed for the onset of diarrhea and death through the
conclusion of the study on the morning of day 10. The results of this
study are displayed in Table 15.
Eighty-six percent of the animals which began receiving treatment with
antitoxin IgY at 24 hrs. post-infection (CTAB-24 above) survived, while
57% of the animals treated with antitoxin IgY starting 48 hrs.
post-infection (CTAB-48 above) survived. In contrast, none of the animals
receiving pre-immune IgY starting 24 hrs. post-infection (Pre-24 above)
survived, and only 29% of the animals which began receiving treatment with
pre-immune IgY at 48 hrs. post-infection (Pre-48 above) survived through
the conclusion of the study. These results demonstrate that avian
antitoxins raised against C. difficile toxins A and B are capable of
successfully treating established C. difficile infections in vivo.
TABLE 15
______________________________________
Experimental Outcome-Day 10
Treatment Group
No. Animals Surviving
No. Animals Dead
______________________________________
CTAB-24 6 1
Pre-24 0 7
CTAB-48 4 3
Pre-48 2 5
______________________________________
(c) Histologic Evaluation Of Cecal Tissue. In order to further evaluate the
ability of the IgY preparations tested in this study to treat established
C. difficile infection, histologic evaluations were performed on cecal
tissue specimens obtained from representative animals from the study
described in section (b) above.
Immediately following death, cecal tissue specimens were removed from
animals which died in the Pre-24 and Pre-48 groups. Following the
completion of the study, a representative surviving animal was sacrificed
and cecal tissue specimens were removed from the CTAB-24 and CTAB-48
groups. A single untreated animal from the same shipment as those used in
the study was also sacrificed and a cecal tissue specimen was removed as a
normal control. All tissue specimens were fixed overnight at 4.degree. C.
in 10% buffered formalin. The fixed tissues were paraffin-embedded,
sectioned, and mounted on glass microscope slides. The tissue sections
were then stained using hematoxylin and eosin (H and E stain), and were
examined by light microscopy.
Upon examination, the tissues obtained from the CTAB-24 and CTAB-48 animals
showed no pathology, and were indistinguishable from the normal control.
This observation provides further evidence for the ability of avian
antitoxins raised against C. difficile toxins A and B to effectively treat
established C. diffcile infection, and to prevent the pathologic
consequences which normally occur as a result of C. difficile disease.
In contrast, characteristic substantial mucosal damage and destruction was
observed in the tissues of the animals from the Pre-24 and Pre-48 groups
which died from C. difficile disease. Normal tissue architecture was
obliterated in these two preparations, as most of the mucosal layer was
observed to have sloughed away, and there were numerous large hemorrhagic
areas containing massive numbers of erythrocytes.
EXAMPLE 11
Cloning And Expression Of C. difficile Toxin A Fragments
The toxin A gene has been cloned and sequenced, and shown to encode a
protein of predicted MW of 308 kd. ›Dove et al., Infect. Immun.,
58:480-488 (1990).! Given the expense and difficulty of isolating native
toxin A protein, it would be advantageous to use simple and inexpensive
procaryotic expression systems to produce and purify high levels of
recombinant toxin A protein for immunization purposes. Ideally, the
isolated recombinant protein would be soluble in order to preserve native
antigenicity, since solubilized inclusion body proteins often do not fold
into native conformations. To allow ease of purification, the recombinant
protein should be expressed to levels greater than 1 mg/litre of E. coli
culture.
To determine whether high levels of recombinant toxin A protein can be
produced in E. coli, fragments of the toxin A gene were cloned into
various prokaryotic expression vectors, and assessed for the ability to
express recombinant toxin A protein in E coli. Three prokaryotic
expression systems were utilized. These systems were chosen because they
drive expression of either fusion (pMALc and pGEX2T) or native (pET23a-c)
protein to high levels in E. coli, and allow affinity purification of the
expressed protein on a ligand containing column. Fusion proteins expressed
from pGEX vectors bind glutathione agarose beads, and are eluted with
reduced glutathione. pMAL fusion proteins bind amylose resin, and are
eluted with maltose. A polyhistidine tag is present at either the
N-terminal (pET16b) or C-terminal (pET23a-c) end of pET fusion proteins.
This sequence specifically binds Ni.sub.2.sup.+ chelate columns, and is
eluted with imidazole salts. Extensive descriptions of these vectors are
available (Williams et al., DNA Cloning: Expression Systems, in press),
and will not be discussed in detail here. The Example involved (a) cloning
of the toxin A gene, (b) expression of large fragments of toxin A in
various prokaryotic expression systems, (c) identification of smaller
toxin A gene fragments that express efficiently in E. coli, (d)
purification of recombinant toxin A protein by affinity chromatography,
and (e) demonstration of functional activity of a recombinant fragment of
the toxin A gene.
(a) Cloning Of The Toxin A Gene. A restriction map of the toxin A gene is
shown in FIG. 6 (SEQ ID NOS:1-4). The encoded protein contains a carboxy
terminal ligand binding region, containing multiple repeats of a
carbohydrate binding domain. ›von Eichel-Streiber and Sauerborn, Gene
96:107-113 (1990).! The toxin A gene was cloned in three pieces, by using
either the polymerase chain reaction (PCR) to amplify specific regions,
(regions 1 and 2, FIG. 6 (SEQ ID NOS:1-4)) or by screening a constructed
genomic library for a specific toxin A gene fragment (region 3, FIG. 6
(SEQ ID NOS:1-4). The sequences of the utilized PCR primers are indicated
in the legend to FIG. 6 (SEQ ID NOS:1-4). These regions were cloned into
prokaryotic expression vectors that express either fusion (pMALc and
pGEX2T) or native (pET23a-c) protein to high levels in E. coli, and allow
affinity purification of the expressed protein on a ligand containing
column.
Clostridium difficile VPI strain 10463 was obtained from the ATCC (ATCC
#43255) and grown under anaerobic conditions in brain-heart infusion
medium (BBL). High molecular-weight C. difficile DNA was isolated
essentially as described by Wren and Tabaqchali, J Clin. Microbiol.,
25:2402-2404 (1987), except proteinase K and sodium dodecyl sulfate (SDS)
was used to disrupt the bacteria, and cetytrimethylammonium bromide
precipitation ›as described in Ausubel et al., Current Protocols in
Molecular Biology (1989)! was used to remove carbohydrates from the
cleared lysate. The integrity and yield of genomic DNA was assessed by
comparison with a serial dilution of uncut lambda DNA after
electrophoresis on an agarose gel.
