Back to EveryPatent.com
United States Patent |
5,728,820
|
Akerblom
|
March 17, 1998
|
Human eosinophil-derived basic protein
Abstract
The present invention provides a human eosinophil-derived basic protein
(EBPH) and polynucleotides which identify and encode EBPH. The invention
also provides genetically engineered expression vectors and host cells
comprising the nucleic acid sequences encoding EBPH and a method for
producing EBPH. The invention also provides for use of EBPH and agonists,
antibodies or antagonists specifically binding EBPH, in the prevention and
treatment of diseases associated with expression of EBPH. Additionally,
the invention provides for the use of antisense molecules to
polynucleotides encoding EBPH for the treatment of diseases associated
with the expression of EBPH. The invention also provides diagnostic assays
which utilize the polynucleotide, or fragments or the complement thereof,
and antibodies specifically binding EBPH.
Inventors:
|
Akerblom; Ingrid E. (Redwood City, CA)
|
Assignee:
|
Incyte Pharmaceuticals, Inc. (Palo Alto, CA)
|
Appl. No.:
|
740036 |
Filed:
|
October 23, 1996 |
Intern'l Class: |
C07H 021/04; C12N 015/63; C12P 021/02 |
Field of Search: |
536/23.5,24.31
435/320.1,70.1,325
|
References Cited
Other References
Gleich et al., "The eosinophil as a mediator of damage to respiratory
epithelium: A model for bronchial hyperreactivity," J. Allergy Clin.
Immun., 81(5) (1):776-781 (1988).
Frigas et al., "Elevated Levels of the Eosinophil Granule Major Basic
Protein in the Sputum of Patients with Bronchial Asthma," Mayo Clin.
Proc., 56:345-353 (1981).
Filley et al., "Identification By Immunofluorescence of Eosinophil,
Granule, Major Basic Protein in Lung Tissues of Patients with Bronchial
Asthma", Lancet, 2:11-16 (Jul. 3, 1982).
Sarmiento et al., "IL-3, IL-5, and Granulocyte-Macrophage
Colony-Stimulating Factor Potentiate Basophil Mediator Release Stimulated
by Eosinophil Granule Major Basic Protein," J. Immunol., 155:2211-2221
(1995).
Moy et al., Identification of an IgA inhibitor of neutrophil chemotaxis and
its membrane target for the metabolic burst, J. Immunol., 145:2626-2632
(1990).
Rohrbach et al., "Activation of Platelets by Eosinophil Granule Proteins"
J. Exp. Med., 145:1271-1274 (1990).
Kita et al., "Eosinophil Major Basic Protein Induces Degranulation and IL-8
Production by Human Eosinophilsl," The Journal of Immunology,
154:4749-4758 (1995).
Popken-Harris et al., "Expression, Purification, and Characterization of
the Recombinant Proform of Eosinophil Granule Major Basci Protein," J.
Immunol., 155:1472-1480 (1995).
Oxvig, et al., "Localization of disulfide bridges and free sulfyhydryl
groups in human eosinophil granule major basic protein," FEBS Lett.,
341:213-217 (1994).
Abu-Ghazaleh, "Interaction of Eosinophil Granule Major Basic Protein with
Synthetic Lipid Bilayers: A Mechanism for Toxicity," J. Membrane Biol.,
128:153-164 (1992).
Wagner, "Pregnancy-Associated Major Basic Protein: Deposition of Protein
and Expression of mRNA at the Maternal-Fetal Junction in Early and Late
Gestation," Placenta, 15:625-640 (1994).
Maddox, "Localization of a Molecule Immunochemically Similar to Eosinophil
Major Basic Protein in Human Placenta," J. Exp. Med., 160:29-41 (1984).
Oxvig, "Circulating Human Pregnancy-Associated Plasma Protein-A Is
Disulfide-bridged to the Proform of Eosinophil Major Basic Protein," The
Journal of Biological Chemistry, 268(17):12243-12246 (1993).
Oxvig, "Identification of Angiotensinogen and Complement C3dg ans Novel
Proteins Binding the Proform of Eosinophil Major Basic Protein in Human
Pregnancy Serum and Plasma," The Journal of Biological Chemistry,
270(23):13645-13651 (1995).
Brambati et al., "Low Material Serum levels of pregnancy associated plasma
protein A (PAPP-A) in the first trimester in association with abnormal
fetal karyotype," British Journal of Obstetrics and Gynecology,
100:324-326 (Apr. 1993).
Tewksbury et al., "Immunochemical Comparison of High Molecular Weight
Angiotensinogen from Amniotic Fluid, Plasma of Men, and Plasma of Pregnant
Women," J. Exp. Med., 168:1493-1498 (1988).
Barker et al., "Acidic Precursor Revealed in Human Eosinophil Granule Major
Basic Protein cDNA," J. Exp. Med., 168:1493-1498 (Sep. 1988) (GI 34476).
Aoki et al., "Comparison of the amino acid and nucleotide sequences between
human and two guinea pig major basic proteins," FEBS Letters, 282(1):
56-60 (GI 220291 & GI 544241) (1994).
|
Primary Examiner: Saunders; David
Assistant Examiner: VanderVegt; F. Pierre
Attorney, Agent or Firm: Billings; Lucy J.
Claims
What is claimed is:
1. An isolated and purified polynucleotide sequence encoding the
eosinophil-derived basic protein of SEQ ID NO:1.
2. A hybridization probe consisting of the polynucleotide sequence of claim
1.
3. An isolated and purified polynucleotide sequence consisting of SEQ ID
NO:2.
4. A polynucleotide sequence which is complementary to SEQ ID NO:2.
5. A hybridization probe consisting of the polynucleotide sequence of claim
4.
6. An expression vector containing the polynucleotide sequence of claim 1.
7. A host cell containing the vector of claim 6.
8. A method for producing a polypeptide comprising the amino acid sequence
of SEQ ID NO:1, the method comprising the steps of:
a) culturing the host cell of claim 7 under conditions suitable for the
expression of the polypeptide; and
b) recovering the polypeptide from the host cell culture.
Description
FIELD OF THE INVENTION
This invention relates to nucleic acid and amino acid sequences of a novel
human eosinophil-derived basic protein and to the use of these sequences
in the diagnosis, prevention, and treatment of disease.
BACKGROUND OF THE INVENTION
Stem cells are progenitor blood cells which differentiate to mature white
blood cells, red blood cells, and platelets. Stem cells are found in adult
bone marrow, in fetal liver and spleen, and in blood collected from the
umbilical cord after the birth of a baby.
Eosinophil growth and differentiation from stem cells is regulated by
hematopoietic growth factors including granulocyte-macrophage colony
stimulating factor (GM-CSF), interleukin-3 (IL-3), and interleukin-5
(IL-5). IL-5 is a potent eosinophil differentiation and activation factor,
while GM-CSF and IL-3 also increase the production of other myeloid cells.
Eosinophils are white blood cells which are sub-classified as granulocytes
due to the presence of large, coarse membrane-bound cytoplasmic granules.
These granules contain proteins and other compounds which carry out a
variety of inflammatory and immune functions. In response to chemotactic
factors, eosinophils migrate through blood vessel walls and through
tissues to the site where they are needed. There the contents of the
granules are released in response to specific stimuli. Eosinophil granule
release is stimulated by immunoglobulin E (IgE)-mediated hypersensitivity
reactions such as parasitic infections and type I allergic reactions. Such
type I allergic reactions include asthma and allergic rhinitis.
A variety of eosinophil-derived basic proteins (EDBPs) are released from
eosinophil granules. These cytotoxic proteins disrupt membrane surfaces
and lyse cells. EDBPs are thus potent anti-parasitic and anti-bacterial
agents, however, EDBPs may also damage host tissues. For instance, the
cardiovascular damage associated with chronic hypereosinophilia has been
attributed in part to secreted EDBPs. EDBPs have been shown to damage
respiratory epithelial cells, and have been implicated in the increase in
bronchial hyperreactivity frequently observed in asthma patients. A
significant correlation exists between the intensity of bronchial
hyperreactivity and the levels of EDBPs in blood and bronchoalveolar
lavage (BAL) fluid from asthmatics.
Eosinophil granule major basic protein (MBP), one of the most extensively
characterized EDBPs, is a potent toxin against helminths, protozoa,
bacteria and other cells. MBP also causes epithelial desquamization and
ciliostasis, effects that mimic the pathology of asthma (Gleich, G. J. et
al. (1988) J. Allergy Clin. Immun. 81:776-781). MBP is found in sputa and
on damaged bronchial tissues of asthma patients (Frigas, E. et al. (1981)
Mayo Clin. Proc. 56:345; Filley, W. V. et al. (1982) Lancet 2:11).
Along with its cytolytic properties, MBP also possesses noncytolytic
proinflammatory properties, many of which are associated with late phase
reactions of allergic disease. The release of histamine and leukotriene C4
from basophils is stimulated by MBP and further enhanced by the cytokines
IL-3, IL-5 and GM-CSF (Sarmiento, E. U. et al. (1995) J. Immunol.
155:2211-2221). MBP also stimulates neutrophil activation and
degranulation, including the release of superoxide anion (O2-) and
lysozyme (Moy, J. N. et al. (1990) J. Immunol. 145:2626-2632), and
platelet activation (Rohrbach, M. S. et al. (1990) J. Exp. Med.
172:1271-1274). MBP also induces further eosinophil degranulation (Kita,
H. et al. (1995) J. Immunol. 154:4749-4758).
The cDNA for MBP encodes a 25 kdal preproprotein molecule of 222 amino
acids, which includes a predicted 15 amino acid leader peptide, a 90 amino
acid acidic pro domain and a 117 amino acid mature polypeptide
(Popken-Harris, P. et al. (1995) J. Immunol. 155:1472-1480). The pro
domain of MBP contains a heterogeneous population of O- and N-linked
glycosyl modifications and has an isoelectric point (pI) of approximately
4.9. The 14 kdal mature MBP contains two disulfide bridges and five free
cysteine residues (Oxvig, C. et al. (1994) FEBS Lett. 341:213-217).
The negatively-charged pro domain appears to interact with the
positively-charged mature MBP. This interaction is proposed to inhibit the
activity of mature MBP thus protecting the developing eosinophil from
damage by MBP during granule processing (Popken-Harris, et al. (1995),
supra). Mature MBP, but not proMBP, reacts readily with acidic lipids and
disorders lipid bilayers resulting in the lysis of liposomes
(Abu-Ghazaleh, R. I. et al. (1992) J. Membr. Biol. 128:153-164). Unlike
mature MBP, proMBP does not stimulate basophil histamine release or
neutrophil superoxide generation; in fact, proMBP is an inhibitor of these
MPB-stimulated activities (Popken-Harris, et al. (1995), supra).
ProMBP is expressed in placental X cells and is found in the sera of
pregnant women (Wagner, J. M. et al. (1994) Placenta 15:625-640). Levels
of proMBP peak before labor and rapidly decline after delivery (Maddox, D.
E. et al. (1983) J. Exp. Med. 158:1211-1216). ProMBP of placental origin
is heavily glycosylated and circulates in disulfide-bridged complexes with
pregnancy-associated plasma protein A (PAPP-A), angiotensinogen, and
complement C3dg (Oxvig C. et al. (1993) J. Biol. Chem. 268:12243-12246;
Oxvig C. et al (1995) J. Biol. Chem. 270:13645-13651). Low serum levels of
PAPP-A in the first trimester have been linked to fetal chromosomal
abnormalities (Brambati, M. C. (1993) Br. J. Obstet. Gynaecol.
100:324-326). A high molecular weight (HMW) form of angiotensinogen has
been found in moderate quantities in plasma from pregnant women and in
high quantities in hypertensive pregnant women (Tewksbury, D. A. et al.
(1989) Am. J. Hypertens. 2:411-413). Oxvig and colleagues (1995, supra)
suggest that this HMW angiotensinogen is actually the
proMBP:angiotensinogen complex.
The discovery of polynucleotides encoding a novel EDBP-like molecule, and
the molecule themselves, satisfies a need in the art by providing a new
means for the diagnosis, prevention, or treatment of diseases and
conditions associated with eosinophil accumulation and granule release
including late-phase allergic/inflammatory reactions, eosinophilias,
parasitic infections, and conditions associated with placental
derived-EDBP accumulation in pregnancy.
SUMMARY OF THE INVENTION
The present invention features a novel basic protein derived from IL-5
cultured umbilical cord blood cells, hereinafter designated as EBPH and
characterized as having chemical and structural homology to eosinophil
granule MBPs from human and guinea pig.
Accordingly, the invention features a substantially purified human EBPH
having the structural characteristics of the MBPs above and as shown in
amino acid sequence, SEQ ID NO:1.
One aspect of the invention features isolated and substantially purified
polynucleotides that encode EBPH. In a particular aspect, the
polynucleotide is the nucleotide sequence of SEQ ID NO:2.
The invention also features a polynucleotide sequence comprising the
complement of SEQ ID NO:2 or variants thereof. In addition, the invention
features polynucleotide sequences which hybridize under stringent
conditions to SEQ ID NO:2.
The invention additionally features nucleic acid sequences encoding
polypeptides, oligonucleotides, peptide nucleic acids (PNA), fragments,
portions or antisense molecules thereof, and expression vectors and host
cells comprising polynucleotides that encode EBPH. The present invention
also features antibodies which bind specifically to EBPH, and
pharmaceutical compositions comprising substantially purified EBPH. The
invention also features agonists and antagonists of EBPH.
BRIEF DESCRIPTION OF THE FIGURES
FIGS. 1A and 1B show the amino acid sequence (SEQ ID NO:1) and nucleic acid
sequence (SEQ ID NO:2) of EBPH. The alignment was produced using MacDNASIS
PRO.TM. software (Hitachi Software Engineering Co., Ltd., San Bruno,
Calif.).
FIG. 2 shows the amino acid sequence alignments among EBPH (SEQ ID NO:1),
eosinophil granule MBP from human (GI 34476; SEQ ID NO:3) and two MBP
homologs from guinea pig, GMBP-1 (GI 220291; SEQ ID NO:4), and GMBP-2 (GI
544241, SEQ ID NO:5). The alignment was produced using the multisequence
alignment program of DNASTAR.TM. software (DNASTAR Inc, Madison Wis.).
FIG. 3 shows the hydrophobicity plot (MacDNASIS PRO software) for EBPH, SEQ
ID NO:1; the positive X axis reflects amino acid position, and the
negative Y axis, hydrophobicity.
DESCRIPTION OF THE INVENTION
Before the present protein, nucleotide sequence, and methods are described,
it is understood that this invention is not limited to the particular
methodology, protocols, cell lines, vectors, and reagents described as
these may, of course, vary. It is also to be understood that the
terminology used herein is for the purpose of describing particular
embodiments only, and is not intended to limit the scope of the present
invention which will be limited only by the appended claims.
It must be noted that as used herein and in the appended claims, the
singular forms "a", "an", and "the" include plural reference unless the
context clearly dictates otherwise. Thus, for example, reference to "a
host cell" includes a plurality of such host cells, reference to the
"antibody" is a reference to one or more antibodies and equivalents
thereof known to those skilled in the art, and so forth.
