Back to EveryPatent.com
| United States Patent |
5,686,248
|
|
Burnie
, et al.
|
November 11, 1997
|
Fungal stress proteins
Abstract
A polypeptide sequence from Candida albicans is described which has
significant sequence homology with known stress proteins from other
organisms, particularly the heat shock protein hsp 90 of Saccharomyces
cerevisiae. Corresponding DNA sequences are also described, together with
antibodies raised against fragments of the sequence. The polypeptide and
DNA sequences and antibodies provide separate means for the diagnosis
and/or treatment of fungal, particularly Candida, infections.
| Inventors:
|
Burnie; James Peter (Wilmslow, GB);
Matthews; Ruth Christine (Wilmslow, GB)
|
| Assignee:
|
The Victoria University of Manchester (GB)
|
| Appl. No.:
|
672514 |
| Filed:
|
June 28, 1996 |
Foreign Application Priority Data
| Current U.S. Class: |
435/6; 435/91.1; 435/91.2; 435/921; 435/922; 536/23.1; 536/23.7; 536/23.74; 536/24.32; 536/24.33 |
| Intern'l Class: |
C12Q 001/68; C12P 019/34; C12N 001/00; C07H 021/04 |
| Field of Search: |
435/6,91.1,91.2,183,911,921,922
536/23.1,23.7,23.74,24.32,24.33
935/8.76,77
|
References Cited
U.S. Patent Documents
| 4806465 | Feb., 1989 | Buckley et al. | 435/7.
|
| 5288639 | Feb., 1994 | Burnie et al. | 435/320.
|
| Foreign Patent Documents |
| 0145333 | Jun., 1985 | EP.
| |
| 86/05400 | Sep., 1986 | WO.
| |
Other References
Matthews et al. "Cloning of a DNA sequence encoding a major fragment of the
47 KD stress protein homologue of Candida albicans", FEMS Microbiology
Letters 60:25-30, 26 Jun. 1989.
Matthews et al, "Immunoblot analysis of the serological response in
systemic candiosis", Lancet, pp. 1415-1418, 22/29 Dec. 1984.
Burnie et al, Lancet "47 KD antigen of Candida albicans," pp. 1155, 18 May
1985.
Farrelly et al, "Complete sequence of the heat shock-inducible HSP90 gene
of Saccharomyces cerivisiae", The Journal of Biological Chemistry,
259(9):5745-5751, 10 May 1984.
Matthews et al, "Isolation of immunodominant antigens from sera of patients
with systemic candidiasis and characterisation of serological response to
Candida albicans" Journal of Clinical Microbiol, . 25(2):230-237, 1987.
Matthews et al, "Characterisation and cellular localisation of
immunodominant 47 KDa antigen of Candida albicans", Journal of Medical
microbiology, 27:227-232, 1988.
Neale et al, "The immunochemical characterisation of circulating immune
complex constituents in Candida albicans osteomyelitis by isoelectric
focusing, immunoblot and immunoprint", Aust. NZ. J. Med., 17:201-208,
1987.
Matthews et al., "Diagnosis of Systemic Candidiasis by an Enzyme-Linked Dot
Immunobinding Assay for a Circulating Immunodominant 47-kilodalton
Antigen", J. Clin. Microbial, 26(3):459-463 (Mar. 1988).
Dragon et al, "The Genome of Trypanosoma cruzi Contains a Constitutively
Expressed, Randomly Arranged Multicopy Gene Homologous to a Major Heat
Shock Protein", Mol. Ceel. Biol. 7(3):1271-1275 (Mar. 1987).
Matthews & Burnie, "Cloning of a DNA Sequence Encoding a Major Fragment of
the 47 Kilodalton Stress Protein Homoloque of Candida Albicus", FEMS
Microbiol. Letters, 60:25-30 (Jul. 1, 1989).
|
Primary Examiner: Sisson; Bradley L.
Attorney, Agent or Firm: Cushman Darby & Cushman IP Group of Pillsbury Madison & Sutro
Parent Case Text
This is a division of application Ser. No. 8/357,264 filed Dec. 13, 1994,
now U.S. Pat. No. 5,541,077 which is a continuation of Ser. No.
08/152,669, Nov. 16, 1993 now abandoned; which was a divisional of Ser.
No. 07/663,897 filed as PCT/GB90/1021 Jul. 2, 1990, now U.S. Pat. No.
5,288,639 issued Feb. 22, 1994.
Claims
We claim:
1. A method for diagnosing the Candida infection wherein said method
comprises:
a) combining a nucleic acid sample with a probe having the nucleotide
residue sequence represented by SEQ ID NO:2 wherein said sample is
suspected of containing Candida nucleic acid;
b) allowing for the formation of a hybridization product between the probe
and said target nucleic acid under conditions which only permit the
formation of a hybridization product between the probe and said target
nucleic acid; and
c) detecting the presence of said hybridization product.