Fragments 1 and 2 were cloned by PCR, utilizing a proofreading thermostable
DNA polymerase (native pfu polymerase; Stratagene). The high fidelity of
this polymerase reduces the mutation problems associated with
amplification by error prone polymerases (e.g., Taq polymerase). PCR
amplification was performed using the indicated PCR primers (FIG. 6 (SEQ
ID NOS:1-4)) in 50 .mu.l reactions containing 10 mM Tris-HCl(8.3), 50 mM
KCl, 1.5 mM MgCl.sub.2, 200 .mu.M each dNTP, 0.2 .mu.M each primer, and 50
ng C. difficile genomic DNA. Reactions were overlaid with 100 .mu.l
mineral oil, heated to 94.degree. C. for 4 min, 0.5 .mu.l native pfu
polymerase (Stratagene) added, and the reaction cycled 30.times. at
94.degree. C. for 1 min, 50.degree. C. for 1 min, 72.degree. C. for 4 min,
followed by 10 min at 72.degree. C. Duplicate reactions were pooled,
chloroform extracted, and ethanol precipitated. After washing in 70%
ethanol, the pellets were resuspended in 50 .mu.l TE buffer ›10 mM
Tris-HCl, 1 mM EDTA pH 80. Aliquots of 10 .mu.each were restriction
digested with either EcoRI/HincII (fragment 1) or EcoRI/PstI (fragment 2),
and the appropriate restriction fragments were gel purified using the
Prep-A-Gene kit (BioRad), and ligated to either EcoRI/SmaI-restricted
pGEX2T (Pharmacia) vector (fragment 1), or the EcoRI/PstI pMAlc (New
England Biolabs) vector (fragment 2). Both clones are predicted to produce
in-frame fusions with either the glutathione-S-transferase protein (pGEX
vector) or the maltose binding protein (pMAL vector). Recombinant clones
were isolated, and confirmed by restriction digestion, using standard
recombinant molecular biology techniques. ›Sambrook et al, Molecular
Cloning. A Laboratory Manual (1989), and designated pGA30-660 and
pMA660-1100, respectively (see FIG. 6 (SEQ ID NOS:1-4) for description of
the clone designations).!
Fragment 3 was cloned from a genomic library of size selected PstI digested
C. difficile genomic DNA, using standard molecular biology techniques
(Sambrook et al.). Given that the fragment 3 internal PstI site is
protected from cleavage in C. difficile genomic DNA ›Price et al., Curr.
Microbiol., 16:55-60 (1987)!, 4.7 kb PstI restricted C. difficile genomic
DNA was gel purified, and ligated to PstI restricted, phosphatase treated
pUC9 DNA. The resulting genomic library was screened with a
oligonucleotide primer specific to fragment 3, and multiple independent
clones were isolated. The presence of fragment 3 in several of these
clones was confirmed by restriction digestion, and a clone of the
indicated orientation (FIG. 6 (SEQ ID NOS:1-4)) was restricted with
BamHI/HindIII, the released fragment purified by gel electrophoresis, and
ligated into similarly restricted pET23c expression vector DNA (Novagen).
Recombinant clones were isolated, and confirmed by restriction digestion.
This construct is predicted to create both a predicted in frame fusion
with the pET protein leader sequence, as well as a predicted C-terminal
poly-histidine affinity tag, and is designated pPA1100-2680 (see FIG. 6
(SEQ ID NOS:1-4) for the clone designation).
(b) Expression Of Large Fragments Of Toxin A In E. coli. Protein expression
from the three expression constructs made in (a) was induced, and analyzed
by Western blot analysis with an affinity purified, goat polyclonal
antiserum directed against the toxin A toxoid (Tech Lab). The procedures
utilized for protein induction, SDS-PAGE, and Western blot analysis are
described in detail in Williams et al. In brief, 5 ml 2XYT (16 g.
tryptone, 10 g. yeast extract, 5 g. NaCl per liter, pH 7.5)+100 .mu.g/ml
ampicillin were added to cultures of bacteria (BL21 for pMAl and pGEX
plasmids, and BL21(DE3)LysS for pET plasmids) containing the appropriate
recombinant clone which were induced to express recombinant protein by
addition of IPTG to 1 mM. Cultures were grown at 37.degree. C., and
induced when the cell density reached 0.5 OD.sub.600. Induced protein was
allowed to accumulate for two hrs after induction. Protein samples were
prepared by pelleting 1 ml aliquots of bacteria by centrifugation (1 min
in a microfuge), and resuspension of the pelleted bacteria in 150 .mu.l of
2.times.SDS-PAGE sample buffer (Williams et al.). The samples were heated
to 95.degree. C. for 5 min, the cooled and 5 or 10 .mu.l aliquots loaded
on 7.5% SDS-PAGE gels. BioRad high molecular weight protein markers were
also loaded, to allow estimation of the MW of identified fusion proteins.
After electrophoresis, protein was detected either generally by staining
gels with coomassie blue, or specifically, by blotting to nitrocellulose
for Western blot detection of specific immunoreactive protein. Western
blots, (performed as described in Example 3) which detect toxin A reactive
protein in cell lysates of induced protein from the three expression
constructs are shown in FIG. 7. In this figure, lanes 1-3 contain cell
lysates prepared from E. coli strains containing pPA 1100-2860 in
B121(DE3)lysE cells; lanes 4-6 contain cell lysates prepared from E. coli
strains containing pPA1100-2860 in B 121(DE3)lysS cells; lanes 7-9 contain
cell lysates prepared from E coli strains containing pMA30-660; lanes
10-12 contain cell lysates prepared from E. coli strains containing
pMA660-1100. The lanes were probed with an affinity purified goat
antitoxin A polyclonal antibody (Tech Lab). Control lysates from uninduced
cells (lanes 1, 7, and 10) contain very little immunoreactive material
compared to the induced samples in the remaining lanes. The highest
molecular weight band observed for each clone is consistent with the
predicted size of the full length fusion protein.
Each construct directs expression of high molecular weight (HMW) protein
that is reactive with the toxin A antibody. The size of the largest
immunoreactive bands from each sample is consistent with predictions of
the estimated MW of the intact fusion proteins. This demonstrates that the
three fusions are in-frame, and that none of the clones contain cloning
artifacts that disrupt the integrity of the encoded fusion protein.
However, the Western blot demonstrates that fusion protein from the two
larger constructs (pGA30-660 and pPA1100-2680) are highly degraded. Also,
expression levels of toxin A proteins from these two constructs are low,
since induced protein bands are not visible by Coomassie staining (not
shown). Several other expression constructs that fuse large sub-regions of
the toxin A gene to either pMALc or pET23a-c expression vectors, were
constructed and tested for protein induction. These constructs were made
by mixing gel purified restriction fragments, derived from the expression
constructs shown in FIG. 6 (SEQ ID NOS:1-4), with appropriately cleaved
expression vectors, ligating, and selecting recombinant clones in which
the toxin A restriction fragments had ligated together and into the
expression vector as predicted for in-frame fusions. The expressed toxin A
interval within these constructs are shown in FIG. 8, as well as the
internal restriction sites utilized to make these constructs.