Unless defined otherwise, all technical and scientific terms used herein
have the same meanings as commonly understood by one of ordinary skill in
the art to which this invention belongs. Although any methods and
materials similar or equivalent to those described herein can be used in
the practice or testing of the present invention, the preferred methods,
devices, and materials are now described. All publications mentioned
herein are incorporated herein by reference for the purpose of describing
and disclosing the cell lines, vectors, and methodologies which are
reported in the publications which might be used in connection with the
invention. Nothing herein is to be construed as an admission that the
invention is not entitled to antedate such disclosure by virtue of prior
invention.
DEFINITIONS
"Nucleic acid sequence" as used herein refers to an oligonucleotide,
nucleotide, or polynucleotide, and fragments or portions thereof, and to
DNA or RNA of genomic or synthetic origin which may be single- or
double-stranded, and represent the sense or antisense strand. Similarly,
"amino acid sequence" as used herein refers to an oligopeptide, peptide,
polypeptide, or protein sequence and fragments or portions thereof, of a
naturally occurring or synthetic molecule.
Where "amino acid sequence" is recited herein to refer to an amino acid
sequence of a naturally occurring protein molecule, "amino acid sequence"
and like terms, such as "polypeptide" or "protein" are not meant to limit
the amino acid sequence to the complete, native amino acid sequence
associated with the recited protein molecule.
"Peptide nucleic acid", as used herein, refers to a molecule which
comprises an oligomer to which an amino acid residue, such as lysine, and
an amino group have been added. These small molecules, also designated
anti-gene agents, stop transcript elongation by binding to their
complementary strand of nucleic acid (Nielsen, P. E. et al. (1993)
Anticancer Drug Des. 8:53-63).
EBPH, as used herein, refers to the amino acid sequences of substantially
purified EBPH obtained from any species, particularly mammalian, including
bovine, ovine, porcine, murine, equine, and preferably human, from any
source whether natural, synthetic, semi-synthetic, or recombinant.
"Consensus", as used herein, refers to a nucleic acid sequence which has
been resequenced to resolve uncalled bases, or which has been extended
using XL-PCR.TM. (Perkin Elmer, Norwalk, Conn.) in the 5' and/or the 3'
direction and resequenced, or which has been assembled from the
overlapping sequences of more than one Incyte clone using the GCG Fragment
Assembly.TM. system (GCG, Madison, Wis.), or which has been both extended
and assembled.
A "variant" of EBPH, as used herein, refers to an amino acid sequence that
is altered by one or more amino acids. The variant may have "conservative"
changes, wherein a substituted amino acid has similar structural or
chemical properties, e.g., replacement of leucine with isoleucine. More
rarely, a variant may have "nonconservative" changes, e.g., replacement of
a glycine with a tryptophan. Similar minor variations may also include
amino acid deletions or insertions, or both. Guidance in determining which
amino acid residues may be substituted, inserted, or deleted without
abolishing biological or immunological activity may be found using
computer programs well known in the art, for example, DNASTAR software.
A "deletion", as used herein, refers to a change in either amino acid or
nucleotide sequence in which one or more amino acid or nucleotide
residues, respectively, are absent.
An "insertion" or "addition", as used herein, refers to a change in an
amino acid or nucleotide sequence resulting in the addition of one or more
amino acid or nucleotide residues, respectively, as compared to the
naturally occurring molecule.
A "substitution", as used herein, refers to the replacement of one or more
amino acids or nucleotides by different amino acids or nucleotides,
respectively.
The term "biologically active", as used herein, refers to a protein having
structural, regulatory, or biochemical functions of a naturally occurring
molecule. Likewise, "immunologically active" refers to the capability of
the natural, recombinant, or synthetic EBPH, or any oligopeptide thereof,
to induce a specific immune response in appropriate animals or cells and
to bind with specific antibodies.
The term "agonist", as used herein, refers to a molecule which, when bound
to EBPH, causes a change in EBPH which modulates the activity of EBPH.
Agonists may include proteins, nucleic acids, carbohydrates, or any other
molecules which bind to EBPH.
The terms "antagonist" or "inhibitor", as used herein, refer to a molecule
which, when bound to EBPH, blocks the activity of EBPH. Antagonists and
inhibitors may include proteins, nucleic acids, carbohydrates, or any
other molecules which bind to EBPH.
The term "modulate", as used herein, refers to a change or an alteration in
the biological activity of EBPH. Modulation may be an increase or a
decrease in protein activity, a change in binding characteristics, or any
other change in the biological, functional or immunological properties of
EBPH.
The term "mimetic", as used herein, refers to a molecule, the structure of
which is developed from knowledge of the structure of EBPH or portions
thereof and, as such, is able to effect some or all of the actions of
EBPH.
The term "derivative", as used herein, refers to the chemical modification
of a nucleic acid encoding EBPH or the encoded EBPH. Illustrative of such
modifications would be replacement of hydrogen by an alkyl, acyl, or amino
group. A nucleic acid derivative would encode a polypeptide which retains
essential biological characteristics of the natural molecule.
The term "substantially purified", as used herein, refers to nucleic or
amino acid sequences that are removed from their natural environment,
isolated or separated, and are at least 60% free, preferably 75% free, and
most preferably 90% free from other components with which they are
naturally associated.
"Amplification" as used herein refers to the production of additional
copies of a nucleic acid sequence and is generally carried out using
polymerase chain reaction (PCR) technologies well known in the art
(Dieffenbach, C. W. et al. (1995) PCR Primer, a Laboratory Manual, Cold
Spring Harbor Press, Plainview, N.Y.).
The term "hybridization", as used herein, refers to any process by which a
strand of nucleic acid binds with a complementary strand through base
pairing.
The term "hybridization complex", as used herein, refers to a complex
formed between two nucleic acid sequences by virtue of the formation of
hydrogen bonds between complementary G and C bases and between
complementary A and T bases; these hydrogen bonds may be further
stabilized by base stacking interactions. The two complementary nucleic
acid sequences hydrogen bond in an antiparallel configuration. A
hybridization complex may be formed in solution (e.g., C.sub.0 t or
R.sub.0 t analysis) or between one nucleic acid sequence present in
solution and another nucleic acid sequence immobilized on a solid support
(e.g., membranes, filters, chips, pins or glass slides to which cells have
been fixed for in situ hybridization).
The terms "complementary" or "complementarity", as used herein, refer to
the natural binding of polynucleotides under permissive salt and
temperature conditions by base-pairing. For example, for the sequence
"A-G-T" bonds to the complementary sequence "T-C-A". Complementarity
between two single-stranded molecules may be "partial", in which only some
of the nucleic acids bind, or it may be complete when total
complementarity exists between the single stranded molecules. The degree
of complementarity between nucleic acid strands has significant effects on
the efficiency and strength of hybridization between nucleic acid strands.
This is of particular importance in amplification reactions, which depend
upon binding between the nucleic acids strands.
The term "homology", as used herein, refers to a degree of complementarity.
There may be partial homology or complete homology (i.e., identity). A
partially complementary sequence is one that at least partially inhibits
an identical sequence from hybridizing to a target nucleic acid; it is
referred to using the functional term "substantially homologous." The
inhibition of hybridization of the completely complementary sequence to
the target sequence may be examined using a hybridization assay (Southern
or northern blot, solution hybridization and the like) under conditions of
low stringency. A substantially homologous sequence or probe will compete
for and inhibit the binding (i.e., the hybridization) of a completely
homologous sequence or probe to the target sequence under conditions of
low stringency. This is not to say that conditions of low stringency are
such that non-specific binding is permitted; low stringency conditions
require that the binding of two sequences to one another be a specific
(i.e., selective) interaction. The absence of non-specific binding may be
tested by the use of a second target sequence which lacks even a partial
degree of complementarity (e.g., less than about 30% identity); in the
absence of non-specific binding the probe will not hybridize to the second
non-complementary target sequence.
As known in the art, numerous equivalent conditions may be employed to
comprise either low or high stringency conditions. Factors such as the
length and nature (DNA, RNA, base composition) of the sequence, nature of
the target (DNA, RNA, base composition, presence in solution or
immobilization, etc.), and the concentration of the salts and other
components (e.g., the presence or absence of formamide, dextran sulfate
and/or polyethylene glycol) are considered and the hybridization solution
may be varied to generate conditions of either low or high stringency
different from, but equivalent to, the above listed conditions.
The term "stringent conditions", as used herein, is the "stringency" which
occurs within a range from about Tm-5.degree. C. (5.degree. C. below the
melting temperature (Tm) of the probe) to about 20.degree. C. to
25.degree. C. below Tm. As will be understood by those of skill in the
art, the stringency of hybridization may be altered in order to identify
or detect identical or related polynucleotide sequences.
The term "antisense", as used herein, refers to nucleotide sequences which
are complementary to a specific DNA or RNA sequence. The term "antisense
strand" is used in reference to a nucleic acid strand that is
complementary to the "sense" strand. Antisense molecules may be produced
by any method, including synthesis by ligating the gene(s) of interest in
a reverse orientation to a viral promoter which permits the synthesis of a
complementary strand. Once introduced into a cell, this transcribed strand
combines with natural sequences produced by the cell to form duplexes.
These duplexes then block either the further transcription or translation.
In this manner, mutant phenotypes may be generated. The designation
"negative" is sometimes used in reference to the antisense strand, and
"positive" is sometimes used in reference to the sense strand.
The term "portion", as used herein, with regard to a protein (as in "a
portion of a given protein") refers to fragments of that protein. The
fragments may range in size from four amino acid residues to the entire
amino acid sequence minus one amino acid. Thus, a protein "comprising at
least a portion of the amino acid sequence of SEQ ID NO:1" encompasses the
full-length human EBPH and fragments thereof.
"Transformation", as defined herein, describes a process by which exogenous
DNA enters and changes a recipient cell. It may occur under natural or
artificial conditions using various methods well known in the art.
Transformation may rely on any known method for the insertion of foreign
nucleic acid sequences into a prokaryotic or eukaryotic host cell. The
method is selected based on the host cell being transformed and may
include, but are not limited to, viral infection, electroporation,
lipofection, and particle bombardment. Such "transformed" cells include
stably transformed cells in which the inserted DNA is capable of
replication either as an autonomously replicating plasmid or as part of
the host chromosome. They also include cells which transiently express the
inserted DNA or RNA for limited periods of time.
The term "antigenic determinant", as used herein, refers to that portion of
a molecule that makes contact with a particular antibody (i.e., an
epitope). When a protein or fragment of a protein is used to immunize a
host animal, numerous regions of the protein may induce the production of
antibodies which bind specifically to a given region or three-dimensional
structure on the protein; these regions or structures are referred to as
antigenic determinants. An antigenic determinant may compete with the
intact antigen (i.e., the immunogen used to elicit the immune response)
for binding to an antibody.
The terms "specific binding" or "specifically binding", as used herein, in
reference to the interaction of an antibody and a protein or peptide, mean
that the interaction is dependent upon the presence of a particular
structure (i.e., the antigenic determinant or epitope) on the protein; in
other words, the antibody is recognizing and binding to a specific protein
structure rather than to proteins in general. For example, if an antibody
is specific for epitope "A", the presence of a protein containing epitope
A (or free, unlabeled A) in a reaction containing labeled "A" and the
antibody will reduce the amount of labeled A bound to the antibody.
The term "sample", as used herein, is used in its broadest sense. A
biological sample suspected of containing nucleic acid encoding EBPH or
fragments thereof may comprise a cell, chromosomes isolated from a cell
(e.g., a spread of metaphase chromosomes), genomic DNA (in solution or
bound to a solid support such as for Southern blot analysis), RNA (in
solution or bound to a solid support such as for northern blot analysis),
cDNA (in solution or bound to a solid support), extract from cells or a
tissue, and the like.
The term "correlates with expression of a polynucleotide", as used herein,
indicates that the detection of the presence of ribonucleic acid that is
complementary to SEQ ID NO:2 by northern analysis hybridization assays is
indicative of the presence of mRNA encoding EBPH in a sample and thereby
correlates with expression of the transcript from the gene encoding the
protein.
"Alterations" in the polynucleotide of SEQ ID NO:2, as used herein,
comprise any alteration in the sequence of polynucleotides encoding EBPH
including deletions, insertions, and point mutations that may be detected
using hybridization assays. Included within this definition is the
detection of alterations to the genomic DNA sequence which encodes EBPH
(e.g., by alterations in the pattern of restriction fragment length
polymorphisms capable of hybridizing to SEQ ID NO:2), the inability of a
selected fragment of SEQ ID NO:2 to hybridize to a sample of genomic DNA
(e.g., using allele-specific oligonucleotide probes), and improper or
unexpected hybridization, such as hybridization to a locus other than the
normal chromosomal locus for the polynucleotide sequence encoding EBPH
(e.g., using fluorescent in situ hybridization (FISH) to metaphase
chromosomes spreads).
As used herein, the term "antibody" refers to intact molecules as well as
fragments thereof, such as Fa, F(ab').sub.2, and Fv, which are capable of
binding the epitopic determinant. Antibodies that bind EBPH polypeptides
can be prepared using intact polypeptides or fragments containing small
peptides of interest as the immunizing antigen. The polypeptide or peptide
used to immunize an animal can be derived from translated cDNA or
synthesized chemically, and can be conjugated to a carrier protein, if
desired. Commonly used carriers that are chemically coupled to peptides
include bovine serum albumin and thyroglobulin. The coupled peptide is
then used to immunize the animal (e.g., a mouse, a rat, or a rabbit).
The term "humanized antibody", as used herein, refers to antibody molecules
in which amino acids have been replaced in the non-antigen binding regions
in order to more closely resemble a human antibody, while still retaining
the original binding ability.
THE INVENTION
The invention is based on the discovery of eosinophil-derived basic protein
(EBPH), the polynucleotides encoding EBPH, and the use of these
compositions for the diagnosis, prevention, or treatment of disorders
associated with excessive eosinophil accumulation and degranulation such
as type I allergic reactions, or disorders in pregnancy related to
placental-derived EBPH.
Nucleic acids encoding the human EBPH of the present invention were first
identified in cDNA, Incyte Clone 1525913, from an IL-5 stimulated
umbilical cord blood cDNA library (UCMCL5T01), through a
computer-generated search for amino acid sequence alignments. A consensus
sequence, SEQ ID NO:2, was derived from the following overlapping and/or
extended nucleic acid sequences: Incyte Clones 1525915, 1488589, 1486890,
and 1491748, all from the UCMCL5T01 cDNA library.
In one embodiment, the invention encompasses EBPH, a polypeptide comprising
the amino acid sequence of SEQ ID NO:1, as shown in FIGS. 1A and 1B. EBPH
is 225 amino acids in length. EBPH has chemical and structural homology
(FIG. 2) with human MBP (GI 34476; SEQ ID NO:3), guinea pig GMBP-1 (GI
220291; SEQ ID NO:4), and GMBP-2 (GI 544241; SEQ ID NO:5). In particular,
EBPH and MBP share 48% identity, EBPH and GMBP-1 share 47% identity, and
EBPH and GMBP-2 share 47% identity. As illustrated by FIGS. 2 and 3, EBPH
is expressed as a preproprotein, with a signal peptide predicted to extend
from residues 1 to 16, an acidic pro domain predicted to extend from
residues 17 to 108, and the basic mature coding region predicted to extend
from residues 109 to 225. The entire 225 amino acid prepro-EBPH protein
coding region contains 13 cysteines and no potential N-linked
glycosylation sites. The deduced 116 amino acid mature coding region of
EBPH contains 10 cysteines. A C-type lectin domain consensus sequence
pattern extends from amino acids 200 to 216. The C-type lectin domain
structure contains two disulfide bonds. The predicted isoelectric point
(pI) for prepro-EBPH is 4.6 and for mature EBPH is 9.6, assuming the
formation of two disulfide bonds in the lectin domain.