2. The method of claim 1 further comprising amplifying the target nucleic
acid prior to formation of said hybridization product.
3. The method of claim 2 wherein said amplification is achieved by
performing a polymerase chain reaction.
4. The method of claim 1 wherein the probe is detectably labeled.
Description
FIELD OF THE INVENTION
This invention relates to fungal stress proteins, to corresponding DNA
sequences, to fungal stress protein inhibitors and to their use in
medicine and for diagnosis.
BACKGROUND OF THE INVENTION
Environmental stress can induce an increase in the rate of synthesis of
so-called heat shock, or stress, proteins in both procaryotic and
eucaryotic cells ›see for example Schlesinger et al (eds) in Heat Shock
from Bacteria to Man, Cold Spring Harbor Laboratory, Cold Spring Harbor,
N.Y. (1972)!. Although the function of stress proteins has yet to be
finally resolved, some have been reported to participate in assembly and
structural stabilization of certain cellular and viral proteins, and their
presence at high concentration may have an additional stabilising effect
during exposure to adverse conditions.
Many pathogenic organisms have been shown to produce stress proteins ›see
for example Young D, et al., Proc. Natl. Acad. Sci. USA 85, 4267-4270
(1988)!. The proteins are thought to be produced in response to the stress
of infection to help protect the invading pathogen. Thus, for example, the
ability to produce stress proteins has been implicated in the survival of
bacterial pathogens within macrophages ›Christmas, M. F. et al. Cell, 41,
753-762 (1985) and Morgan, R. W. et al, Proc. Natl. Acad. Sci. USA, 83,
8059-8063, (1986)!.
It has been suggested that the presence of stress proteins in a variety of
human pathogens indicates that the stress response is a general component
of infections, and that stress proteins should be considered among
candidates for subunit vaccines ›Young, D. et al, ibid!. Candida albicans
is, medically, the most important of the human fungal pathogens. Systemic
candidiasis (candidosis) is an increasingly common cause of death amongst
immunocompromised and debilitated patients, with a mortality of over 70%
›Gold, J.W.M., Am. J. Med. 76, 458-463, (1984)!; while oral candidiasis is
a frequent early manifestation of the acquired immunodeficiency syndrome
›Klein, R. S. et al, N. Engl. J. Med. 311, 354-357, (1984)!. Candidiasis
is difficult to diagnose, and is not easy to treat, mainly since the usual
method of treatment involves use of amphotericin B, which is itself highly
toxic. A need therefore exists in the diagnosis and treatment of Candida
infections for more sensitive diagnostic methods and treatment which has
less toxic side effects.
A number of Candida antigens have been detected in the sera of patients
with systemic candidiasis ›Matthews, R. C. et al, J. Clin. Microbiol. 25,
230-237 (1987)!. One of these, with a relative molecular mass of
approximately 47 kilodaltons (47 kd) is an immunodominant antigen which
has been reported by four independent groups ›Matthews R. C., et al Lancet
ii, 1415-1418 (1984); Au-Young, JK et al, Diagn. Microbiol. Infect. Dis.,
3, 419-432, (1985); Neale T. J., et al, Aust. N. Z. J. Med., 17, 201-209
(1987); and Ferreira R. P. et al, J. Clin. Microbiol. 28, 1075-1078
(1990)!. This 47 Kd antigen is distinct from the 48-52 Kd antigen
described by Strockbine et al ›Strockbine N. A. et al Infect. Immun. 43,
715-721 (1984)! for two reactions:
(1) monoclonal antibodies raised against the 48-52 Kd antigen cross-react
with antigens at 120-135 Kd and 35-38 Kd ›Strockbine N. A. et al, Infect
Immun 43, 1012-18 (1984); Buckley H. R., et al U.S. Pat. No. 4,670,382
(1987)! and
(2) the 48-52 Kd antigen it is an enolase ›Safranek W. W. and Buckley H.
R., Second Conference on Candida and Candidiasis, Abstract A7 (1990)!. In
contrast, antibody to the 47 Kd antigen cross-reacts with an antigen at
about 92 Kd (see below). An immunodominant C. albicans antigen of 54.3 Kd
(range 48.9 to 59.7 Kd) was described by Greenfield R. A., and Jones J.
M., in Infect. Immun. 34, 469-477 (1981).