As used herein, the term "interval" refers to any portion (i.e., any
segment of the toxin which is less than the whole toxin molecule) of a
clostridial toxin. In a preferred embodiment, "interval" refers to
portions of C. difficile toxins such as toxin A. It is also contemplated
that these intervals will correspond to epitopes of immunologic
importance, such as antigens or immunogens against which a neutralizing
antibody response is effected. It is not intended that the present
invention be limited to the particular intervals or sequences described in
these Examples. It is also contemplated that sub-portions of intervals
(e.g., an epitope contained within one interval or which bridges multiple
intervals) be used as compositions and in the methods of the present
invention.
In all cases, Western blot analysis of each of these constructs with goat
antitoxin A antibody (Tech Lab) detected HMW fusion protein of the
predicted size (not shown). This confirms that the reading frame of each
of these clones is not prematurely terminated, and is fused in the correct
frame with the fusion partner. However, the Western blot analysis revealed
that in all cases, the induced protein is highly degraded, and, as
assessed by the absence of identifiable induced protein bands by Coomassie
Blue staining, are expressed only at low levels. These results suggest
that expression of high levels of intact toxin A recombinant protein is
not possible when large regions of the toxin A gene are expressed in E
coli using these expression vectors.
(c) High Level Expression Of Small Toxin A Protein Fusions In E. coli.
Experience indicates that expression difficulties are often encountered
when large (greater than 100 kd) fragments are expressed in E coli. A
number of expression constructs containing smaller fragments of the toxin
A gene were constructed, to determine if small regions of the gene can be
expressed to high levels without extensive protein degradation. A summary
of these expression constructs are shown in FIG. 9. All were constructed
by in-frame fusions of convenient toxin A restriction fragments to either
the pMALc or pET23a-c vectors. Protein preparations from induced cultures
of each of these constructs were analyzed by both Coomassie and Western
analysis as in (b) above. In all cases, higher levels of intact, full
length fusion proteins were observed than with the larger recombinants
from section (b).
(d) Purification Of Recombinant Toxin A Protein. Large scale (500 ml)
cultures of each recombinant from (c) were grown, induced, and soluble and
insoluble protein fractions were isolated. The soluble protein extracts
were affinity chromatogrammed to isolate recombinant fusion protein, as
described (Williams et al.). In brief, extracts containing tagged pET
fusions were chromatogrammed on a nickel chelate column, and eluted using
imidazole salts as described by the distributor (Novagen). Extracts
containing soluble pMAL fusion protein were prepared and chromatogrammed
in column buffer (10 mM NaPO4, 0.5M NaCl, 10 mM B-mercaptoethanol, pH 7.2)
over an amylose resin column (New England Biolabs), and eluted with column
buffer containing 10 mM maltose as described (Williams et al.). When the
expressed protein was found to be predominantly insoluble, insoluble
protein extracts were prepared by a proprietary method, described in
(Williams et al.) The results are summarized in Table 16. FIG. 10 shows
the sample purifications recombinant toxin A protein. In this figure,
lanes 1 and 2 contain MBP fusion protein purified by affinity purification
of soluble protein. Lanes 3 and 4 contain MBP fusion protein purified by
solubilization of insoluble inclusion bodies. The purified fusion protein
samples are pMA1870-2680 (lane 1),d pMA660-1100 (lane 2), pMA300-600 (lane
3) and pMA1450-1870 (lane 4).
TABLE 16
______________________________________
Purification Of Recombinant Toxin A Protein
% Intact
Soluble
Yield Affinity
Fusion
Yield Intact
Protein Purified Soluble
Protein
Insoluble
Clone .sup.(a)
Solubility
Protein .sup.(b)
(c) Fusion Protein
______________________________________
pMA30-270
Soluble 4 mg/500 mls
10% NA
PMA30-300
Soluble 4 mg/500 mls
5-10% NA
pMA300-660
Insoluble
-- NA 10 mg/500 ml
pMA660-1100
Soluble 4.5 mg/500 mls
50% NA
pMA1100- Soluble 18 mg/500 mls
10% NA
1610
pMA1610- Both 22 mg/500 mls
90% 20 mg/500 ml
1870
pMA1450- Insoluble
-- NA 0.2 mg/500 ml
1870
pPA1100- Soluble 0.1 mg/500 mls
90% NA
1450
pPA1100- Soluble 0.02 mg/500 mls
90% NA
1870
pMA1870- Both 12 mg/500 mls
80% NA
2680
pPa1870-2680
Insoluble
-- NA 10 mg/500 ml
______________________________________
.sup.(a) pP = pET23 vector, pM = pMALc vector, A = toxin A.
.sup.(b) Based on 1.5 0D.sub.280 = 1 mg/ml (extinction coefficient of
MBP).
(c) Estimated by Coomassie staining of SDSPAGE gels.
Poor yields of affinity purified protein were obtained when poly-histidine
tagged pET vectors were used to drive expression (pPA1100-1450, pP
1100-1870). However, significant protein yields were obtained from pMAL
expression constructs spanning the entire toxin A gene, and yields of
full-length soluble fusion protein ranged from an estimated 200-400
.mu.g/500 ml culture (pMA30-300) to greater than 20 mg/500 ml culture
(pMA1610-l870). Only one interval is expressed to high levels as strictly
insoluble protein (pMA300-660). Thus, although high level expression was
not observed when using large expression constructs from the toxin A gene,
usable levels of recombinant protein spanning the entire toxin A gene were
obtainable by isolating induced protein from a series of smaller pMAL
expression constructs that span the entire toxin A gene. This is the first
demonstration of the feasibility of expressing recombinant toxin A protein
to high levels in E. coli.
(e) Hemagglutination Assay Using The Toxin A Recombinant Proteins. The
carboxy terminal end consisting of the repeating units contains the
hemagglutination activity or binding domain of C. difficile toxin A. To
determine whether the expressed toxin A recombinants retain functional
activity, hemagglutination assays were performed. Two toxin A recombinant
proteins, one containing the binding domain as either soluble affinity
purified protein (pMA1870-2680) or SDS solubilized inclusion body protein
(pPA1870-2680) and soluble protein from one region outside that domain
(pMA1100-1610) were tested using a described procedure. ›H. C. Krivan et.
al., Infect. Immun., 53:573 (1986).! Citrated rabbit red blood cells
(RRBC)(Cocalico) were washed several times with Tris-buffer (0.1M Tris and
50 mM NaCl) by centrifugation at 450 xg for 10 minutes at 4.degree. C. A
1% RRBC suspension was made from the packed cells and resuspended in
Tris-buffer. Dilutions of the recombinant proteins and native toxin A
(Tech Labs) were made in the Tris-buffer and added in duplicate to a
round-bottomed 96-well microtiter plate in a final volume of 100 .mu.l. To
each well, 50 .mu.l of the 1% RRBC suspension was added, mixed by gentle
tapping, and incubated at 4.degree. C. for 3-4 hours. Significant
hemagglutination occurred only in the recombinant proteins containing the
binding domain (pMA 1870-2680) and native toxin A. The recombinant protein
outside the binding domain (pMA 1100-1610) displayed no hemagglutination
activity. Using equivalent protein concentrations, the hemagglutination
titer for toxin A was 1:256, while titers for the soluble and insoluble
recombinant proteins of the binding domain were 1:256 and about 1:5000.