The sequence identity of MBP, GMBP-1 and GMBP-2 to EBPH decreases in the
pro domain coding regions and increases in the mature coding regions. The
identity of MBP, GMBP-1 and GMBP-2 to EBPH in the pro-regions is 27%, 33%,
and 38%, respectively, while the identity in the mature coding regions is
63%, 56%, and 53%, respectively. The decreased identity in the pro domains
may be indicative of different functions for proEBPH and proMBP.
The invention also encompasses EBPH variants. A preferred EBPH variant is
one having at least 80%, and more preferably 90%, amino acid sequence
similarity to the EBPH amino acid sequence (SEQ ID NO:1). A most preferred
EBPH variant is one having at least 95% amino acid sequence similarity to
SEQ ID NO:1.
The invention also encompasses polynucleotides which encode EBPH.
Accordingly, any nucleic acid sequence which encodes the amino acid
sequence of EBPH can be used to generate recombinant molecules which
express EBPH. In a particular embodiment, the invention encompasses the
polynucleotide comprising the nucleic acid of SEQ ID NO:2, as shown in
FIGS. 1A and 1B.
It will be appreciated by those skilled in the art that as a result of the
degeneracy of the genetic code, a multitude of nucleotide sequences
encoding EBPH, some bearing minimal homology to the nucleotide sequences
of any known and naturally occurring gene, may be produced. Thus, the
invention contemplates each and every possible variation of nucleotide
sequence that could be made by selecting combinations based on possible
codon choices. These combinations are made in accordance with the standard
triplet genetic code as applied to the nucleotide sequence of naturally
occurring EBPH, and all such variations are to be considered as being
specifically disclosed.
Although nucleotide sequences which encode EBPH and its variants are
preferably capable of hybridizing to the nucleotide sequence of the
naturally occurring EBPH under appropriately selected conditions of
stringency, it may be advantageous to produce nucleotide sequences
encoding EBPH or its derivatives possessing a substantially different
codon usage. Codons may be selected to increase the rate at which
expression of the peptide occurs in a particular prokaryotic or eukaryotic
expression host in accordance with the frequency with which particular
codons are utilized by the host. Other reasons for substantially altering
the nucleotide sequence encoding EBPH and its derivatives without altering
the encoded amino acid sequences include the production of RNA transcripts
having more desirable properties, such as a greater half-life, than
transcripts produced from the naturally occurring sequence.
The invention also encompasses production of a DNA sequence, or portions
thereof, which encode EBPH and its derivatives, entirely by synthetic
chemistry. After production, the synthetic gene may be inserted into any
of the many available DNA vectors and cell systems using reagents that are
well known in the art at the time of the filing of this application.
Moreover, synthetic chemistry may be used to introduce mutations into a
sequence encoding EBPH or any portion thereof.
Also encompassed by the invention are polynucleotide sequences that are
capable of hybridizing to the claimed nucleotide sequences, and in
particular, those shown in SEQ ID NO:2, under various conditions of
stringency. Hybridization conditions are based on the melting temperature
(Tm) of the nucleic acid binding complex or probe, as taught in Berger and
Kimmel (1987; Methods in Enzymol., Vol. 152, Academic Press, San Diego,
Calif.), and may be used at a defined stringency.
Altered nucleic acid sequences encoding EBPH which are encompassed by the
invention include deletions, insertions, or substitutions of different
nucleotides resulting in a polynucleotide that encodes the same or a
functionally equivalent EBPH. The encoded protein may also contain
deletions, insertions, or substitutions of amino acid residues which
produce a silent change and result in a functionally equivalent EBPH.
Deliberate amino acid substitutions may be made on the basis of similarity
in polarity, charge, solubility, hydrophobicity, hydrophilicity, and/or
the amphipathic nature of the residues as long as the biological activity
of EBPH is retained. For example, negatively charged amino acids may
include aspartic acid and glutamic acid; positively charged amino acids
may include lysine and arginine; and amino acids with uncharged polar head
groups having similar hydrophilicity values may include leucine,
isoleucine, and valine; glycine and alanine; asparagine and glutamine;
serine and threonine; phenylalanine and tyrosine.
Also included within the scope of the present invention are alleles
encoding EBPH. As used herein, an "allele" or "allelic sequence" is an
alternative form of the gene which may result from at least one mutation
in the nucleic acid sequence. Alleles may result in altered mRNAs or
polypeptides whose structure or function may or may not be altered. Any
given gene may have none, one, or many allelic forms. Common mutational
changes which give rise to alleles are generally ascribed to natural
deletions, additions, or substitutions of amino acids. Each of these types
of changes may occur alone, or in combination with the others, one or more
times in a given sequence.
Methods for DNA sequencing which are well known and generally available in
the art may be used to practice any embodiments of the invention. The
methods may employ such enzymes as the Klenow fragment of DNA polymerase
I, Sequenase.RTM. (US Biochemical Corp, Cleveland, Ohio), Taq polymerase
(Perkin Elmer), thermostable T7 polymerase (Amersham, Chicago, Ill.), or
combinations of recombinant polymerases and proofreading exonucleases such
as the ELONGASE Amplification System marketed by Gibco BRL (Gaithersburg,
Md.). Preferably, the process is automated with machines such as the
Hamilton Micro Lab 2200 (Hamilton, Reno, Nev.), Peltier Thermal Cycler
(PTC200; MJ Research, Watertown, Mass.) and the ABI 377 DNA sequencers
(Perkin Elmer).
The polynucleotide sequence encoding EBPH may be extended utilizing a
partial nucleotide sequence and employing various methods known in the art
to detect upstream sequences such as promoters and regulatory elements.
For example, one method which may be employed, "restriction-site" PCR,
uses universal primers to retrieve unknown sequence adjacent to a known
locus (Gobinda, et al. (1993) PCR Methods Applic. 2:318-322). In
particular, genomic DNA is first amplified in the presence of primer to a
linker sequence and a primer specific to the known region. The amplified
sequences are then subjected to a second round of PCR with the same linker
primer and another specific primer internal to the first one. Products of
each round of PCR are transcribed with an appropriate RNA polymerase and
sequenced using reverse transcriptase.
Inverse PCR may also be used to amplify or extend sequences using divergent
primers based on a known region (Triglia, T. et al. (1988) Nucleic Acids
Res. 16:8186). The primers may be designed using OLIGO.RTM. 4.06 primer
analysis software (National Biosciences Inc., Plymouth, Minn.), or another
appropriate program, to be 22-30 nucleotides in length, to have a GC
content of 50% or more, and to anneal to the target sequence at
temperatures about 68.degree.-72.degree. C. The method uses several
restriction enzymes to generate a suitable fragment in the known region of
a gene. The fragment is then circularized by intramolecular ligation and
used as a PCR template.
Another method which may be used is capture PCR which involves PCR
amplification of DNA fragments adjacent to a known sequence in human and
yeast artificial chromosome DNA (Lagerstrom, M. et al. (1991) PCR Methods
Applic. 1:111-119). In this method, multiple restriction enzyme digestions
and ligations may also be used to place an engineered double-stranded
sequence into an unknown portion of the DNA molecule before performing
PCR.
Another method which may be used to retrieve unknown sequences is that of
Parker, J. D. et al. (1991; Nucleic Acids Res. 19:3055-3060).
Additionally, one may use PCR, nested primers, and PromoterFinder.TM.
libraries to walk in genomic DNA (Clontech, Palo Alto, Calif.). This
process avoids the need to screen libraries and may be useful in finding
intron/exon junctions.
When screening for full-length cDNAs, it is preferable to use libraries
that have been size-selected to include larger cDNAs. Also, random-primed
libraries are preferable in that they will contain more sequences which
contain the 5' and upstream regions of genes. Use of a randomly primed
library may be especially preferable for situations in which an oligo d(T)
library does not yield a full-length cDNA. Genomic libraries may be useful
for extension of sequence into the 5' and 3' non-translated regulatory
regions.
Capillary electrophoresis systems which are commercially available may be
used to analyze the size or confirm the nucleotide sequence of sequencing
or PCR products. In particular, capillary sequencing may employ flowable
polymers for electrophoretic separation, four different fluorescent dyes
(one for each nucleotide) which are laser activated, and detection of the
emitted wavelengths by a charge coupled devise camera. Output/light
intensity may be converted to electrical signal using appropriate software
(e.g. Genotyper.TM. and Sequence Navigator.TM. from Perkin Elmer) and the
entire process from loading of samples to computer analysis and electronic
data display may be computer controlled. Capillary electrophoresis is
especially preferable for the sequencing of small pieces of DNA which
might be present in limited amounts in a particular sample.
In another embodiment of the invention, polynucleotide sequences or
fragments thereof which encode EBPH, or fusion proteins or functional
equivalents thereof, may be used in recombinant DNA molecules to direct
expression of EBPH in appropriate host cells. Due to the inherent
degeneracy of the genetic code, other DNA sequences which encode
substantially the same or a functionally equivalent amino acid sequence
may be produced and these sequences may be used to clone and express EBPH.
As will be understood by those of skill in the art, it may be advantageous
to produce EBPH-encoding nucleotide sequences possessing non-naturally
occurring codons. For example, codons preferred by a particular
prokaryotic or eukaryotic host can be selected to increase the rate of
EBPH expression or to produce a recombinant RNA transcript having
desirable properties, such as a half-life which is longer than that of a
transcript generated from the naturally occurring sequence.
The nucleotide sequences of the present invention can be engineered using
methods generally known in the art in order to alter the EBPH coding
sequence for a variety of reasons, including but not limited to,
alterations which modify the cloning, processing, and/or expression of the
gene product. DNA shuffling by random fragmentation and PCR reassembly of
gene fragments and synthetic oligonucleotides may be used to engineer the
nucleotide sequence. For example, site-directed mutagenesis may be used to
insert new restriction sites, alter glycosylation patterns, to change
codon preference, to produce splice variants, or other mutations, and so
forth.
In another embodiment of the invention, a natural, modified, or recombinant
polynucleotide encoding EBPH may be ligated to a heterologous sequence to
encode a fusion protein. For example, to screen peptide libraries for
inhibitors of EBPH activity, it may be useful to encode a chimeric EBPH
protein that can be recognized by a commercially available antibody. A
fusion protein may also be engineered to contain a cleavage site located
between an EBPH encoding sequence and the heterologous protein sequence,
so that the EBPH may be cleaved and purified away from the heterologous
moiety.
In another embodiment, the coding sequence of EBPH may be synthesized, in
whole or in part, using chemical methods well known in the art (see
Caruthers, M. H. et al. (1980) Nucl. Acids Res. Symp. Ser. 215-223; Horn,
T. et al. (1980) Nucl. Acids Res. Symp. Ser. 225-232). Alternatively, the
protein itself may be produced using chemical methods to synthesize the
EBPH amino acid sequence, or a portion thereof. For example, peptide
synthesis can be performed using various solid-phase techniques (Roberge,
et al. (1995) Science 269:202-204) and automated synthesis may be
achieved, for example, using the ABI 431A Peptide Synthesizer (Perkin
Elmer).
The newly synthesized peptide may be substantially purified by preparative
high performance liquid chromatography (e.g., Creighton, T. (1983)
Proteins, Structures and Molecular Principles, W H Freeman and Co., New
York, N.Y.). The composition of the synthetic peptides may be confirmed by
amino acid analysis or sequencing (e.g., the Edman degradation procedure;
Creighton, supra). Additionally, the amino acid sequence of EBPH, or any
part thereof, may be altered during direct synthesis and/or combined using
chemical methods with sequences from other proteins, or any part thereof,
to produce a variant polypeptide.
In order to express a biologically active EBPH, the nucleotide sequence
encoding EBPH or functional equivalents, may be inserted into an
appropriate expression vector, i.e., a vector which contains the necessary
elements for the transcription and translation of the inserted coding
sequence.
Methods which are well known to those skilled in the art may be used to
construct expression vectors containing an EBPH coding sequence and
appropriate transcriptional or translational controls. These methods
include in vitro recombinant DNA techniques, synthetic techniques, and in
vivo recombination or genetic recombination. Such techniques are described
in Sambrook, J. et al. (1989) Molecular Cloning, A Laboratory Manual, Cold
Spring Harbor Press, Plainview, N.Y., and Ausubel, F. M. et al. (1989)
Current Protocols in Molecular Biology, John Wiley & Sons, New York, N.Y.
A variety of expression vector/host systems may be utilized to contain and
express a EBPH coding sequence. These include, but are not limited to,
microorganisms such as bacteria transformed with recombinant
bacteriophage, plasmid, or cosmid DNA expression vectors; yeast
transformed with yeast expression vectors; insect cell systems infected
with virus expression vectors (e.g., baculovirus); plant cell systems
transformed with virus expression vectors (e.g., cauliflower mosaic virus,
CaMV; tobacco mosaic virus, TMV) or transformed with bacterial expression
vectors (e.g., Ti or pBR322 plasmid); or animal cell systems.
The "control elements" or "regulatory sequences" are those non-translated
regions of the vector--enhancers, promoters, 5' and 3' untranslated
regions--which interact with host cellular proteins to carry out
transcription and translation. Such elements may vary in their strength
and specificity. Depending on the vector system and host utilized, any
number of suitable transcription and translation elements, including
constitutive and inducible promoters, may be used. For example, when
cloning in bacterial systems, inducible promoters such as the hybrid lacZ
promoter of the Bluescript.RTM. phagemid (Stratagene, LaJolla, Calif.) or
pSport1 (Gibco BRL) and ptrp-lac hybrids, and the like may be used. The
baculovirus polyhedrin promoter may be used in insect cells. Promoters or
enhancers derived from the genomes of plant cells (e.g., heat shock,
RUBISCO, and storage protein genes) or from plant viruses (e.g., viral
promoters or leader sequences) may be cloned into the vector. In mammalian
cell systems, promoters from mammalian genes or from mammalian viruses are
preferable. If it is necessary to generate a cell line that contains
multiple copies of the sequence encoding EBPH, vectors based on SV40 or
EBV may be used with an appropriate selectable marker.
In bacterial systems, a number of expression vectors may be selected
depending upon the use intended for EBPH. For example, when large
quantities of EBPH are needed for the induction of antibodies, vectors
which direct high level expression of fusion proteins that are readily
purified may be used. Such vectors include, but are not limited to, the
multifunctional E. coli cloning and expression vectors such as
Bluescript.RTM. (Stratagene), in which the EBPH coding sequence may be
ligated into the vector in frame with sequences for the amine-terminal Met
and the subsequent 7 residues of .beta.-galactosidase so that a hybrid
protein is produced; pIN vectors (Van Heeke, G. et el. (1989) J. Biol.