SUMMARY OF THE INVENTION
We have now been able to clone and express part of the DNA sequence
encoding the 47 Kd antigen, and in doing so we have surprisingly
discovered a polypeptide sequence which has significant sequence homology
with known stress proteins from other organisms, particularly the heat
shock protein hsp 90 of Saccharomyces cerevisiae ›Farrelly F. W. and
Finkelstein D. B., J. Biol. Chem. 259, 5745-5751 (1984)!. In Saccharomyces
two genes exist, hsp 90 and hsc 90, coding for 98% homologous proteins
›Finkelstein D. B. and Farrelly F. W., Fed. Proc. 43, 1499 Abstr. 482
(1984)!. Either of the genes can be deleted without affecting cell
viability, however, deletion of both genes is lethal. The separate genes
produce a constitutive and an inducible form ›D. Finkelstein, personal
communication cited in Lindquist S. Ann. Rev. Biochem. 55, 1151-91
(1986)!.
We can also now suggest that there are two forms of a C. albicans stress or
heat shock protein hsp90. Thus a 47 Kd breakdown product occurs on
immunoblots of C. albicans grown at 37.degree. C. or 23.degree. C. whereas
a 92 Kd antigen only appears at 37.degree. C. This suggests a
heat-inducible, stable hsp 90 is produced at 37.degree. C., but not at
23.degree. C., whereas a more labile hsp 90 occurs at 23.degree. C. which
breaks down to the 47 Kd subcomponent under denaturing conditions. We have
used this discovery to develop means for the improved diagnosis and
treatment of candida infections and related fungal disease.
Thus according to one aspect of the invention we provide a fungal stress
protein having an amino acid sequence which includes at least the sequence
of formula (1) (SEQ ID NO:1).
##STR1##
or a fragment thereof, or an analogue thereof.
The single letters in formula (1) are each to be understood to represent a
separate amino acid, and each is the conventional single letter symbol
used for amino acids.
The stress protein according to the invention may be of fungal origin and
may be obtainable, for example, from strains belonging to the general
Candida, for example Candida parapsilosis, Candida krusei and, in
particular, Candida albicans and Candida tropicalis; Cryptococcus, for
example Cryptococcus neoformans; Histoplasma, for example Histoplasma
capsulatum, and related yeasts; and Aspergillus, for example Aspergillus
fumigatus and related filamentous fungi.
Particular fragments of a stress protein according to the invention include
any peptide epitopes, for example of a few amino acids or analogues
thereof. Examples of such epitopes include STDEPAGESA (SEQ ID NO:4), LSREM
(SEQ ID NO:5), LKVIRK (SEQ ID NO:6) and LKVIRKNIVKKMIE (SEQ ID NO:7).
Peptides of this type may be synthesized using conventional liquid or
solid phase peptide synthesis techniques.
Analogues of a stress protein according to the invention include those
proteins wherein one or more amino acids in the sequence of formula (1) is
replaced by another amino acid, providing that the overall functionality
of the protein is conserved.
A stress protein according to the invention may be obtained in a purified
form, and thus according to a further aspect of the invention we provide a
substantially pure fungal stress protein having an amino acid sequence
which includes at least the sequence of formula (1), and analogues
thereof.
The term substantially pure is intended to mean that the stress protein
according to the invention is free from other proteins of fungal origin.
In the various aspects of the invention described hereinafter it is to be
understand that a reference to the fungal stress protein also includes
substantially pure preparations of the protein.
In a further aspect the invention particularly provides a recombinant
fungal stress protein having an amino acid sequence which includes at
least the sequence of formula (1) or a fragment thereof, or an analogue
thereof.
A stress protein according to the invention may be further characterised by
one or more of the following features:
(1) it has an isoelectric point (pI) in a range around pI 4 to pI 5;
(2) it is an immunodominant conserved antigen;
(3) patients recovering from systemic candidiasis seroconvert to the stress
protein;
(4) patients with acquired immunodeficiency syndrome have antibody to the
stress protein;
(5) it cross-reacts with the 47 kilodalton and approximately 92 kilodalton
antigens of Candida albicans using affinity-purified polyclonal
monospecific antibody against the 47 kilodalton antigen.
A stress protein according to the invention has a number of uses. Thus, for
example, the protein may form the basis of a diagnostic test for fungal
infection, for example an immunological test such as an enzyme-linked
immunosorbent assay, a radioimmunoassay or a latex aggulutination assay,
essentially to determine whether antibodies specific for the protein are
present in an organism.
In another use, the stress protein according to the invention may be
employed, using conventional techniques, for screening to obtain activity
inhibiting agents for use in the treatment of fungal infections. Such a
screening method forms a further aspect of the invention.
In a further use, the stress protein according to the invention is
particularly well suited for the generation of antibodies. Thus according
to a further aspect of the invention we provide a fungal stress protein
having an amino acid sequence which includes at least the sequence of
formula (1) or a fragment thereof or an analogue thereof, for use as an
immunogen.