Clearly, the recombinant proteins tested retained functional activity and
were able to bind RRBC's.
EXAMPLE 12
Functional Activity Of IgY Reactive Against Toxin A Recombinants
The expression of recombinant toxin A protein as multiple fragments in
E.coli has demonstrated the feasibility of generating toxin A antigen
through use of recombinant methodologies (Example 11). The isolation of
these recombinant proteins allows the immunoreactivity of each individual
subregion of the toxin A protein to be determined (i.e., in a antibody
pool directed against the native toxin A protein). This identifies the
regions (if any) for which little or no antibody response is elicited when
the whole protein is used as a immunogen. Antibodies directed against
specific fragments of the toxin A protein can be purified by affinity
chromatography against recombinant toxin A protein, and tested for
neutralization ability. This identifies any toxin A subregions that are
essential for producing neutralizing antibodies. Comparison with the
levels of immune response directed against these intervals when native
toxin is used as an immunogen predicts whether potentially higher titers
of neutralizing antibodies can be produced by using recombinant protein
directed against a individual region, rather than the entire protein.
Finally, since it is unknown whether antibodies reactive to the
recombinant toxin A proteins produced in Example 11 neutralize toxin A as
effectively as antibodies raised against native toxin A (Examples 9 and
10), the protective ability of a pool of antibodies affinity purified
against recombinant toxin A fragments was assessed for its ability to
neutralize toxin A.
This Example involved (a) epitope mapping of the toxin A protein to
determine the titre of specific antibodies directed against individual
subregions of the toxin A protein when native toxin A protein is used as
an immunogen, (b) affinity purification of IgY reactive against
recombinant protein spanning the toxin A gene, (c) toxin A neutralization
assays with affinity purified IgY reactive to recombinant toxin A protein
to identify subregions of the toxin A protein that induce the production
of neutralizing antibodies, and determination of whether complete
neutralization of toxin A can be elicited with a mixture of antibodies
reactive to recombinant toxin A protein.
(a) Epitope Mapping Of The Toxin A Gene. The affinity purification of
recombinant toxin A protein specific to defined intervals of the toxin A
protein allows epitope mapping of antibody pools directed against native
toxin A. This has not previously been possible, since previous expression
of toxin A recombinants has been assessed only by Western blot analysis,
without knowledge of the expression levels of the protein ›e.g., von
Eichel-Streiber et al, J. Gen. Microbiol., 135:55-64 (1989)!. Thus, high
or low reactivity of recombinant toxin A protein on Western blots may
reflect protein expression level differences, not immunoreactivity
differences. Given that the purified recombinant proteins generated in
Example 11 have been quantitated, the issue of relative immunoreactivity
of individual regions of the toxin A protein was precisely addressed.
For the purposes of this Example, the toxin A protein was subdivided into 6
intervals (1-6), numbered from the amino (interval 1) to the carboxyl
(interval 6) termini.
The recombinant proteins corresponding to these intervals were from
expression clones (see Example 11(d) for clone designations) pMA30-300
(interval 1), pMA300-660 (interval 2), pMA660-1100 (interval 3),
pPA1100-1450 (interval 4), pMA1450-1870 (interval 5) and pMA1870-2680
(interval 6). These 6 clones were selected because they span the entire
protein from amino acids numbered 30 through 2680, and subdivide the
protein into 6 small intervals. Also, the carbohydrate binding repeat
interval is contained specifically in one interval (interval 6), allowing
evaluation of the immune response specifically directed against this
region. Western blots of 7.5% SDS-PAGE gels, loaded and electrophoresed
with defined quantities of each recombinant protein, were probed with
either goat antitoxin A polyclonal antibody (Tech Lab) or chicken
antitoxin A polyclonal antibody ›pCTA IgY, Example 8(c)!. The blots were
prepared and developed with alkaline phosphatase as previously described
(Williams et al). At least 90% of all reactivity, in either goat or
chicken antibody pools, was found to be directed against the ligand
binding domain (interval 6). The remaining immunoreactivity was directed
against all five remaining intervals, and was similar in both antibody
pools, except that the chicken antibody showed a much lower reactivity
against interval 2 than the goat antibody.
This clearly demonstrates that when native toxin A is used as an immunogen
in goats or chickens, the bulk of the immune response is directed against
the ligand binding domain of the protein, with the remaining response
distributed throughout the remaining 2/3 of the protein.
(b) Affinity Purification Of IgY Reactive Against Recombinant Toxin A
Protein. Affinity columns, containing recombinant toxin A protein from the
6 defined intervals in (a) above, were made and used to (i) affinity
purify antibodies reactive to each individual interval from the CTA IgY
preparation ›Example 8(c)!, and (ii) deplete interval specific antibodies
from the CTA IgY preparation. Affinity columns were made by coupling 1 ml
of PBS-washed Actigel resin (Sterogene) with region specific protein and
1/10 final volume of Ald-coupling solution (1M sodium cyanoborohydride).
The total region specific protein added to each reaction mixture was 2.7
mg (interval 1), 3 mg (intervals 2 and 3), 0.1 mg (interval 4), 0.2 mg
(interval 5) and 4 mg (interval 6). Protein for intervals 1, 3, and 6 was
affinity purified pMAl fusion protein in column buffer (see Example 11).
Interval 4 was affinity purified poly-histidine containing pET fusion in
PBS; intervals 2 and 5 were from inclusion body preparations of insoluble
pMAL fusion protein, dialysed extensively in PBS. Aliquots of the
supernatants from the coupling reactions, before and after coupling, were
assessed by Coomassie staining of 7.5% SDS-PAGE gels. Based on protein
band intensities, in all cases greater than 50% coupling efficiencies were
estimated. The resins were poured into 5 ml BioRad columns, washed
extensively with PBS, and stored at 4.degree. C.