Chem. 264:5503-5509); and the like. pGEX vectors (Promega, Madison, Wis.)
may also be used to express foreign so polypeptides as fusion proteins
with glutathione S-transferase (GST). In general, such fusion proteins are
soluble and can easily be purified from lysed cells by adsorption to
glutathione-agarose beads followed by elution in the presence of free
glutathione. Proteins made in such systems may be designed to include
heparin, thrombin, or factor XA protease cleavage sites so that the cloned
polypeptide of interest can be released from the GST moiety at will.
In the yeast, Saccharomyces cerevisiae, a number of vectors containing
constitutive or inducible promoters such as alpha factor, alcohol oxidase,
and PGH may be used. For reviews, see Ausubel, et al. (supra) and Grant,
et al. (1987) Methods Enzymol. 153:516-544.
In cases where plant expression vectors are used, the expression of a
sequence encoding EBPH may be driven by any of a number of promoters. For
example, viral promoters such as the 35S and 19S promoters of CaMV may be
used alone or in combination with the omega leader sequence from TMV
(Takamatsu et al. (1987) EMBO J. 6:307-311; Brisson et al. (1984) Nature
310:511-514). Alternatively, plant promoters such as the small subunit of
RUBISCO or heat shock promoters may be used (Coruzzi et al. (1984) EMBO J.
3:1671-1680; Broglie et al. (1984) Science 224:838-843; Winter, J. et al.
(1991) Results Probl. Cell Differ. 17:85-105). These constructs can be
introduced into plant cells by direct DNA transformation or
pathogen-mediated transfection. Such techniques are described in a number
of generally available reviews (see, for example, Hobbs, S. or Murry, L.
E. in McGraw Hill Yearbook of Science and Technology (1992) McGraw Hill,
New York, N.Y.; pp. 191-196 or Weissbach and Weissbach (1988) Methods for
Plant Molecular Biology, Academic Press, New York, N.Y.; pp. 421-463).
An insect system may also be used to express EBPH. For example, in one such
system, Autographa californica nuclear polyhedrosis virus (AcNPV) is used
as a vector to express foreign genes in Spodoptera frugiperda cells or in
Trichoplusia larvae. The EBPH coding sequence may be cloned into a
non-essential region of the virus, such as the polyhedrin gene, and placed
under control of the polyhedrin promoter. Successful insertion of EBPH
will render the polyhedrin gene inactive and produce recombinant virus
lacking coat protein. The recombinant viruses may then be used to infect,
for example, S. frugiperda cells or Trichoplusia larvae in which EBPH may
be expressed (Smith et al. (1983) J. Virol 46:584; Engelhard, E. K. et al.
(1994) Proc. Natl. Acad. Sci. 91:3224-3227).
In mammalian host cells, a number of viral-based expression systems may be
utilized. In cases where an adenovirus is used as an expression vector, an
EBPH coding sequence may be ligated into an adenovirus
transcription/translation complex consisting of the late promoter and
tripartite leader sequence. Insertion in a non-essential E1 or E3 region
of the viral genome may be used to obtain a viable virus which is capable
of expressing EBPH in infected host cells (Logan and Shenk (1984) Proc.
Natl. Aced. Sci. 81:3655-3659). In addition, transcription enhancers, such
as the Rous sarcoma virus (RSV) enhancer, may be used to increase
expression in mammalian host cells.
Specific initiation signals may also be used to achieve more efficient
translation of a EBPH sequence. Such signals include the ATG initiation
codon and adjacent sequences. In cases where sequences encoding EBPH, its
initiation codon, and upstream sequences are inserted into the appropriate
expression vector, no additional translational control signals may be
needed. However, in cases where only coding sequence, or a portion
thereof, is inserted, exogenous translational control signals including
the ATG initiation codon should be provided. Furthermore, the initiation
codon should be in the correct reading frame to ensure translation of the
entire insert. Exogenous translational elements and initiation codons may
be of various origins, both natural and synthetic. The efficiency of
expression may be enhanced by the inclusion of enhancers which are
appropriate for the particular cell system which is used, such as those
described in the literature (Scharf, D. et al. (1994) Results Probl. Cell
Differ. 20:125-162; Bittner et al. (1987) Methods Enzymol. 153:516-544).
In addition, a host cell strain may be chosen for its ability to modulate
the expression of the inserted sequences or to process the expressed
protein in the desired fashion. Such modifications of the polypeptide
include, but are not limited to, acetylation, carboxyladon, glycosylation,
phosphorylation, lipidation, and acylation. Post-translational processing
which cleaves a "prepro" form of the protein may also be used to
facilitate correct insertion, folding and/or function. Different host
cells such as CHO, HeLa, MDCK, HEK293, and WI38, which have specific
cellular machinery and characteristic mechanisms for such
post-translational activities, may be chosen to ensure the correct
modification and processing of the introduced foreign protein.
For long-term, high-yield production of recombinant proteins,. stable
expression is preferred. For example, cell lines which stably express EBPH
may be transformed using expression vectors which may contain viral
origins of replication and/or endogenous expression elements and a
selectable marker gene on the same or separate vector. Following the
introduction of the vector, cells may be allowed to grow for 1-2 days in
an enriched media before they are switched to selective media. The purpose
of the selectable marker is to confer resistance to selection, and its
presence allows growth and recovery of cells which successfully express
the introduced sequences. Resistant clones of stably transformed cells may
be proliferated using tissue culture techniques appropriate to the cell
type.
Any number of selection systems may be used to recover transformed cell
lines. These include, but are not limited to, the herpes simplex virus
thymidine kinase (Wigler, M. et al. (1977) Cell 11:223-32) and adenine
phosphoribosyltransferase (Lowy, I. et al. (1980) Cell 22:817-23) genes
which can be employed in tk.sup.- or aprt.sup.- cells, respectively. Also,
antimetabolite, antibiotic or herbicide resistance can be used as the
basis for selection; for example, dhfr which confers resistance to
methotrexate (Wigler, M. et al. (1980) Proc. Natl. Acad. Sci. 77:3567-70);
npt, which confers resistance to the aminoglycosides neomycin and G-418
(Colbere-Garapin, F. et al (1981) J. Mol. Biol. 150:1-14) and als or pat,
which confer resistance to chlorsulfuron and phosphinotricin
acetyltransferase, respectively (Murry, supra). Additional selectable
genes have been described, for example, trpB, which allows cells to
utilize indole in place of tryptophan, or hisD, which allows cells to
utilize histinol in place of histidine (Hartman, S. C. and R. C. Mulligan
(1988) Proc. Natl. Acad. Sci. 85:8047-51). Recently, the use of visible
markers has gained popularity with such markers as anthocyanins, .beta.
glucuronidase and its substrate, GUS, and luciferase and its substrate,
luciferin, being widely used not only to identify transformants, but also
to quantify the amount of transient or stable protein expression
attributable to a specific vector system (Rhodes, C. A. et al. (1995)
Methods Mol. Biol. 55:121-131).
Although the presence/absence of marker gene expression suggests that the
gene of interest is also present, its presence and expression may need to
be confirmed. For example, if the sequence encoding EBPH is inserted
within a marker gene sequence, recombinant cells containing sequences
encoding EBPH can be identified by the absence of marker gene function.
Alternatively, a marker gene can be placed in tandem with an EBPH sequence
under the control of a single promoter. Expression of the marker gene in
response to induction or selection usually indicates expression of the
tandem EBPH as well.
Alternatively, host cells which contain the coding sequence for EBPH and
express EBPH may be identified by a variety of procedures known to those
of skill in the art. These procedures include, but are not limited to,
DNA--DNA or DNA-RNA hybridizations, fluorescent activated cell sorting and
protein bioassay or immunoassay techniques which include membrane,
solution, or chip based technologies for the detection and/or
quantification of the nucleic acid or protein.
The presence of the polynucleotide sequence encoding EBPH can be detected
by DNA--DNA or DNA-RNA hybridization or amplification using probes or
portions or fragments of polynucleotides encoding EBPH. Nucleic acid
amplification based assays involve the use of oligonucleotides or
oligomers based on the EBPH-encoding sequence to detect transfectants
containing DNA or RNA encoding EBPH. As used herein "oligonucleotides" or
"oligomers" refer to a nucleic acid sequence of at least about 10
nucleotides and as many as about 60 nucleotides, preferably about 15 to 30
nucleotides, and more preferably about 20-25 nucleotides, which can be
used as a probe or amplimer.
A variety of protocols for detecting and measuring the expression of EBPH,
using either polyclonal or monoclonal antibodies specific for the protein
are known in the art. Examples include enzyme-linked immunosorbent assay
(ELISA), radioimmunoassay (RIA), and fluorescent activated cell sorting
(FACS). A two-site, monoclonal-based immunoassay utilizing monoclonal
antibodies reactive to two non-interfering epitopes on EBPH is preferred,
but a competitive binding assay may be employed. These and other assays
are described, among other places, in Hampton et al. (1990, Serological
Methods., a Laboratory Manual, APS Press, St Paul, Minn.) and Maddox D E
et al. (1983) J. Exp. Med. 158:1211-1216).
A wide variety of labels and conjugation techniques are known by those
skilled in the art and may be used in various nucleic acid and amino acid
assays. Means for producing labeled hybridization or PCR probes for
detecting sequences related to polynucleotides encoding EBPH include
oligolabeling, nick translation, end-labeling or PCR amplification using a
labeled nucleotide. Alternatively, the sequence encoding EBPH, or any
portion of it, may be cloned into a vector for the production of an mRNA
probe. Such vectors are known in the art, are commercially available, and
may be used to synthesize RNA probes in vitro by addition of an
appropriate RNA polymerase such as T7, T3, or SP6 and labeled nucleotides.
These procedures may be conducted using a variety of commercially
available kits (Pharmacia Upjohn, (Kalamazoo, Mich.); Promega (Madison,
Wis.); and U.S. Biochemical Corp., (Cleveland, Ohio)). Suitable reporter
molecules or labels, which may be used, include radionuclides, enzymes,
fluorescent, chemiluminescent, or chromogenic agents as well as
substrates, cofactors, inhibitors, magnetic particles, and the like.
Host cells transformed with a nucleotide sequence encoding EBPH may be
cultured under conditions suitable for the expression and recovery of the
encoded protein from cell culture. The protein produced by a recombinant
cell may be secreted or contained intracellularly depending on the
sequence and/or the vector used. As will be understood by those of skill
in the art, expression vectors containing polynucleotides which encode
EBPH may be designed to contain signal sequences which direct secretion of
EBPH through a prokaryotic or eukaryotic cell membrane. Other recombinant
constructions may be used to join sequences encoding EBPH to nucleotide
sequence encoding a polypeptide domain which will facilitate purification
of soluble proteins. Such purification facilitating domains include, but
are not limited to, metal chelating peptides such as histidine-tryptophan
modules that allow purification on immobilized metals, protein A domains
that allow purification on immobilized immunoglobulin, and the domain
utilized in the FLAGS extension/affinity purification system (Immunex
Corp., Seattle Wash.). The inclusion of cleavable linker sequences such as
those specific for Factor XA or enterokinase (Invitrogen, San Diego,
Calif.) between the purification domain and EBPH may be used to facilitate
purification. One such expression vector which may be used provides for
expression of a fusion protein containing EBPH and a nucleic acid encoding
6 histidine residues followed by thioredoxin and an enterokinase cleavage
site. The histidine residues facilitate purification on IMIAC (immobilized
metal ion affinity chromatography as described in Porath, J. et al. (1992;
Protein Exp. Purif. 3:263-281) while the enterokinase cleavage site
provides a means for purifying EBPH from the fusion protein. A discussion
of vectors which contain fusion proteins is provided in Kroll, D. J. et
al. (1993; DNA Cell Biol. 12:441-453).
In addition to recombinant production, fragments of EBPH may be produced by
direct peptide synthesis using solid-phase techniques (cf Stewart et al.
(1969) Solid-Phase Peptide Synthesis, W. H. Freeman Co., San Francisco,
Calif.; Merrifield J. (1963) J. Am. Chem. Soc. 85:2149-2154). In vitro
protein synthesis may be performed using manual techniques or by
automation. Automated synthesis may be achieved, for example, using
Applied Biosystems 431A Peptide Synthesizer (Perkin Elmer). Various
fragments of EBPH may be chemically synthesized separately and combined
using chemical methods to produce the full length molecule.
THERAPEUTICS
In another embodiment of the invention, EBPH or fragments thereof may be
used for therapeutic purposes.
Chemical and structural homology exists among EBPH and the eosinophil
granule MBPs from human and guinea pig. In addition, northern analysis
demonstrates that mRNA encoding full-length EBPH was found only in a
library constructed from pooled human umbilical cord blood cells cultured
in the presence of IL-5 (UCMCL5T01). Since umbilical cord blood is a rich
source of stem cells and IL-5 is a potent eosinophilic differentiation
factor, EBPH is believed to function as an eosinophil granule protein.
Furthermore, a significant proportion oft he cDNA clones in the UCMCL5T01
library encode eosinophil-specific proteins. It must be noted, however,
that naturally occurring expression of EBPH is not necessarily limited to
eosinophils.
From the homology and expression information provided above, it appears
that EBPH plays a role in host defense mechanisms against parasitic and
bacterial infections. Accordingly, in another embodiment of the invention,
EBPH or derivatives thereof may be used as cytolytic agents in the
treatment of such infections.
In another embodiment of the invention, EBPH may be used as a cytolytic
agent against cancer cells. Control of EBPH activity as a novel approach
to cancer treatment may be especially useful in combination therapy with
other, conventional chemotherapeutic agents. Such combinations of
therapeutic agents having different cellular mechanisms of action often
have synergistic effects allowing the use of lower effective doses of each
agent and lessening side effects
Eosinophil-associated diseases and conditions, including type I allergic
reactions, vary in severity. Allergic rhinitis, which affects a large
segment of the population, has severe economic impact. Anaphylaxis is a
major complication of allergic reactions which in many instances is fatal.
Asthma is a chronic disease of the airways characterized by mucus
hypersecretion as well as bronchial inflammation, edema, and
hyperresponsiveness resulting in increased bronchoconstriction. Atopic
dermatitis is an allergic skin disease associated with high eosinophil
levels which result in skin lesions. Hypereosinophilic syndrome and
eosinophilic endomyocardial disease may lead to severe cardiac tissue
damage and cardiac failure. Graft-vs.-host disease is also associated with
high eosinophil accumulation and degranulation.
Therefore, in another embodiment of the invention, vectors expressing
antisense and antagonists or inhibitors which block or modulate the effect
of EBPH may be used in those situations where such inhibition or
modulation is therapeutically desirable. Such situations may include
diseases and conditions with which eosinophil accumulation and granule
release are involved, including the diseases discussed above. In such
situations, EBPH released from eosinophils may promote or exacerbate
intimation and tissue damage. EBPH may also induce further eosinophil
degranulation and thus act as an autocrine mediator in the pathogenesis of
eosinophil-associated diseases.
Antagonists of EBPH may be produced using methods which are generally known
in the art. In one aspect, proEBPH may be useful as an inhibitor of
EBPH-associated functions, including, but not limited to, those associated
with the activation and degranulation of eosinophils, basophils, and
neutrophils, including histamine and superoxide release. To prevent the
processing of administered proEBPH into mature EBPH in vivo, variants of
EBPH may be produced which contain at least one mutation in SEQ ID NO:1
located at or about the pro-mature domain boundary, said boundary located
approximately at amino acid residues 108 and 109 of SEQ ID NO:1.
In another aspect of the invention, the isolated EBPH pro domain,
comprising amino acid residues 17 to 108 of SEQ ID NO:1, may likewise be
useful as an inhibitor of mature EBPH. The pro domain may be particularly
useful in preventing or treating EBPH-associated tissue damage. Most
particularly, the EBPH pro domain may be administered topically to prevent
or to treat tissue damage associated with EBPH. Such applications may
include, but are not limited to: inhalants for the prevention or treatment
of bronchial hyperreactivity and tissue damage associated with asthma;
nose drops for the prevention or treatment of nasal tissue irritation
associated with allergic rhinitis; and ointments for the prevention or
treatment of skin lesions associated with atopic dermatitis.
In another aspect, antibodies which are specific for EBPH may be used as an
agonist, antagonist, or as part of a targeting or delivery mechanism so as
to bring a pharmaceutical agent to cells or tissues which express EBPH.
The antibodies may be generated using methods that are well known in the
art. Such antibodies may include, but are not limited to, polyclonal,
monoclonal, chimeric, single chain, Fab fragments, and fragments produced
by a Fab expression library. Neutralizing antibodies, (i.e., those which
inhibit dimer formation) are especially preferred for therapeutic use.
For the production of antibodies, various hosts including goats, rabbits,
rats, mice, and humans, may be immunized by injection with EBPH or any
fragment or oligopeptide thereof which has immunogenic properties.
Depending on the host species, various adjuvants may be used to increase
immunological response. Such adjuvants include, but are not limited to,
Freund's, mineral gels such as aluminum hydroxide, and surface active
substances such as lysolecithin, pluronic polyols, polyanions, peptides,
oil emulsions, keyhole limpet hemocyanin, and dinitrophenol. Among
adjuvants used in humans, BCG (bacilli Calmette-Guerin) and
Corynebacterium parvum are especially preferable.
It is preferred that the peptides, fragments, or oligopeptides used to
induce antibodies to EBPH have an amino acid sequence consisting of at
least five amino acids, and more preferably at least 10 amino acids. It is
also preferable that they are identical to a portion of the amino acid
sequence of the natural protein, and they may contain the entire amino
acid sequence of a small, naturally occurring molecule. Short stretches of
EBPH amino acids may be fused with those of another protein such as
keyhole limpet hemocyanin and antibody produced against the chimeric
molecule.
Monoclonal antibodies to EBPH may be prepared using any technique which
provides for the production of antibody molecules by continuous cell lines
in culture. These s include, but are not limited to, the hybridoma
technique, the human B-cell hybridoma technique, and the EBV-hybridoma
technique (Koehler et al. (1975) Nature 256:495-497; Kosbor et al. (1983)
Immunol. Today 4:72; Cote et al. (1983) Proc. Natl. Acad. Sci.
80:2026-2030; Cole et al. (1985) Monoclonal Antibodies and Cancer Therapy,
Alan R. Liss Inc., New York, N.Y., pp. 77-96).
In addition, techniques developed for the production of "chimeric
antibodies", the splicing of mouse antibody genes to human antibody genes
to obtain a molecule with appropriate antigen specificity and biological
activity can be used (Morrison et al. (1984) Proc. Natl. Acad. Sci.
81:6851-6855; Neuberger et al. (1984) Nature 312:604-608; Takeda et al.
(1985) Nature 314:452-454). Alternatively, techniques described for the
production of single chain antibodies may be adapted, using methods known
in the art, to produce EBPH-specific single chain antibodies. Antibodies
with related specificity but of distinct idiotypic composition may be
generated by chain shuffling from random combinatorial immunoglobin
libraries (Burton D. R. (1991) Proc. Natl. Acad. Sci. 88:11120-3).
Antibodies may also be produced by inducing in vivo production in the
lymphocyte population or by screening recombinant immunoglobulin libraries
or panels of highly specific binding reagents as disclosed in the
literature (Orlandi et al. (1989) Proc. Natl. Acad. Sci. 86: 3833-3837;
Winter, G. et al. (1991) Nature 349:293-299).
Antibody fragments which contain specific binding sites for EBPH may also
be generated. For example, such fragments include, but are not limited to,
the F(ab')2 fragments which can be produced by pepsin digestion of the
antibody molecule and the Fab fragments which can be generated by reducing
the disulfide bridges of the F(ab')2 fragments. Alternatively, Fab
expression libraries may be constructed to allow rapid and easy
identification of monoclonal Fab fragments with the desired specificity
(Huse, W. D. et al. (1989) Science 256:1275-1281).
Various immunoassays may be used for screening to identify antibodies
having the desired specificity. Numerous protocols for competitive binding
or immunoradiometric assays using either polyclonal or monoclonal
antibodies with established specificities are well known in the art. Such
immunoassays typically involve the measurement of complex formation
between EBPH and its specific antibody. A two-site, monoclonal-based
immunoassay utilizing monoclonal antibodies reactive to two
non-interfering epitopes on a specific EBPH protein is preferred, but a
competitive binding assay may also be employed (Maddox (1983), supra).
In another embodiment of the invention, the polynucleotides encoding EBPH,
or any fragment thereof or antisense sequences, may be used for
therapeutic purposes. In one aspect, antisense to the polynucleotide
encoding EBPH may be used in situations in which it would be desirable to
block the synthesis of the protein. In particular, cells may be
transformed with antisense sequences to polynucleotides encoding EBPH.
Thus, antisense sequences may be used to prevent EBPH-associated tissue
damage, or to achieve regulation of gene function. Such technology is now
well known in the art, and sense or antisense oligomers, or larger
fragments, can be designed from various locations along the coding or
control regions.
Expression vectors derived from retroviruses, adenovirus, herpes or
vaccinia viruses, or from various bacterial plasmids, may be used for
delivery of nucleotide sequences to the targeted organ, tissue, or cell
population. Methods which are well known to those skilled in the art can
be used to construct recombinant vectors which will express antisense
polynucleotides of the gene encoding EBPH. See, for example, the
techniques described in Sambrook et al. (supra) and Ausubel et al.
(supra).
Genes encoding EBPH can be turned off by transfecting a cell or tissue with
expression vectors which express high levels of a polynucleotide or
fragment thereof which encodes EBPH. Such constructs may be used to
introduce untranslatable sense or antisense sequences into a cell. Even in
the absence of integration into the DNA, such vectors may continue to
transcribe RNA molecules until all copies are disabled by endogenous
nucleases. Transient expression may last for a month or more with a
non-replicating vector and even longer if appropriate replication elements
are part of the vector system.
As mentioned above, modifications of gene expression can be obtained by
designing antisense molecules, DNA, RNA, or PNA, to the control regions of
the gene encoding EBPH, i.e., the promoters, enhancers, and introns.
Oligonucleotides derived from the transcription initiation site, e.g.,
between positions -10 and +10 from the ATG start site, are preferred. The
antisense molecules may also be designed to block translation of mRNA by
preventing the transcript from binding to ribosomes. Similarly, inhibition
can be achieved using "triple helix" base-pairing methodology. Triple
helix pairing is useful because it causes inhibition of the ability of the
double helix to open sufficiently for the binding of polymerases,
transcription factors, or regulatory molecules. Recent therapeutic
advances using triplex DNA have been described in the literature (Gee, J.
E. et al. (1994) In: Huber, B. E. and B. I Carr, Molecular and Immunologic
Approaches, Futura Publishing Co., Mt. Kisco, N.Y.).
Ribozymes, enzymatic RNA molecules, may also be used to catalyze the
specific cleavage of RNA. The mechanism of ribozyme action involves
sequence-specific hybridization of the ribozyme molecule to complementary
target RNA, followed by endonucleolytic cleavage. Examples which may be
used include engineered hammerhead motif ribozyme molecules that can
specifically and efficiently catalyze endonucleolytic cleavage of
sequences encoding EBPH.
Specific ribozyme cleavage sites within any potential RNA target are
initially identified by scanning the target molecule for ribozyme cleavage
sites which include the following sequences: GUA, GUU, and GUC. Once
identified, short RNA sequences of between 15 and 20 ribonucleotides
corresponding to the region of the target gene containing the cleavage
site may be evaluated for secondary structural features which may render
the oligonucleotide inoperable. The suitability of candidate targets may
also be evaluated by testing accessibility to hybridization with
complementary oligonucleotides using ribonuclease protection assays.
Antisense molecules and ribozymes of the invention may be prepared by any
method known in the art for the synthesis of RNA molecules. These include
techniques for chemically synthesizing oligonucleotides such as solid
phase phosphoramidite chemical synthesis. Alternatively, RNA molecules may
be generated by in vitro and in vivo transcription of DNA sequences
encoding EBPH. Such DNA sequences may be incorporated into a wide variety
of vectors with suitable RNA polymerase promoters such as T7 or SP6.
Alternatively, antisense cDNA constructs that synthesize antisense RNA
constitutively or inducibly can be introduced into cell lines, cells, or
tissues.
RNA molecules may be modified to increase intracellular stability and
half-life. Possible modifications include, but are not limited to, the
addition of fling sequences at the 5' and/or 3' ends of the molecule or
the use of phosphorothioate or 2' O-methyl rather than phosphodiesterase
linkages within the backbone of the molecule. This concept is inherent in
the production of PNAs and can be extended in all of these molecules by
the inclusion of nontraditional bases such as inosine, queosine, and
wybutosine, as well as acetyl-, methyl-, thio-, and similarly modified
forms of adenine, cytidine, guanine, thymine, and uridine which are not as
easily recognized by endogenous endonucleases.
Methods for introducing vectors into cells or tissues include those methods
discussed above. These methods are equally suitable for use in vivo, in
vitro, and ex vivo. For ex vivo therapy, vectors may be introduced into
stem cells taken from the patient and clonally propagated for autologous
transplant back into that same patient. Delivery by transfection and by
liposome injections may be achieved using methods which are well known in
the art.
Any of the therapeutic methods described above may be applied to any
suitable subject including, for example, mammals such as dogs, cats, cows,
horses, rabbits, monkeys, and most preferably, humans.
An additional embodiment of the invention relates to the administration of
a pharmaceutical composition, in conjunction with a pharmaceutically
acceptable carrier, for any of the therapeutic effects discussed above.
Such pharmaceutical compositions may consist of EBPH, antibodies to EBPH,
mimetics, agonists, antagonists, or inhibitors of EBPH. The compositions
may be administered alone or in combination with at least one other agent,
such as stabilizing compound, which may be administered in any sterile,
biocompatible pharmaceutical carrier, including, but not limited to,
saline, buffered saline, dextrose, and water. The compositions may be
administered to a patient alone, or in combination with other agents,
drugs or hormones.
The pharmaceutical compositions utilized in this invention may be
administered by any number of routes including, but not limited to, oral,
intravenous, intramuscular, intra-arterial, intramedullary, intrathecal,
intraventricular, transdermal, subcutaneous, intraperitoneal, intranasal,
enteral, topical, sublingual, or rectal means.
In addition to the active ingredients, these pharmaceutical compositions
may contain suitable pharmaceutically-acceptable carriers comprising
excipients and auxiliaries which facilitate processing of the active
compounds into preparations which can be used pharmaceutically. Further
details on techniques for formulation and administration may be found in
the latest edition of Remington's Pharmaceutical Sciences (Maack
Publishing Co., Easton, Pa.).
Pharmaceutical compositions for oral administration can be formulated using
pharmaceutically acceptable carriers well known in the art in dosages
suitable for oral administration. Such carriers enable the pharmaceutical
compositions to be formulated as tablets, pills, dragees, capsules,
liquids, gels, syrups, slurries, suspensions, and the like, for ingestion
by the patient.
Pharmaceutical preparations for oral use can be obtained through
combination of active compounds with solid excipient, optionally grinding
a resulting mixture, and processing the mixture of granules, after adding
suitable auxiliaries, if desired, to obtain tablets or dragee cores.
Suitable excipients are carbohydrate or protein fillers, such as sugars,
including lactose, sucrose, mannitol, or sorbitol; starch from corn,
wheat, rice, potato, or other plants; cellulose, such as methyl cellulose,
hydroxypropylmethyl-cellulose, or sodium carboxymethylcellulose; gums
including arabic and tragacanth; and proteins such as gelatin and
collagen. If desired, disintegrating or solubilizing agents may be added,
such as the cross-linked polyvinyl pyrrolidone, agar, alginic acid, or a
salt thereof, such as sodium alginate.
Dragee cores may be used in conjunction with suitable coatings, such as
concentrated sugar solutions, which may also contain gum arabic, talc,
polyvinylpyrrolidone, carbopol gel, polyethylene glycol, and/or titanium
dioxide, lacquer solutions, and suitable organic solvents or solvent
mixtures. Dyestuffs or pigments may be added to the tablets or dragee
coatings for product identification or to characterize the quantity of
active compound, i.e., dosage.
Pharmaceutical preparations which can be used orally include push-fit
capsules made of gelatin, as well as soft, sealed capsules made of gelatin
and a coating, such as glycerol or sorbitol. Push-fit capsules can contain
active ingredients mixed with a filler or binders, such as lactose or
starches, lubricants, such as talc or magnesium stearate, and, optionally,
stabilizers. In soft capsules, the active compounds may be dissolved or
suspended in suitable liquids, such as fatty oils, liquid paraffin, or
liquid polyethylene glycol with or without stabilizers.
Pharmaceutical formulations suitable for parenteral administration may be
formulated in aqueous solutions, preferably in physiologically compatible
buffers such as Hanks's solution, Ringer's solution, or physiologically
buffered saline. Aqueous injection suspensions may contain substances
which increase the viscosity of the suspension, such as sodium
carboxymethyl cellulose, sorbitol, or dextran. Additionally, suspensions
of the active compounds may be prepared as appropriate oily injection
suspensions. Suitable lipophilic solvents or vehicles include fatty oils
such as sesame oil, or synthetic fatty acid esters, such as ethyl oleate
or triglycerides, or liposomes. Optionally, the suspension may also
contain suitable stabilizers or agents which increase the solubility of
the compounds to allow for the preparation of highly concentrated
solutions.
For topical or nasal administration, penetrants appropriate to the
particular barrier to be permeated are used in the formulation. Such
penetrants are generally known in the art.
The pharmaceutical compositions of the present invention may be
manufactured in a manner that is known in the art, e.g., by means of
conventional mixing, dissolving, granulating, dragee-making, levigating,
emulsifying, encapsulating, entrapping, or lyophilizing processes.
The pharmaceutical composition may be provided as a salt and can be formed
with many acids, including but not limited to, hydrochloric, sulfuric,
acetic, lactic, tartaric, malic, succinic, etc. Salts tend to be more
soluble in aqueous or other protonic solvents than are the corresponding
free base forms. In other cases, the preferred preparation may be a
lyophilized powder which may contain any or all of the following: 1 mM-50
mM histidine, 0.1%-2% sucrose, and 2%-7% mannitol at a pH range of 4.5 to
5.5 that is/are combined with buffer prior to use.
After pharmaceutical compositions have been prepared, they can be placed in
an appropriate container and labeled for treatment of an indicated
condition. For administration of EBPH, such labeling would include amount,
frequency, and method of administration.
Pharmaceutical compositions suitable for use in the invention include
compositions wherein the active ingredients are contained in an effective
amount to achieve the intended purpose. The determination of an effective
dose is well within the capability of those skilled in the art.