Aliquots of the CTA IgY polyclonal antibody preparation were depleted for
each individual region as described below. A 20 ml sample of the CTA. IgY
preparation ›Example 8(c)! was dialysed extensively against 3 changes of
PBS (1 litre for each dialysis), quantitated by absorbance at OD.sub.280,
and stored at 4.degree. C. Six 1 ml aliquots of the dialysed IgY
preparation were removed, and depleted individually for each of the six
intervals. Each 1 ml aliquot was passed over the appropriate affinity
column, and the eluate twice reapplied to the column. The eluate was
collected, and pooled with a 1 ml PBS wash. Bound antibody was eluted from
the column by washing with 5 column volumes of 4M Guanidine-HCl (in 10 mM
Tris-HCl, pH 80). The column was reequilibrated in PBS, and the depleted
antibody stock reapplied as described above. The eluate was collected,
pooled with a 1 ml PBS wash, quantitated by absorbance at OD.sub.280, and
stored at 4.degree. C. In this manner, 6 aliquots of the CTA IgY
preparation were individually depleted for each of the 6 toxin A
intervals, by two rounds of affinity depletion. The specificity of each
depleted stock was tested by Western blot analysis. Multiple 7.5% SDS-PAGE
gels were loaded with protein samples corresponding to all 6 toxin A
subregions. After electrophoresis, the gels were blotted, and protein
transfer confirmed by Ponceau S staining (protocols described in Williams
et al). After blocking the blots 1 hr at 20.degree. C. in PBS+0.1% Tween
20 (PBST) containing 5% milk (as a blocking buffer), 4 ml of either a
1/500 dilution of the dialysed CTA IgY preparation in blocking buffer, or
an equivalent amount of the six depleted antibody stocks (using OD.sub.280
to standardize antibody concentration) were added and the blots incubated
a further 1 hr at room temperature. The blots were washed and developed
with alkaline phosphatase (using a rabbit anti-chicken alkaline phosphate
conjugate as a secondary antibody) as previously described (Williams et
al). In all cases, only the target interval was depleted for antibody
reactivity, and at least 90% of the reactivity to the target intervals was
specifically depleted.
Region specific antibody pools were isolated by affinity chromatography as
described below. Ten mls of the dialysed CTA IgY preparation were applied
sequentially to each affinity column, such that a single 10 ml aliquot was
used to isolate region specific antibodies specific to each of the six
subregions. The columns were sequentially washed with 10 volumes of PBS, 6
volumes of BBS-Tween, 10 volumes of TBS, and eluted with 4 ml Actisep
elution media (Sterogene). The eluate was dialysed extensively against
several changes of PBS, and the affinity purified antibody collected and
stored at 4.degree. C. The volumes of the eluate increased to greater than
10 mls during dialysis in each case, due to the high viscosity of the
Actisep elution media. Aliquots of each sample were 20.times. concentrated
using Centricon 30 microconcentrators (Amicon) and stored at 4.degree. C.
The specificity of each region specific antibody pool was tested, relative
to the dialysed CTA IgY preparation, by Western blot analysis, exactly as
described above, except that 4 ml samples of blocking buffer containing
100 .mu.l region specific antibody (unconcentrated) were used instead of
the depleted CTA IgY preparations. Each affinity purified antibody
preparation was specific to the defined interval, except that samples
purified against intervals 1-5 also reacted with interval 6. This may be
due to non-specific binding to the interval 6 protein, since this protein
contains the repetitive ligand binding domain which has been shown to bind
antibodies nonspecifically. ›Lyerly et al., Curr. Microbiol., 19:303-306
(1989).!
The reactivity of each affinity purified antibody preparation to the
corresponding proteins was approximately the same as the reactivity of the
11500 diluted dialysed CTA IgY preparation standard. Given that the
specific antibody stocks were diluted 1/40, this would indicate that the
unconcentrated affinity purified antibody stocks contain 1/10-1/20 the
concentration of specific antibodies relative to the starting CTA IgY
preparation.
(e) Toxin A Neutralization Assay Using Antibodies Reactive Toward
Recombinant Toxin A Protein. The CHO toxin neutralization assay ›Example
8(d)! was used to assess the ability of the depleted or enriched samples
generated in (b) above to neutralize the cytotoxicity of toxin A. The
general ability of affinity purified antibodies to neutralize toxin A was
assessed by mixing together aliquots of all 6 concentrated stocks of the 6
affinity purified samples generated in (b) above, and testing the ability
of this mixture to neutralize a toxin A concentration of 0.1 .mu.g/ml. The
results, shown in FIG. 11, demonstrate almost complete neutralization of
toxin A using the affinity purified (AP) mix. Some epitopes within the
recombinant proteins utilized for affinity purification were probably lost
when the proteins were denatured before affinity purification ›by
Guanidine-HCl treatment in (b) above!. Thus, the neutralization ability of
antibodies directed against recombinant protein is probably underestimated
using these affinity purified antibody pools. This experiment demonstrates
that antibodies reactive to recombinant toxin A can neutralize
cytotoxicity, suggesting that neutralizing antibodies may be generated by
using recombinant toxin A protein as immunogen.
In view of the observation that the recombinant expression clones of the
toxin A gene divide the protein into 6 subregions, the neutralizing
ability of antibodies directed against each individual region was
assessed. The neutralizing ability of antibodies directed against the
ligand binding domain of toxin A was determined first.
In the toxin neutralization experiment shown in FIG. 11, interval 6
specific antibodies (interval 6 contains the ligand binding domain) were
depleted from the dialysed PEG preparation, and the effect on toxin
neutralization assayed. Interval 6 antibodies were depleted either by
utilizing the interval 6 depleted CTA IgY preparation from (b) above ("-6
aff. depleted" in FIG. 11), or by addition of interval 6 protein to the
CTA IgY preparation (estimated to be a 10 fold molar excess over
anti-interval 6 immunoglobulin present in this preparation) to
competitively compete for interval 6 protein ("-6 prot depleted" in FIG.
11). In both instances, removal of interval 6 specific antibodies reduces
the neutralization efficiency relative to the starting CTA IgY
preparation. This demonstrates that antibodies directed against interval 6
contribute to toxin neutralization. Since interval 6 corresponds to the
ligand binding domain of the protein, these results demonstrate that
antibodies directed against this region in the PEG preparation contribute
to the neutralization of toxin A in this assay. However, it is significant
that after removal of these antibodies, the PEG preparation retains
significant ability to neutralize toxin A (FIG. 11). This neutralization
is probably due to the action of antibodies specific to other regions of
the toxin A protein, since at least 90% of the ligand binding region
reactive antibodies were removed in the depleted sample prepared in (b)
above. This conclusion was supported by comparison of the toxin
neutralization of the affinity purified (AP) mix compared to affinity
purified interval 6 antibody alone. Although some neutralization ability
was observed with AP interval 6 antibodies alone, the neutralization was
significantly less than that observed with the mixture of all 6 AP
antibody stocks (not shown).
Given that the mix of all six affinity purified samples almost completely
neutralized the cytotoxicity of toxin A (FIG. 11), the relative importance
of antibodies directed against toxin A intervals 1-5 within the mixture
was determined. This was assessed in two ways. First, samples containing
affinity purified antibodies representing 5 of the 6 intervals were
prepared, such that each individual region was depleted from one sample.