For any compound, the therapeutically effective dose can be estimated
initially either in cell culture assays, e.g., of neoplastic cells, or in
animal models, usually mice, rabbits, dogs, or pigs. The animal model may
also be used to determine the appropriate concentration range and route of
administration. Such information can then be used to determine useful
doses and routes for administration in humans.
A therapeutically effective dose refers to that amount of active
ingredient, for example EBPH or fragments thereof, agonists antibodies to
EBPH or agonists, antagonists, or inhibitors of EBPH, which ameliorates
the symptoms or condition. Therapeutic efficacy and toxicity may be
determined by standard pharmaceutical procedures in cell cultures or
experimental animals, e.g., ED50 (the dose therapeutically effective in
50% of the population) and LD50 (the dose lethal to 50% of the
population). The dose ratio between therapeutic and toxic effects is the
therapeutic index, and it can be expressed as the ratio, LD50/ED50.
Pharmaceutical compositions which exhibit large therapeutic indices are
preferred. The data obtained from cell culture assays and animal studies
is used in formulating a range of dosage for human use. The dosage
contained in such compositions is preferably within a range of circulating
concentrations that include the ED50 with little or no toxicity. The
dosage varies within this range depending upon the dosage form employed,
sensitivity of the patient, and the route of administration.
The exact dosage will be determined by the practitioner, in light of
factors related to the subject who requires treatment. Dosage and
administration are adjusted to provide sufficient levels of the active
moiety or to maintain the desired effect. Factors which may be taken into
account include the severity of the disease state, general health of the
subject, age, weight, and gender of the subject, diet, time and frequency
of administration, drug combination(s), reaction sensitivities, and
tolerance/response to therapy. Long-acting pharmaceutical compositions may
be administered every 3 to 4 days, every week, or once every two weeks
depending on half-life and clearance rate of the particular formulation.
Normal dosage amounts may vary from 0.1 to 100,000 micrograms, up to a
total dose of about 1 g, depending upon the route of administration.
Guidance as to particular dosages and methods of delivery is provided in
the literature and generally available to practitioners in the art. Those
skilled in the art will employ different formulations for nucleotides than
for proteins or their inhibitors. Similarly, delivery of polynucleotides
or polypeptides will be specific to particular cells, conditions,
locations, etc.
DIAGNOSTICS
In another embodiment, antibodies which are specific for EBPH may be used
for the diagnosis of conditions or diseases characterized by expression of
EBPH, or in assays to monitor patients being treated with EBPH, agonists,
antagonists or inhibitors. The antibodies useful for diagnostic purposes
may be prepared in the same manner as those described above for
therapeutics. Diagnostic assays for EBPH include methods which utilize the
antibody and a label to detect EBPH in human body fluids or extracts of
cells or tissues. The antibodies may be used with or without modification,
and may be labeled by joining them, either covalently or non-covalently,
with a reporter molecule. A wide variety of reporter molecules which are
known in the art may be used, several of which are described above.
A variety of protocols including ELISA, RIA, and FACS for measuring EBPH
are known in the art and provide a basis for diagnosing altered or
abnormal levels of EBPH expression. Normal or standard values for EBPH
expression are established by combining body fluids or cell extracts taken
from normal mammalian subjects, preferably human, with antibody to EBPH
under conditions suitable for complex formation The amount of standard
complex formation may be quantified by various methods, but preferably by
photometric means. Quantities of EBPH expressed in subject, control, and
disease samples from biopsied tissues are compared with the standard
values. Deviation between standard and subject values establishes the
parameters for diagnosing disease.
In another embodiment of the invention, the polynucleotides encoding EBPH
may be used for diagnostic purposes. The polynucleotides which may be used
include oligonucleotide sequences, antisense RNA and DNA molecules, and
PNAs. The polynucleotides may be used to detect and quantitate gene
expression in biopsied tissues in which expression of EBPH may be
correlated with disease. The diagnostic assay may be used to distinguish
between absence, presence, and excess expression of EBPH, and to monitor
regulation of EBPH levels during therapeutic intervention.
In one aspect, hybridization with PCR probes which are capable of detecting
polynucleotide sequences, including genomic sequences, encoding EBPH or
closely related molecules, may be used to identify nucleic acid sequences
which encode EBPH. The specificity of the probe, whether it is made from a
highly specific region, e.g., 10 unique nucleotides in the 5' regulatory
region, or a less specific region, e.g., especially in the 3' region, and
the stringency of the hybridization or amplification (maximal, high,
intermediate, or low) will determine whether the probe identifies only
naturally occurring sequences encoding EBPH, alleles, or related
sequences.
Probes may also be used for the detection of related sequences, and should
preferably contain at least 50% of the nucleotides from any of these EBPH
encoding sequences. The hybridization probes of the subject invention may
be derived from the nucleotide sequence of SEQ ID NO:2 or from genomic
sequence including promoter, enhancer elements, and introns of the
naturally occurring EBPH.
Other means for producing specific hybridization probes for DNAs encoding
EBPH include the cloning of nucleic acid sequences encoding EBPH or EBPH
derivatives into vectors for the production of mRNA probes. Such vectors
are known in the art, commercially available, and may be used to
synthesize RNA probes in vitro by means of the addition of the appropriate
RNA polymerases and the appropriate radioactively labeled nucleotides.
Hybridization probes may be labeled by a variety of reporter groups, for
example, radionuclides such as 32P or 35S, or enzymatic labels, such as
alkaline phosphatase coupled to the probe via avidin/biotin coupling
systems, and the like.
Polynucleotide sequences encoding EBPH may be used for the diagnosis of
conditions or diseases which are associated with expression of EBPH.
Examples of such conditions or diseases include type I allergic reactions,
parasitic infections, and eosinophilias. In addition, proEBPH in placenta
may be complexed with other pregnancy-associated molecules such as PAPP-A
and angiotensinogen and thus may be useful in the diagnosis of
pregnancy-associated conditions. The polynucleotide sequences encoding
EBPH may be used in Southern or northern analysis, dot blot, or other
membrane-based technologies; in PCR technologies; in dip stick, pin, chip,
and ELISA assays of fluids or tissues from patient biopsies to detect
altered EBPH expression. Such qualitative or quantitative methods are well
known in the art.
In order to provide a basis for the diagnosis of disease associated with
expression of EBPH, a normal or standard profile for expression is
established. This may be accomplished by combining body fluids or cell
extracts taken from normal subjects, either animal or human, with a
sequence, or a fragment thereof, which encodes EBPH, under conditions
suitable for hybridization or amplification. Standard hybridization may be
quantified by comparing the values obtained from normal subjects with a
dilution series of EBPH measured in the same experiment, where a known
amount of a substantially purified EBPH is used. Standard values obtained
from normal samples may be compared with values obtained from samples from
patients who are symptomatic for disease associated with EBPH. Deviation
between standard and subject values is used to establish the presence of
disease.
Once disease is established and a treatment protocol is initiated,
hybridization assays may be repeated on a regular basis to evaluate
whether the level of expression in the patient begins to approximate that
which is observed in the normal patient. The results obtained from
successive assays may be used to show the efficacy of treatment over a
period ranging from several days to months.
Additional diagnostic uses for oligonucleotides encoding EBPH may involve
the use of PCR. Such oligomers may be chemically synthesized, generated
enzymatically, or produced from a recombinant source. Oligomers will
preferably consist of two nucleotide sequences, one with sense orientation
(5'.fwdarw.3') and another with antisense (3'.rarw.5'), employed under
optimized conditions for identification of a specific gene or condition.
The same two oligomers, nested sets of oligomers, or even a degenerate
pool of oligomers may be employed under less stringent conditions for
detection and/or quantitation of closely related DNA or RNA sequences.
Methods which may also be used to quantitate the expression of EBPH include
radiolabeling or biotinylating nucleotides, coamplification of a control
nucleic acid, and standard curves onto which the experimental results are
interpolated (Melby, P. C. et al. (1993) J. Immunol. Methods, 159:235-244;
Duplaa, C. et al. (1993) Anal. Biochem. 229-236.) The speed of
quantitation of multiple samples may be accelerated by running the assay
in an ELISA format where the oligomer of interest is presented in various
dilutions and a spectrophotometric or colorimetric response gives rapid
quantitation.
In another embodiment of the invention, the nucleic acid sequence which
encodes EBPH may also be used to generate hybridization probes which are
useful for mapping the naturally occurring genomic sequence. The sequence
may be mapped to a particular chromosome or to a specific region of the
chromosome using well known techniques. Such techniques include FISH,
FACS, or artificial chromosome constructions, such as yeast artificial
chromosomes, bacterial artificial chromosomes, bacterial P1 constructions
or single chromosome cDNA libraries as reviewed in Price, C. M. (1993)
Blood Rev. 7:127-134, and Trask, B. J. (1991) Trends Genet. 7:149-154.
FISH (as described in Verma et al. (1988) Human Chromosomes: A Manual of
Basic Techniques, Pergamon Press, New York, N.Y.) may be correlated with
other physical chromosome mapping techniques and genetic map data.
Examples of genetic map data can be found in the 1994 Genome Issue of
Science (265:1981f). Correlation between the location of the gene encoding
EBPH on a physical chromosomal map and a specific disease (or
predisposition to a specific disease) may help delimit the region of DNA
associated with that genetic disease. The nucleotide sequences of the
subject invention may be used to detect differences in gene sequences
between normal, carrier, or affected individuals.
In situ hybridization of chromosomal preparations and physical mapping
techniques such as linkage analysis using established chromosomal markers
may be used for extending genetic maps. Often the placement of a gene on
the chromosome of another mammalian species, such as mouse, may reveal
associated markers even if the number or arm of a particular human
chromosome is not known. New sequences can be assigned to chromosomal
arms, or parts thereof, by physical mapping. This provides valuable
information to investigators searching for disease genes using positional
cloning or other gene discovery techniques. Once the disease or syndrome
has been crudely localized by genetic linkage to a particular genomic
region, for example, AT to 11q22-23 (Gatti et al. (1988) Nature
336:577-580), any sequences mapping to that area may represent associated
or regulatory genes for further investigation. The nucleotide sequence of
the subject invention may also be used to detect differences in the
chromosomal location due to translocation, inversion, etc. among normal,
carrier, or affected individuals.
In another embodiment of the invention, EBPH, its catalytic or immunogenic
fragments or oligopeptides thereof, can be used for screening libraries of
compounds in any of a variety of drug screening techniques. The fragment
employed in such a test may be free in solution, affixed to a solid
support, borne on a cell surface, or located intracellularly. The
formation of binding complexes, between EBPH and the agent being tested,
may be measured.
Another technique for drug screening which may be used provides for high
throughput screening of compounds having suitable binding affinity to the
protein of interest as described in published PCT application WO84/03564.
In this method, as applied to EBPH, large numbers of different small test
compounds are synthesized on a solid substrate, such as plastic pins or
some other surface. The test compounds are reacted with EBPH, or fragments
thereof, and washed. Bound EBPH is then detected by methods well known in
the art. Purified EBPH can also be coated directly onto plates for use in
the aforementioned drug screening techniques. Alternatively,
non-neutralizing antibodies can be used to capture the peptide and
immobilize it on a solid support.
In another embodiment, one may use competitive drug screening assays in
which neutralizing antibodies capable of binding EBPH specifically compete
with a test compound for binding EBPH. In this manner, the antibodies can
be used to detect the presence of any peptide which shares one or more
antigenic determinants with EBPH.
In additional embodiments, the nucleotide sequences which encode EBPH may
be used in any molecular biology techniques that have yet to be developed,
provided the new techniques rely on properties of nucleotide sequences
that are currently known, including, but not limited to, such properties
as the triplet genetic code and specific base pair interactions.
The examples below are provided to illustrate the subject invention and are
not included for the purpose of limiting the invention.
EXAMPLES
I Construction of cDNA Libraries
Mononuclear cells were obtained from the umbilical cord blood of 12
individuals and were cultured in the presence of IL-5 for 12 days. The
cells were homogenized and lysed using a Brinkmann Homogenizer Polytron
PT-3000 (Brinkmann Instruments, Westbury, N.J.) in guanidinium
isothiocyanate solution. The lysate was centrifuged over a 5.7M CsCl
cushion using an Beckman SW28 rotor in a Beckman L8-70M Ultracentrifuge
(Beckman Instruments) for 18 hours at 25,000 rpm at ambient temperature.
The RNA was extracted with acid phenol pH 4.7, precipitated using 0.3M
sodium acetate and 2.5 volumes of ethanol, resuspended in RNAse-free
water, and DNase treated at 37.degree. C. The RNA extraction was repeated
with acid phenol pH 4.7 and precipitated with sodium acetate and ethanol
as before. The mRNA was then isolated using the Qiagen Oligotex kit
(QIAGEN, Inc., Chatsworth, Calif.) and used to construct the cDNA library.
The mRNA was handled according to the recommended protocols in the
SuperScript Plasmid System for cDNA Synthesis and Plasmid Cloning (Cat.
#18248-013, Gibco/BRL).
The commercial plasmid pSPORT 1.TM. (Gibco/BRL) was digested with EcoR I
restriction enzyme (New England Biolabs, Beverley, Mass.). The overhanging
ends of the plasmid were filled in using Klenow enzyme (New England
Biolabs) and 2'-deoxynucleotide 5'-triphosphates (dNTPs). The plasmid was
self-ligated and transformed into the bacterial host, E. coli strain JM
109. An intermediate plasmid produced by the bacteria failed to digest
with EcoR I confirming the desired loss of the EcoR I restriction site.
This intermediate plasmid (pSPORT 1-.DELTA.RI) was then digested with Hind
III restriction enzyme (New England Biolabs) and the overhang was filled
in with Klenow and dNTPs. A 10-mer linker of sequence 5' . . . CGGAATTCCG
. . . 3' was phosphorylated and ligated onto the blunt ends. The product
of the ligation reaction was digested with EcoR I and self-ligated.
Following transformation into JM109 host cells, plasmids were isolated and
screened for the digestibility with EcoR I but not with Hind III. A single
colony which met this criteria was designated pINCY 1. The plasmid
produced by this colony was sequenced and found to contain several copies
of the 10-mer linker. These extra linkers did not present a problem as
they were eliminated when the vector was prepared for cloning.
The plasmid was tested for its ability to incorporate cDNAs from a library
prepared using Not I and EcoR I restriction enzymes. Several clones were
sequenced and a single clone containing an insert of approximately 0.8 kb
was selected to prepare a large quantity of the plasmid for library
production. After digestion with Not I and EcoR I, the plasmid and the
cDNA insert were isolated on an agarose gel and the vector was purified on
a QIAQuick.TM. (QIAGEN, Inc.) column for use in library construction.
cDNAs were fractionated on a Sepharose CL4B column (Cat. #275105-01,
Pharmacia), and those cDNAs exceeding 400 bp were ligated into pSport I.
The plasmid pSport I was subsequently transformed into DH5a.TM. competent
cells (Cat. #18258-012, Gibco/BRL).