FIG. 12 demonstrates a sample neutralization curve, comparing the
neutralization ability of affinity purified antibody mixes without
interval 4 (-4) or 5 (-5) specific antibodies, relative to the mix of all
6 affinity purified antibody stocks (positive control). While the removal
of interval 5 specific antibodies had no effect on toxin neutralization
(or intervals 1-3, not shown), the loss of interval 4 specific antibodies
significantly reduced toxin neutralization (FIG. 12).
Similar results were seen in a second experiment, in which affinity
purified antibodies, directed against a single region, were added to
interval 6 specific antibodies, and the effects on toxin neutralization
assessed. Only interval 4 specific antibodies significantly enhanced
neutralization when added to interval 6 specific antibodies (FIG. 13).
These results demonstrate that antibodies directed against interval 4
(corresponding to clone pPA1100-1450 in FIG. 9) are important for
neutralization of cytotoxicity in this assay. Epitope mapping has shown
that only low levels of antibodies reactive to this region are generated
when native toxin A is used as an immunogen ›Example 12(a)!. It is
hypothesized that immunization with recombinant protein specific to this
interval will elicit higher titers of neutralizing antibodies. In summary,
this analysis has identified two critical regions of the toxin A protein
against which neutralizing antibodies are produced, as assayed by the CHO
neutralization assay.
EXAMPLE 13
Production And Evaluation Of Avian Antitoxin Against C. difficile
Recombinant Toxin A Polypeptide
In Example 12, we demonstrated neutralization of toxin A mediated
cytotoxicity by affinity purified antibodies reactive to recombinant toxin
A protein. To determine whether antibodies raised against a recombinant
polypeptide fragment of C. difficile toxin A may be effective in treating
clostridial diseases, antibodies to recombinant toxin A protein
representing the binding domain were generated. Two toxin A binding domain
recombinant polypetides, expressing the binding domain in either the pMALc
(pMA1870-2680) or pET 23(pPA1870-2680) vector, were used as immunogens.
The pMAL protein was affinity purified as a soluble product ›Example
12(d)! and the pET protein was isolated as insoluble inclusion bodies
›Example 12(d)! and solublized to an immunologically active protein using
a proprietary method described in a pending patent application (U.S.
patent application Ser. No. 08/129,027). This Example involves (a)
immunization, (b) antitoxin collection, (c) determination of antitoxin
antibody titer, (d) anti-recombinant toxin A neutralization of toxin A
hemagglutination activity in vitro, and (e) assay of in vitro toxin A
neutralizing activity.
(a) Immunization. The soluble and the inclusion body preparations each were
used separately to immunize hens. Both purified toxin A polypeptides were
diluted in PBS and emulsified with approximately equal volumes of CFA for
the initial immunization or IFA for subsequent booster immunizations. On
day zero, for each of the recombinant preparations, two egg laying white
Leghorn hens (obtained from local breeder) were each injected at multiple
sites (intramuscular and subcutaneous) with 1 ml of recombinant adjuvant
mixture containing approximately 0.5 to 1.5 mgs of recombinant toxin A.
Booster immunizations of 1.0 mg were given on days 14 and day 28.
(b) Antitoxin Collection. Total yolk immune IgY was extracted as described
in the standard PEG protocol (as in Example 1) and the final IgY pellet
was dissolved in sterile PBS at the original yolk volume. This material is
designated "immune recombinant IgY "or" immune IgY."
(c) Antitoxin Antibody Titer. To determine if the recombinant toxin A
protein was sufficiently immunogenic to raise antibodies in hens, the
antibody titer of a recombinant toxin A polypeptide was determined by
ELISA. Eggs from both hens were collected on day 32, the yolks pooled and
the antibody was isolated using PEG as described. The immune recombinant
IgY antibody titer was determined for the soluble recombinant protein
containing the maltose binding protein fusion generated in p-Mal (pMAl
870-2680). Ninety-six well Falcon Pro-bind plates were coated overnight at
4.degree. C. with 100 .mu.l /well of toxin A recombinant at 2.5 .mu.g
/.mu.l in PBS containing 0.05% thimerosal. Another plate was also coated
with maltose binding protein (MBP) at the same concentration, to permit
comparison of antibody reactivity to the fusion partner. The next day, the
wells were blocked with PBS containing 1% bovine serum albumin (BSA) for 1
hour at 37.degree. C. IgY isolated from immune or preimmune eggs was
diluted in antibody diluent (PBS containing 1% BSA and 0.05% 20 Tween-20),
and added to the blocked wells and incubated for 1 hour at 37.degree. C .
The plates were washed three times with PBS with 0.05% Tween-20, then
three times with PBS. Alkaline phosphatase conjugated rabbit anti-chicken
IgG (Sigma) diluted 1:1000 in antibody diluent was added to the plate, and
incubated for 1 hour at 37.degree. C. The plates were washed as before and
substrate was added, ›p-nitrophenyl phosphate (Sigma)! at 1 mg/ml in 0.05M
Na.sub.2 CO.sub.3, pH 9.5 and 10 mM MgCl.sub.2. The plates were evaluated
quantitatively on a Dynatech MR 300 Micro EIA plate reader at 410 nm about
10 minutes after the addition of substrate.
Based on these ELISA results, high antibody titers were raised in chickens
immunized with the toxin A recombinant polypeptide. The recombinant
appeared to be highly immunogenic, as it was able to generate high
antibody titers relatively quickly with few immunizations. Immune IgY
titer directed specifically to the toxin A portion of the recombinant was
higher than the immune IgY titer to its fusion partner, the maltose
binding protein, and significantly higher than the preimmune IgY. ELISA
titers (reciprocal of the highest dilution of IgY generating a signal) in
the preimmune IgY to the MBP or the recombinant was <1:30 while the immune
IgY titers to MBP and the toxin A recombinant were 1:18750 and >1:93750
respectively. Importantly, the anti-recombinant antibody titers generated
in the hens against the recombinant polypeptide is much higher, compared
to antibodies to that region raised using native toxin A. The recombinant
antibody titer to region 1870-2680 in the CTA antibody preparation is at
least five-fold lower compared to the recombinant generated antibodies
(1:18750 versus >1:93750). Thus, it appears a better immune response can
be generated against a specific recombinant using that recombinant as the
immunogen compared to the native toxin A.
This observation is significant, as it shows that because recombinant
portions stimulate the production of antibodies, it is not necessary to
use native toxin molecules to produce antitoxin preparations. Thus, the
problems associated with the toxicity of the native toxin are avoided and
large-scale antitoxin production is facilitated.