II Isolation and Sequencing of cDNA Clones
Plasmid DNA was released from the cells and purified using the REAL Prep 96
Plasmid Kit for Rapid Extraction Alkaline Lysis Plasmid Minipreps (Catalog
#26173, QIAGEN, Inc.). This kit enabled the simultaneous purification of
96 samples in a 96-well block using multi-channel reagent dispensers. The
recommended protocol was employed except for the following changes: 1) the
bacteria were cultured in 1 ml of sterile Terrific Broth (Catalog #22711,
Life Technologies) with carbenicillin at 25 mg/L and glycerol at 0.4%; 2)
after inoculation, the cultures were incubated for 19 hours and at the end
of incubation, the cells were lysed with 0.3 ml of lysis buffer; and 3)
following isopropanol precipitation, the plasmid DNA pellet was
resuspended in 0.1 ml of distilled water. After the last step in the
protocol, samples were transferred to a 96-well block for storage at
4.degree. C.
The cDNAs were sequenced by the method of Sanger et al. (1975, J. Mol.
Biol. 94:441f), using a Hamilton Micro Lab 2200 (Hamilton, Reno, Nev.) in
combination with Peltier Thermal Cyclers (PTC200 from MJ Research,
Watertown, Mass.) and Applied Biosystems 377 DNA Sequencing Systems; and
the reading frame was determined.
Most of the sequences disclosed herein were sequenced according to standard
ABI protocols, using ABI kits (Cat. Nos. 79345, 79339, 79340, 79357,
79355). The solution volumes were used at 0.25x-1.0x concentrations. Some
of the sequences disclosed herein were sequenced using different solutions
and dyes which, unless otherwise noted, came from Amersham Life Science
(Cleveland, Ohio).
Stock solutions were prepared with HPLC water. The following solutions were
each mixed by vortexing for 2 min: 1) Tris-EDTA (TE) Buffer was prepared
by adding 49 ml water to 1 ml 50x Tris-EDTA concentrate, and 2) 10%
Reaction Buffer was prepared by adding 45 ml water to 5 ml Concentrated
Thermo Sequenase (TS) Reaction Buffer.
Energy transfer (ET) primers (0.2 .mu.M) were prepared in the following
manner. Each primer tube was centrifuged prior to opening to assure that
all primer powder was on the bottom of the tube. After each solubilization
step, the mixture was vortexed for 2 min and then centrifuged for about 10
sec in a table-top centrifuge. 1 ml of 1x TE was added to each primer
powder; adenine and cytosine dissolved primers (5-carboxyrhodamine-6G
(R6G) and 6-carboxyfluorescein (FAM), respectively), were diluted with 9
ml 1x TE. Guanine and thymine dyes
(N,N,N',N"-tetramethyl-6-carboxyrhodamine (TAM) and 6-carboxy-X-rhodamine
(ROX), respectively) were diluted with 19 ml 1x TE.
The sequencing reaction ready mix was prepared as follows: 1) nucleotides A
and C (8 ml of each) were added to 6 ml ET primer and 18 ml TS reaction
buffer; and 2) nucleotides G and T (8 ml of each) were added to 6 ml ET
primer and 18 ml TS reaction buffer. After vortexing for 2 min and
centrifuging for 20 sec, the resulting solution was divided into tubes in
volumes of 8 ml per tube in order to make 1x (A,C) and 2x (G,T) solutions.
Prior to thermal cycling, each nucleotide was individually mixed with DNA
template in the following proportions:
______________________________________
Reagent
A C G T
(.mu.L)
(.mu.L) (.mu.L)
(.mu.L)
______________________________________
Reaction ready premix
2 2 4 4
DNA template 1 1 2 2
Total Volume 3 3 6 6
______________________________________
These solutions were subjected to the usual thermal cycling:
1. Rapid thermal ramp to 94.degree. C. (94.degree. C. for 20 sec)*
* Steps 1, 2, and 3 were repeated for 15 cycles
2. Rapid thermal ramp to 50.degree. C. (50.degree. C. for 40 sec)*
* Steps 1, 2, and 3 were repeated for 15 cycles
3. Rapid thermal ramp to 68.degree. C. (68.degree. C. for 60 sec)*
* Steps 1, 2, and 3 were repeated for 15 cycles
4. Rapid thermal ramp to 94.degree. C. (94.degree. C. for 20 sec)**
** Steps 4 and 5 were repeated for 15 cycles
5. Rapid thermal ramp to 68.degree. C. (68.degree. C. for 60 sec)**
** Steps 4 and 5 were repeated for 15 cycles
6. Rapid thermal ramp to 4 .degree. C. and hold until ready to combine.
After thermal cycling, the A, C, G, and T reactions were combined with each
DNA template. Then, 50 .mu.L 100% ethanol was added and the solution was
spun at 4.degree. C. for 30 min. The supernatant was decanted and the
pellet was rinsed with 100 .mu.L 70% ethanol. After being spun for 15 min
the supernatant was discarded and the pellet was dried for 15 min under
vacuum. The DNA sample was dissolved in 3 .mu.L of formaldehyde/50 mM
EDTA. The resulting samples were loaded on wells in volumes of 2 .mu.L per
well for sequencing in ABI sequencers.
III Homology Searching of cDNA Clones and Their Deduced Proteins
Each cDNA was compared to sequences in GenBank using a search algorithm
developed by Applied Biosystems and incorporated into the INHERIT.TM. 670
Sequence Analysis System. In this algorithm, Pattern Specification
Language (TRW Inc, Los Angeles, Calif.) was used to determine regions of
homology. The three parameters that determine how the sequence comparisons
run were window size, window offset, and error tolerance. Using a
combination of these three parameters, the DNA database was searched for
sequences containing regions of homology to the query sequence, and the
appropriate sequences were scored with an initial value. Subsequently,
these homologous regions were examined using dot matrix homology plots to
distinguish regions of homology from chance matches. Smith-Waterman
alignments were used to display the results of the homology search.
Peptide and protein sequence homologies were ascertained using the
INHERIT-670 Sequence Analysis System using the methods similar to those
used in DNA sequence homologies. Pattern Specification Language and
parameter windows were used to search protein databases for sequences
containing regions of homology which were scored with an initial value.
Dot-matrix homology plots were examined to distinguish regions of
significant homology from chance matches.
BLAST, which stands for Basic Local Alignment Search Tool (Altschul S F
(1993) J. Mol. Evol. 36:290-300; Altschul et al. (1990) J. Mol. Biol.
215:403-410), was used to search for local sequence alignments. BLAST
produces alignments of both nucleotide and amino acid sequences to
determine sequence similarity. Because of the local nature of the
alignments, BLAST is especially useful in determining exact matches or in
identifying homologs. BLAST is useful for matches which do not contain
gaps. The fundamental unit of BLAST algorithm output is the High-scoring
Segment Pair (HSP).
An HSP consists of two sequence fragments of arbitrary but equal lengths
whose alignment is locally maximal and for which the alignment score meets
or exceeds a threshold or cutoff score set by the user. The BLAST approach
is to look for HSPs between a query sequence and a database sequence, to
evaluate the statistical significance of any matches found, and to report
only those matches which satisfy the user-selected threshold of
significance. The parameter E establishes the statistically significant
threshold for reporting database sequence matches. E is interpreted as the
upper bound of the expected frequency of chance occurrence of an HSP (or
set of HSPs) within the context of the entire database search. Any
database sequence whose match satisfies E is reported in the program
output.
IV Northern Analysis
Northern analysis is a laboratory technique used to detect the presence of
a transcript of a gene and involves the hybridization of a labeled
nucleotide sequence to a membrane on which RNAs from a particular cell
type or tissue have been bound (Sambrook et al., supra).
Analogous computer techniques using BLAST (Altschul S. F. 1993 and 1990,
supra) are used to search for identical or related molecules in nucleotide
databases such as GenBank or the LIFESEQ.TM. database (Incyte
Pharmaceuticals, Inc.). This analysis is much faster than multiple,
membrane-based hybridizations. In addition, the sensitivity of the
computer search can be modified to determine whether any particular match
is categorized as exact or homologous.
The basis of the search is the product score which is defined as:
##EQU1##
The product score takes into account both the degree of similarity between
two sequences and the length of the sequence match. For example, with a
product score of 40, the match will be exact within a 1-2% error; and at
70, the match will be exact. Homologous molecules are usually identified
by selecting those which show product scores between 15 and 40, although
lower scores may identify related molecules.
The results of northern analysis are reported as a list of libraries in
which the transcript encoding EBPH occurs. Abundance and percentage
abundance are also reported. Abundance directly reflects the number of
times a particular transcript is represented in a cDNA library, and
percent abundance is abundance divided by the total number of sequences
examined in the cDNA library.
V Extension of EBPH-Encoding Polynucleotides to Full Length or to Recover
Regulatory Elements
Full length EBPH-encoding nucleic acid sequence (SEQ ID NO:2) is used to
design oligonucleotide primers for extending a partial nucleotide sequence
to full length or for obtaining 5' sequences from genomic libraries. One
primer is synthesized to initiate extension in the antisense direction
(XLR) and the other is synthesized to extend sequence in the sense
direction (XLF). Primers are used to facilitate the extension of the known
sequence "outward" generating amplicons containing new, unknown nucleotide
sequence for the region of interest. The initial primers are designed from
the cDNA using OLIGO.RTM. 4.06 (National Biosciences), or another
appropriate program, to be 22-30 nucleotides in length, to have a GC
content of 50% or more, and to anneal to the target sequence at
temperatures about 68.degree.-72.degree. C. Any stretch of nucleotides
which would result in hairpin structures and primer--primer dimerizations
is avoided.
The original, selected cDNA libraries, or a human genomic library are used
to extend the sequence; the latter is most useful to obtain 5' upstream
regions. If more extension is necessary or desired, additional sets of
primers are designed to further extend the known region.
By following the instructions for the XL-PCR kit (Perkin Elmer) and
thoroughly mixing the enzyme and reaction mix, high fidelity amplification
is obtained. Beginning with 40 pmol of each primer and the recommended
concentrations of all other components of the kit, PCR is performed using
the Peltier Thermal Cycler (PTC200; M.J. Research, Watertown, Mass.) and
the following parameters:
______________________________________
Step 1 94.degree. C. for 1 min (initial denaturation)
Step 2 65.degree. C. for 1 min
Step 3 68.degree. C. for 6 min
Step 4 94.degree. C. for 15 sec
Step 5 65.degree. C. for 1 min
Step 6 68.degree. C. for 7 min
Step 7 Repeat step 4-6 for 15 additional cycles
Step 8 94.degree. C. for 15 sec
Step 9 65.degree. C. for 1 min
Step 10 68.degree. C. for 7:15 min
Step 11 Repeat step 8-10 for 12 cycles
Step 12 72.degree. C. for 8 min
Step 13 4.degree. C. (and holding)
______________________________________
A 5-10 .mu.l aliquot of the reaction mixture is analyzed by electrophoresis
on a low concentration (about 0.6-0.8%) agarose mini-gel to determine
which reactions were successful in extending the sequence. Bands thought
to contain the largest products are selected and removed from the gel.
Further purification involves using a commercial gel extraction method
such as QIAQuick.TM. (QIAGEN Inc., Chatsworth, Calif.). After recovery of
the DNA, Klenow enzyme is used to trim single-stranded, nucleotide
overhangs creating blunt ends which facilitate religation and cloning.
After ethanol precipitation, the products are redissolved in 13 .mu.l of
ligation buffer, 1 .mu.l T4-DNA ligase (15 units) and 1 .mu.l T4
polynucleotide kinase are added, and the mixture is incubated at room
temperature for 2-3 hours or overnight at 16.degree. C. Competent E. coli
cells (in 40 .mu.l of appropriate media) are transformed with 3 .mu.l of
ligation mixture and cultured in 80 .mu.l of SOC medium (Sambrook et al.,
supra). After incubation for one hour at 37.degree. C., the whole
transformation mixture is plated on Luria Bertani (LB)-agar (Sambrook et
al., supra) containing 2xCarb. The following day, several colonies are
randomly picked from each plate and cultured in 150 .mu.l of liquid
LB/2xCarb medium placed in an individual well of an appropriate,
commercially-available, sterile 96-well microtiter plate. The following
day, 5 of each overnight culture is transferred into a non-sterile 96-well
plate and after dilution 1:10 with water, 5 .mu.l of each sample is
transferred into a PCR array.
For PCR amplification, 18 .mu.l of concentrated PCR reaction mix (3.3x)
containing 4 units of rTth DNA polymerase, a vector primer, and one or
both of the gene specific primers used for the extension reaction are
added to each well. Amplification is performed using the following
conditions:
______________________________________
Step 1 94.degree. C. for 60 sec
Step 2 94.degree. C. for 20 sec
Step 3 55.degree. C. for 30 sec
Step 4 72.degree. C. for 90 sec
Step 5 Repeat steps 2-4 for an additional 29 cycles
Step 6 72.degree. C. for 180 sec
Step 7 4.degree. C. (and holding)
______________________________________
Aliquots of the PCR reactions are run on agarose gels together with
molecular weight markers. The sizes of the PCR products are compared to
the original partial cDNAs, and appropriate clones are selected, ligated
into plasmid, and sequenced.
VI Labeling and Use of Hybridization Probes
Hybridization probes derived from SEQ ID NO:2 are employed to screen cDNAs,
genomic DNAs, or mRNAs. Although the labeling of oligonucleotides,
consisting of about 20 base-pairs, is specifically described, essentially
the same procedure is used with larger cDNA fragments. Oligonucleotides
are designed using state-of-the-art software such as OLIGO 4.06 (National
Biosciences), labeled by combining 50 pmol of each oligomer and 250 mCi of
›.gamma.-.sup.32 P! adenosine triphosphate (Amersham, Chicago, Ill.) and
T4 polynucleotide kinase (DuPont NEN.RTM., Boston, Mass.). The labeled
oligonucleotides are substantially purified with Sephadex G-25 superfine
resin column (Pharmacia Upjohn). A portion containing 10.sup.7 counts per
minute of each of the sense and antisense oligonucleotides is used in a
typical membrane based hybridization analysis of human genomic DNA
digested with one of the following endonucleases (Ase I, Bgl II, Eco RI,
Pst I, Xba 1, or Pvu II; DuPont NEN.RTM.).
The DNA from each digest is fractionated on a 0.7 percent agarose gel and
transferred to nylon membranes (Nytran Plus, Schleicher & Schuell, Durham,
N.H.). Hybridization is carried out for 16 hours at 40.degree. C. To
remove nonspecific signals, blots are sequentially washed at room
temperature under increasingly stringent conditions up to 0.1x saline
sodium citrate and 0.5% sodium dodecyl sulfate. After XOMAT AR.TM. film
(Kodak, Rochester, N.Y.) is exposed to the blots in a Phosphoimager
cassette (Molecular Dynamics, Sunnyvale, Calif.) for several hours,
hybridization patterns are compared visually.
VII Antisense Molecules
Antisense molecules to the EBPH-encoding sequence, or any part thereof, is
used to inhibit in vivo or in vitro expression of naturally occurring
EBPH. Although use of antisense oligonucleotides, comprising about 20
base-pairs, is specifically described, essentially the same procedure is
used with larger cDNA fragments. An oligonucleotide based on the coding
sequences of EBPH, as shown in FIGS. 1A and 1B, is used to inhibit
expression of naturally occurring EBPH. The complementary oligonucleotide
is designed from the most unique 5' sequence as shown in FIGS. 1A and 1B
and used either to inhibit transcription by preventing promoter binding to
the upstream nontranslated sequence or translation of an EBPH-encoding
transcript by preventing the ribosome from binding. Using an appropriate
portion of the signal and 5' sequence of SEQ ID NO:2, an effective
antisense oligonucleotide includes any 15-20 nucleotides spanning the
region which translates into the signal or 5' coding sequence of the
polypeptide as shown in FIGS. 1A and 1B.