(d) Anti-recombinant Toxin A Neutralization of Toxin A Hemagglutination
Activity in vitro. Toxin A has hemagglutinating activity besides cytotoxic
and enterotoxic properties. Specifically, toxin A agglutinates rabbit
erythrocytes by binding to a trisaccharide (gal 1-3B1-4GlcNAc) on the cell
surface. ›H. Krivan et al., Infect. Immun., 53:573-581 (1986).! We
examined whether the anti-recombinant toxin A (immune IgY, antibodies
raised against the insoluble product expressed in pET) can neutralize the
hemagglutination activity of toxin A in vitro. The hemagglutination assay
procedure used was described by H. C. Krivan et al. Polyethylene
glycol-fractionated immune or preimmune IgY were pre-absorbed with
citrated rabbit erythrocytes prior to performing the hemagglutination
assay because we have found that IgY alone can agglutinate red blood
cells. Citrated rabbit red blood cells (RRBC's)(Cocalico) were washed
twice by centrifugation at 450.times.g with isotonic buffer (0.1M
Tris-HCl, 0.05M NaCl, pH 7.2). RRBC-reactive antibodies in the IgY were
removed by preparing a 10% RRBC suspension (made by adding packed cells to
immune or preimmune IgY) and incubating the mixture for 1 hour at
37.degree. C. The RRBCs were then removed by centrifugation.
Neutralization of the hemagglutination activity of toxin A by antibody was
tested in round-bottomed 96-well microtiter plates. Twenty-five .mu.l of
toxin A (36 .mu.g /ml) (Tech Lab) in isotonic buffer was mixed with an
equal volume of different dilutions of immune or preimmune IgY in isotonic
buffer, and incubated for 15 minutes at room temperature. Then, 50 .mu.l
of a 1% RRBC suspension in isotomic buffer was added and the mixture was
incubated for 3 hours at 4.degree. C. Positive control wells containing
the final concentration of 9 .mu.g/ml of toxin A after dilution without
IgY were also included. Hemagglutination activity was assessed visually,
with a diffuse matrix of RRBC's coating the bottom of the well
representing a positive hemagglutination reaction and a tight button of
RRBC's at the bottom of the well representing a negative reaction. The
anti-recombinant immune IgY neutralized toxin A hemagglutination activity,
giving a neutralization titer of 1:8. However, preimmune IgY was unable to
neutralize the hemagglutination ability of toxin A.
(e) Assay Of in vitro Toxin A Neutralizing Activity. The ability of the
anti-recombinant toxin A IgY (immune IgY antibodies raised against
pMA1870-2680, the soluble recombinant binding domain protein expressed in
pMAL, designated as Anti-tox. A-s in FIG. 14, and referred to as
recombinant region 6) and pre-immune IgY, prepared as described in Example
8(c) above, to neutralize the cytotoxic activity of toxin A was assessed
in vitro using the CHO cell cytotoxicity assay, and toxin A (Tech Lab) at
a concentration of 0.1 .mu.g/ml, as described in Example 8(d) above. As
additional controls, the anti-native toxin A IgY (CTA) and pre-immune IgY
preparations described in Example 8(c) above were also tested. The results
are shown in FIG. 14.
The anti-recombinant toxin A IgY demonstrated only partial neutralization
of the cytotoxic activity of toxin A, while the pre-immune IgY did not
demonstrate any significant neutralizing activity.
EXAMPLE 14
In Vivo Neutralization Of C. difficile Toxin A
The ability of avian antibodies (IgY) raised against recombinant toxin A
binding domain to neutralize the enterotoxic activity of C. difficile
toxin A was evaluated in vivo using Golden Syrian hamsters. The Example
involved: (a) preparation of the avian anti-recombinant toxin A IgY for
oral administration; (b) in vivo protection of hamsters from C. difficile
toxin A enterotoxicity by treatment of toxin A with avian anti-recombinant
toxin A IgY; and (c) histologic evaluation of hamster ceca.
(a) Preparation of the Avian Anti-recombinant Toxin A IgY for Oral
Administration. Eggs were collected from hens which had been immunized
with the recombinant C. difficile toxin A fragment pMA1870-2680 (described
in Example 13, above). A second group of eggs purchased at a local
supermarket was used as a pre-immune (negative) control. Egg yolk
immunoglobulin (IgY) was extracted by PEG from the two groups of eggs as
described in Example 8(c), and the final IgY pellets were solubilized in
one-fourth the original yolk volume using 0.1M carbonate buffer (mixture
of NaHCO.sub.3 and Na.sub.2 CO.sub.3), pH 9.5. The basic carbonate buffer
was used in order to protect the toxin A from the acidic pH of the stomach
environment.
(b) In vivo Protection Of Hamsters Against C. difficile Toxin A
Enterotoxicity By Treatment of Toxin A with Avian Anti-recombinant Toxin A
IgY. In order to assess the ability of the avian anti-recombinant toxin A
IgY, prepared in section (a) above to neutralize the in vivo enterotoxic
activity of toxin A, an in vivo toxin neutralization model was developed
using Golden Syrian hamsters. This model was based on published values for
the minimum amount of toxin A required to elicit diarrhea (0.08 mg toxin
A/Kg body wt.) and death (0.16 mg toxin A/Kg body wt.) in hamsters when
administered orally (Lyerly et al. Infect. Immun., 47:349-352 (1985).
For the study, four separate experimental groups were used, with each group
consisting of 7 female Golden Syrian hamsters (Charles River), approx.
three and one-half weeks old, weighing approx. 50 gms each. The animals
were housed as groups of 3 and 4, and were offered food and water ad
libitum through the entire length of the study.
For each animal, a mixture containing either 10 .mu.g of toxin A (0.2
mg/Kg) or 30 .mu.g of toxin A (0.6 mg/Kg) (C. difficile toxin A was
obtained from Tech Lab and 1 ml of either the anti-recombinant toxin A IgY
or pre-immune IgY (from section (a) above) was prepared. These mixtures
were incubated at 37.degree. C. for 60 min. and were then administered to
the animals by the oral route. The animals were then observed for the
onset of diarrhea and death for a period of 24 hrs. following the
administration of the toxin A+IgY mixtures, at the end of which time, the
following results were tabulated and shown in Table 17:
TABLE 17
______________________________________
Study Outcome At 24 Hours
Study Outcome at 24 Hours
Experimental Group Healthy.sup.1
Diarrhea.sup.2
Dead.sup.3
______________________________________
10 .mu.g Toxin A + Antitoxin
7 0 0
Against Interval 6
30 .mu.g Toxin A + Antitoxin
7 0 0
Against Interval 6
10 .mu.g Toxin A + Pre-Immune Serum
0 5 2
30 .mu.g Toxin A + Pre-Immune
0 5 2
______________________________________
.sup.1 Animals remained healthy through the entire 24 hour study period.
.sup.2 Animals developed diarrhea, but did not die.
.sup.3 Animals developed diarrhea, and subsequently died.
Pretreatment of toxin A at both doses tested, using the anti-recombinant
toxin A IgY, prevented all overt symptoms of disease in hamsters.
Therefore, pretreatment of C. difficile toxin A, using the
anti-recombinant toxin A IgY, neutralized the in vivo enterotoxic activity
of the toxin A. In contrast, all animals from the two groups which
received toxin A which had been pretreated using pre-immune IgY developed
disease symptoms which ranged from diarrhea to death. The diarrhea which
developed in the 5 animals which did not die in each of the two pre-immune
groups, spontaneously resolved by the end of the 24 hr. study period.
(c) Histologic Evaluation Of Hamster Ceca. In order to further assess the
ability of anti-recombinant toxin A IgY to protect hamsters from the
enterotoxic activity of toxin A, histologic evaluations were performed on
the ceca of hamsters from the study described in section (b) above.
Three groups of animals were sacrificed in order to prepare histological
specimens. The first group consisted of a single representative animal
taken from each of the 4 groups of surviving hamsters at the conclusion of
the study described in section (b) above. These animals represented the 24
hr. timepoint of the study.
The second group consisted of two animals which were not part of the study
described above, but were separately treated with the same toxin
A+pre-immune IgY mixtures as described for the animals in section (b)
above. Both of these hamsters developed diarrhea, and were sacrificed 8
hrs. after the time of administration of the toxin A+ pre-immune IgY
mixtures. At the time of sacrifice, both animals were presenting symptoms
of diarrhea These animals represented the acute phase of the study.
The final group consisted of a single untreated hamster from the same
shipment of animals as those used for the two previous groups. This animal
served as the normal control.
Samples of cecal tissue were removed from the 7 animals described above,
and were fixed overnight at 4.degree. C. using 10% buffered formalin. The
fixed tissues were paraffin-embedded, sectioned, and mounted on glass
microscope slides. The tissue sections were then stained using hematoxylin
and eosin (H and E stain), and were examined by light microscopy.
The tissues obtained from the two 24 hr. animals which received mixtures
containing either 10 .mu.g or 30 .mu.g of toxin A and anti-recombinant
toxin A IgY were indistinguishable from the normal control, both in terms
of gross pathology, as well as at the microscopic level. These
observations provide further evidence for the ability of anti-recombinant
toxin A IgY to effectively neutralize the in vivo enterotoxic activity of
C. difficile toxin A, and thus its ability to prevent acute or lasting
toxin A-induced pathology.
In contrast, the tissues from the two 24 hr. animals which received the
toxin A+pre-immune IgY mixtures demonstrated significant pathology. In
both of these groups, the mucosal layer was observed to be less organized
than in the normal control tissue. The cytoplasm of the epithelial cells
had a vacuolated appearance, and gaps were present between the epithelium
and the underlying cell layers. The lamina propria was largely absent.
Intestinal villi and crypts were significantly diminished, and appeared to
have been overgrown by a planar layer of epithelial cells and fibroblasts.
Therefore, although these animals overtly appeared to recover from the
acute symptoms of toxin A intoxication, lasting pathologic alterations to
the cecal mucosa had occurred.
The tissues obtained from the two acute animals which received mixtures of
toxin A and pre-immune IgY demonstrated the most significant pathology. At
the gross pathological level, both animals were observed to have severely
distended ceca which were filled with watery, diarrhea-like material. At
the microscopic level, the animal that was given the mixture containing 10
.mu.g of toxin A and pre-immune IgY was found to have a mucosal layer
which had a ragged, damaged appearance, and a disorganized, compacted
quality. The crypts were largely absent, and numerous breaks in the
epithelium had occurred. There was also an influx of erythrocytes into
spaces between the epithelial layer and the underlying tissue. The animal
which had received the mixture containing 30 .mu.g of toxin A and
pre-immune IgY demonstrated the most severe pathology. The cecal tissue of
this animal had an appearance very similar to that observed in animals
which had died from C. difficile disease. Widespread destruction of the
mucosa was noted, and the epithelial layer had sloughed. Hemmorhagic areas
containing large numbers of erythrocytes were very prevalent. All
semblance of normal tissue architecture was absent from this specimen. In
terms of the presentation of pathologic events, this in vivo hamster model
of toxin A-intoxication correlates very closely with the pathologic
consequences of C. difficile disease in hamsters. The results presented in
this Example demonstrate that while anti-recombinant toxin A IgY is
capable of only partially neutralizing the cytotoxic activity of C.
difficile toxin A, the same antibody effectively neutralizes 100% of the
in vivo enterotoxic activity of the toxin. While it is not intended that
this invention be limited to this mechanism, this may be due to the
cytotoxicity and enterotoxicity of C. difficile Toxin A as two separate
and distinct biological functions.
From the above it is clear that the present invention provides compositions
and methods for effective therapy against clostridial toxin disease
therapy. It is also contemplated that these antitoxins be used for
diagnostic purposes.
__________________________________________________________________________
SEQUENCE LISTING
(1) GENERAL INFORMATION:
(iii) NUMBER OF SEQUENCES: 5
(2) INFORMATION FOR SEQ ID NO:1:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 24 base pairs
(B) TYPE: nucleic acid
(C) STRANDEDNESS: single
(D) TOPOLOGY: linear
(ii) MOLECULE TYPE: DNA (genomic)
(xi) SEQUENCE DESCRIPTION: SEQ ID NO:1:
GGAAATTTAGCTGCAGCATCTGAC24
(2) INFORMATION FOR SEQ ID NO:2:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 24 base pairs
(B) TYPE: nucleic acid
(C) STRANDEDNESS: single
(D) TOPOLOGY: linear
(ii) MOLECULE TYPE: DNA (genomic)
(xi) SEQUENCE DESCRIPTION: SEQ ID NO:2:
TCTAGCAAATTCGCTTGTGTTGAA24
(2) INFORMATION FOR SEQ ID NO:3:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 20 base pairs
(B) TYPE: nucleic acid
(C) STRANDEDNESS: single
(D) TOPOLOGY: linear
(ii) MOLECULE TYPE: DNA (genomic)
(xi) SEQUENCE DESCRIPTION: SEQ ID NO:3:
CTCGCATATAGCATTAGACC20
(2) INFORMATION FOR SEQ ID NO:4:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 19 base pairs
(B) TYPE: nucleic acid
(C) STRANDEDNESS: single
(D) TOPOLOGY: linear
(ii) MOLECULE TYPE: DNA (genomic)
(xi) SEQUENCE DESCRIPTION: SEQ ID NO:4:
CTATCTAGGCCTAAAGTAT19
(2) INFORMATION FOR SEQ ID NO:5:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 12 amino acids
(B) TYPE: amino acid
(C) STRANDEDNESS: single
(D) TOPOLOGY: unknown
(ii) MOLECULE TYPE: peptide
(xi) SEQUENCE DESCRIPTION: SEQ ID NO:5:
CysGlnThrIleAspGlyLysLysTyrTyrPheAsn
1510
__________________________________________________________________________
Top