VIII Expression of EBPH
Expression of EBPH is accomplished by subcloning the cDNAs into appropriate
vectors and transforming the vectors into host cells. In this case, the
cloning vector, pSport, previously used for the generation of the cDNA
library is used to express EBPH in E. coli. Upstream of the cloning site,
this vector contains a promoter for B-galactosidase, followed by sequence
containing the amino-terminal Met, and the subsequent seven residues of
.beta.-galactosidase. Immediately following these eight residues is a
bacteriophage promoter useful for transcription and a linker containing a
number of unique restriction sites.
Induction of an isolated, transformed bacterial strain with IPTG using
standard methods produces a fusion protein which consists of the first
eight residues of .beta.-galactosidase, about 5 to 15 residues of linker,
and the full length protein. The signal residues direct the secretion of
EBPH into the bacterial growth media which can be used directly in the
following assay for activity.
IX Demonstration of EBPH Activity
The cytolytic activity of EBPH is assayed by monitoring the release of
.sup.51 Cr from cells treated with EBPH. Bronchial epithelial cells, or
other suitable cells, are incubated with .sup.51 Cr (Amersham) in an
appropriate medium for 1 hour at 37.degree. C. The cells are washed to
remove unincorporated .sup.51 Cr and are resuspended. The cytolysis
reaction is initiated by addition of EBPH followed by incubation for a
predetermined length of time at 37.degree. C. The reaction mixture is
centrifuged at 4.degree. C., and radioactivity of an aliquot of the
cell-free supernatant is assayed in a gamma scintillation counter. Total
cellular .sup.51 Cr content is determined with an aliquot of the reaction
mixture lysed in 0.04% Triton X-100, and spontaneous .sup.51 Cr release is
determined for cells incubated under the same conditions but in the
absence of EBPH.
X Production of EBPH Specific Antibodies
EBPH that is substantially purified using PAGE electrophoresis (Sambrook,
supra), or other purification techniques, is used to immunize rabbits and
to produce antibodies using standard protocols. The amino acid sequence
deduced from SEQ ID NO:2 is analyzed using DNASTAR software (DNASTAR Inc)
to determine regions of high immunogenicity and a corresponding
oligopolypeptide is synthesized and used to raise antibodies by means
known to those of skill in the art. Selection of appropriate epitopes,
such as those near the C-terminus or in hydrophilic regions, is described
by Ausubel et al. (supra), and others.
Typically, the oligopeptides are 15 residues in length, synthesized using
an Applied Biosystems Peptide Synthesizer Model 431A using fmoc-chemistry,
and coupled to keyhole limpet hemocyanin (KLH, Sigma) by reaction with
M-maleimidobenzoyl-N-hydroxysuccinimide ester (MBS; Ausubel et al.,
supra). Rabbits are immunized with the oligopeptide-KLH complex in
complete Freund's adjuvant. The resulting antisera are tested for
antipeptide activity, for example, by binding the peptide to plastic,
blocking with 1% BSA, reacting with rabbit antisera, washing, and reacting
with radioiodinated, goat anti-rabbit IgG.
XI Purification of Naturally Occurring EBPH Using Specific Antibodies
Naturally occurring or recombinant EBPH is substantially purified by
immunoaffinity chromatography using antibodies specific for EBPH. An
immunoaffinity column is constructed by covalently coupling EBPH antibody
to an activated chromatographic resin, such as CnBr-activated Sepharose
(Pharmacia Upjohn). After the coupling, the resin is blocked and washed
according to the manufacturer's instructions.
Media containing EBPH is passed over the immunoaffinity column, and the
column is washed under conditions that allow the preferential absorbance
of EBPH (e.g., high ionic strength buffers in the presence of detergent).
The column is eluted under conditions that disrupt antibody/EBPH binding
(eg, a buffer of pH 2-3 or a high concentration of a chaotrope, such as
urea or thiocyanate ion), and EBPH is collected.
XII Identification of Molecules Which Interact with EBPH
EBPH or biologically active fragments thereof are labeled with .sup.125 I
Bolton-Hunter reagent (Bolton et al. (1973) Biochem. J. 133: 529).
Candidate molecules previously arrayed in the wells of a multi-well plate
are incubated with the labeled EBPH, washed and any wells with labeled
EBPH complex are assayed. Data obtained using different concentrations of
EBPH are used to calculate values for the number, affinity, and
association of EBPH with the candidate molecules.
All publications and patents mentioned in the above specification are
herein incorporated by reference. Various modifications and variations of
the described method and system of the invention will be apparent to those
skilled in the art without departing from the scope and spirit of the
invention. Although the invention has been described in connection with
specific preferred embodiments, it should be understood that the invention
as claimed should not be unduly limited to such specific embodiments.
Indeed, various modifications of the described modes for carrying out the
invention which are obvious to those skilled in molecular biology or
related fields are intended to be within the scope of the following
claims.
__________________________________________________________________________
SEQUENCE LISTING
(1) GENERAL INFORMATION:
(iii) NUMBER OF SEQUENCES: 5
(2) INFORMATION FOR SEQ ID NO:1:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 225 amino acids
(B) TYPE: amino acid
(C) STRANDEDNESS: single
(D) TOPOLOGY: linear
(ii) MOLECULE TYPE: peptide
(vii) IMMEDIATE SOURCE:
(A) LIBRARY:
(B) CLONE: Consensus
(xi) SEQUENCE DESCRIPTION: SEQ ID NO:1:
MetGlnArgLeuLeuLeuLeuProPheLeuLeuLeuGlyThrValSer
151015
AlaLeuHisLeuGluAsnAspAlaProHisLeuGluSerLeuGluThr
202530
GlnAlaAspLeuGlyGlnAspLeuAspSerSerLysGluGlnGluArg
354045
AspLeuAlaLeuThrGluGluValIleGlnAlaGluGlyGluGluVal
505560
LysAlaSerAlaCysGlnAspAsnPheGluAspGluGluAlaMetGlu
65707580
SerAspProAlaAlaLeuAspLysAspPheGlnCysProArgGluGlu
859095
AspIleValGluValGlnGlySerProArgCysLysThrCysArgTyr
100105110
LeuLeuValArgThrProLysThrPheAlaGluAlaGlnAsnValCys
115120125
SerArgCysTyrGlyGlyAsnLeuValSerIleHisAspPheAsnPhe
130135140
AsnTyrArgIleGlnCysCysThrSerThrValAsnGlnAlaGlnVal
145150155160
TrpIleGlyGlyAsnLeuArgGlyTrpPheLeuTrpLysArgPheCys
165170175
TrpThrAspGlySerHisTrpAsnPheAlaTyrTrpSerProGlyGln
180185190
ProGlyAsnGlyGlnGlySerCysValAlaLeuCysThrLysGlyGly
195200205
TyrTrpArgArgAlaGlnCysAspLysGlnLeuProPheValCysSer
210215220
Phe
225
(2) INFORMATION FOR SEQ ID NO:2:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 865 base pairs
(B) TYPE: nucleic acid
(C) STRANDEDNESS: single
(D) TOPOLOGY: linear
(ii) MOLECULE TYPE: cDNA
(vii) IMMEDIATE SOURCE:
(A) LIBRARY:
(B) CLONE: Consensus
(xi) SEQUENCE DESCRIPTION: SEQ ID NO:2:
GACGGCTCGAGTGGAGGTCTCAGACTCTTGGAAGGGGCTATACTAGACACACAAAGACAG60
CCCCAAGAAGGACGGTGGAGTAGTGTCCTCGCTAAAAGACAGTAGATATGCAACGCCTCT120
TGCTCCTGCCCTTTCTCCTGCTGGGAACAGTTTCTGCTCTTCATCTGGAGAATGATGCCC180
CCCATCTGGAGAGCCTAGAGACACAGGCAGACCTAGGCCAGGATCTGGATAGTTCAAAGG240
AGCAGGAGAGAGACTTGGCTCTGACGGAGGAGGTGATTCAGGCAGAGGGAGAGGAGGTCA300
AGGCTTCTGCCTGTCAAGACAACTTTGAGGATGAGGAAGCCATGGAGTCGGACCCAGCTG360
CCTTAGACAAGGACTTCCAGTGCCCCAGGGAAGAAGACATTGTTGAAGTGCAGGGAAGTC420
CAAGGTGCAAGACCTGCCGCTACCTATTGGTGCGGACTCCTAAAACTTTTGCAGAAGCTC480
AGAATGTCTGCAGCAGATGCTACGGAGGCAACCTTGTCTCTATCCATGACTTCAACTTCA540
ACTATCGCATTCAGTGCTGCACTAGCACAGTCAACCAAGCCCAGGTCTGGATTGGAGGCA600
ACCTCAGGGGCTGGTTCCTGTGGAAGCGGTTTTGCTGGACTGATGGGAGCCACTGGAATT660
TTGCTTACTGGTCCCCAGGGCAACCTGGGAATGGGCAAGGCTCCTGTGTGGCCCTATGCA720
CCAAAGGAGGTTATTGGCGACGAGCTCAATGCGACAAGCAACTGCCCTTCGTCTGCTCCT780
TCTAAGCCAGCGGCACGGAGACCCTGCCAGCAGCTCCCTCCCGTCCCCCAACCTCTCCTG840
CTCATAAATCCAGACTTCCCACAGC865
(2) INFORMATION FOR SEQ ID NO:3:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 222 amino acids
(B) TYPE: amino acid
(C) STRANDEDNESS: single
(D) TOPOLOGY: linear
(ii) MOLECULE TYPE: peptide
(vii) IMMEDIATE SOURCE:
(A) LIBRARY: GenBank
(B) CLONE: 34476
(xi) SEQUENCE DESCRIPTION: SEQ ID NO:3:
MetLysLeuProLeuLeuLeuAlaLeuLeuPheGlyAlaValSerAla
151015
LeuHisLeuArgSerGluThrSerThrPheGluThrProLeuGlyAla
202530
LysThrLeuProGluAspGluGluThrProGluGlnGluMetGluGlu
354045
ThrProCysArgGluLeuGluGluGluGluGluTrpGlySerGlySer
505560
GluAspAlaSerLysLysAspGlyAlaValGluSerIleSerValPro
65707580
AspMetValAspLysAsnLeuThrCysProGluGluGluAspThrVal
859095
LysValValGlyIleProGlyCysGlnThrCysArgTyrLeuLeuVal
100105110
ArgSerLeuGlnThrPheSerGlnAlaTrpPheThrCysArgArgCys
115120125
TyrArgGlyAsnLeuValSerIleHisAsnPheAsnIleAsnTyrArg
130135140
IleGlnCysSerValSerAlaLeuAsnGlnGlyGlnValTrpIleGly
145150155160
GlyArgIleThrGlySerGlyArgCysArgArgPheGlnTrpValAsp
165170175
GlySerArgTrpAsnPheAlaTyrTrpAlaAlaHisGlnProTrpSer
180185190
ArgGlyGlyHisCysValAlaLeuCysThrArgGlyGlyTyrTrpArg
195200205
ArgAlaHisCysLeuArgArgLeuProPheIleCysSerTyr
210215220
(2) INFORMATION FOR SEQ ID NO:4:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 233 amino acids
(B) TYPE: amino acid
(C) STRANDEDNESS: single
(D) TOPOLOGY: linear
(ii) MOLECULE TYPE: peptide
(vii) IMMEDIATE SOURCE:
(A) LIBRARY: GenBank
(B) CLONE: 220291
(xi) SEQUENCE DESCRIPTION: SEQ ID NO:4:
MetLysLeuLeuLeuLeuLeuAlaLeuLeuLeuGlyAlaValSerThr
151015
ArgHisLeuLysValAspThrSerSerLeuGlnSerLeuArgGlyGlu
202530
GluSerLeuAlaGlnAspGlyGluThrAlaGluGlyAlaThrArgGlu
354045
AlaThrAlaGlyAlaLeuMetProLeuProGluGluGluGluMetGlu
505560
GlyAlaSerGlySerGluAspAspProGluGluGluGluGluGluGlu
65707580
GluGluValGluPheSerSerGluLeuAspValSerProGluAspIle
859095
GlnCysProLysGluGluAspThrValLysPhePheSerArgProGly
100105110
TyrLysThrArgGlyTyrValMetValGlySerAlaArgThrPheAsn
115120125
GluAlaGlnTrpValCysGlnArgCysTyrArgGlyAsnLeuAlaSer
130135140
IleHisSerPheAlaPheAsnTyrGlnValGlnCysThrSerAlaGly
145150155160
LeuAsnValAlaGlnValTrpIleGlyGlyGlnLeuArgGlyLysGly
165170175
ArgCysArgArgPheValTrpValAspArgThrValTrpAsnPheAla
180185190
TyrTrpAlaArgGlyGlnProTrpGlyGlyArgGlnArgGlyArgCys
195200205
ValThrLeuCysAlaArgGlyGlyHisTrpArgArgSerHisCysGly
210215220
LysArgArgProPheValCysThrTyr
225230
(2) INFORMATION FOR SEQ ID NO:5:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 234 amino acids
(B) TYPE: amino acid
(C) STRANDEDNESS: single
(D) TOPOLOGY: linear
(ii) MOLECULE TYPE: peptide
(vii) IMMEDIATE SOURCE:
(A) LIBRARY: GenBank
(B) CLONE: 544241
(xi) SEQUENCE DESCRIPTION: SEQ ID NO:5:
MetLysLeuLeuLeuLeuLeuAlaLeuLeuValGlyAlaValSerThr
151015
ArgHisLeuAsnValAspThrSerSerLeuGlnSerLeuGlnGlyGlu
202530
GluSerLeuAlaGlnAspGlyGluThrAlaGluGlyAlaThrArgGlu
354045
AlaAlaSerGlyValLeuMetProLeuArgGluGluValLysGluGlu
505560
MetGluGlyGlySerGlySerGluAspAspProGluGluGluGluGlu
65707580
GluLysGluMetGluSerSerSerGluLeuAspMetGlyProGluAsp
859095
ValGlnCysProLysGluGluAspIleValLysPheGluGlySerPro
100105110
GlyCysLysIleCysArgTyrValValLeuSerValProLysThrPhe
115120125
LysGlnAlaGlnSerValCysGlnArgCysPheArgGlyAsnLeuAla
130135140
SerIleHisSerTyrAsnIleAsnLeuGlnValGlnArgSerSerArg
145150155160
IleLeuAsnValAlaGlnValTrpIleGlyGlyGlnLeuArgGlyLys
165170175
GlyHisHisLysHisPheHisTrpValAspGlyThrLeuTrpAsnPhe
180185190
TrpTyrTrpAlaAlaGlyGlnProTrpArgGlyAsnAsnSerGlyArg
195200205
CysValThrLeuCysAlaArgGlyGlyHisTrpArgArgSerHisCys
210215220
GlyValArgArgAlaPheSerCysSerTyr
225230
__________________________________________________________________________
Top