Standard immunological techniques may be employed with the stress protein
in order to use it as an immunogen. Thus, for, example, any suitable host
may be injected with the protein and the serum collected to yield the
desired polyclonal anti-stress protein antibody after purification and/or
concentration. Prior to injection of the host the stress protein may be
formulated in a suitable vehicle ad thus according to a further aspect of
the invention we provide a composition comprising a fungal stress protein
having an amino acid sequence which includes at least the sequence of
formula (1) or an analogue thereof together with one or more
pharmaceutically acceptable excipients.
For purification of any anti-stress protein antibody, use may be made of
affinity chromatography employing an immobilised stress protein of the
invention as the affinity medium. This according to another aspect of the
invention we provide a fungal stress protein having an amino acid sequence
which includes at least the sequence of formula (1), or a part thereof or
an analogue thereof, covalently bound to an insoluble support.
The use of the stress proteins according to the invention as immunogens for
the production of antibodies generates one type of inhibitor of the action
of the protein. Generally, inhibitors of the stress proteins are
potentially useful in the diagnosis, and in particular the treatment, of
fungal infections and provide a further feature of the invention.
Inhibitors include any antagonists of the action of the stress proteins or
agents which prevent their production, and in particular include those
which may be used in the treatment of fungal infections. Suitable
inhibitors include for example pharmaceutical reagents, including
antibodies, and chemical analogues of the stress proteins to antagonise
the action of the stress protein, and anti-sense RNA and DNA to prevent
production of the stress protein. Suitable inhibitors may be determined
using appropriate screens, for example by measuring the ability of a
potential inhibitor to antagonise the action of, or prevent the production
of a stress protein according to the invention or a fragment thereof, or
an analogue thereof, in a test model for example an animal model such as
the mouse model described in the Examples hereinafter.
According to a further aspect of the invention we provide an inhibitor of a
fungal stress protein, said protein having an amino acid sequence which
include at least the sequence of formula (1) or a fragment thereof or an
analogue thereof, for use in the diagnosis or treatment of fungal
infections.
Inhibitors may be used either along or where appropriate in combination
with other pharmaceutical agents, for example, other anti-fungal agents,
such as amphotericin or flucytosine.
One particularly useful group of inhibitors according to this aspect of the
invention are antibodies capable of recognising and binding to the stress
proteins.
Thus, according to yet another aspect of the invention we provide an
antibody specific for one or more epitopes of a fungal stress protein
having an amino acid sequence which includes at least the sequence or
formula (1) or a fragment thereof or an analogue thereof.
The antibody may be a whole antibody or an antigen binding fragment thereof
and may in general belong to any immunoglobulin class. Thus, for example,
it may be an immunoglobulin M antibody or, in particular, an
immunoglobulin G antibody. The antibody or fragment may be of animal, for
example mammalian origin and may be for example or murine, rat or human
origin. It may be a natural antibody or a fragment thereof, or, if
desired, a recombinant antibody or antibody fragment, i.e. an antibody or
antibody fragment which has been produced using recombinant DNA
techniques.
Particular recombinant antibodies or antibody fragments include, (1) those
having an antigen binding site at least part of which is derived from a
different antibody, for example those in which the hypervariable or
complementarity determining regions of one antibody have been grafted into
the variable framework regions of a second, different antibody (as
described in European Patent Specification No. 239400); (2) recombinant
antibodies or fragments wherein non-Fv sequences have been substituted by
non-Fv sequences from other, different antibodies (as described in
European Patent Specifications Nos. 171496, 173494 and 194276); or (3)
recombinant antibodies or fragments possessing substantially the structure
of a natural immunoglobulin but wherein the hinge region has a different
number of cystein residues from that found in the natural immunoglobulin,
or wherein one or more cysteine residues in a surface pocket of the
recombinant antibody or fragment is in the place of another amino acid
residue present in the natural immunoglobulin (as described in
International Patent Applications Nos. PCT/GB 88/00730 and PCT/GB 88/00729
respectively).
The antibody or antibody fragment may be of polyclonal, or preferably,
monoclonal origin. It may be specific for a number of epitopes associated
with the stress protein but it is preferably specific for one.
Antigen binding antibody fragments include for example fragments derived by
proteolytic cleavage of a whole antibody, such as F(ab').sub.2,Fab' or Fab
fragments, or fragments obtained by recombinant DNA techniques, for
example Fv fragments (as described in International Patent Application No.
PCT/GB 88/00747).
The antibodies according to the invention may be prepared using well-known
immunological techiques employing the stress protein as antigen. Thus, for
example, any suitable host may be injected with the stress protein and the
serum collected to yield the desired polyclonal antibody after appropriate
purification and/or concentration (for example by affinity chromatography
using the immobilised stress protein as the affinity medium).
Alternatively splenocytes or lymphocytes may be recovered from the stress
protein injected host and immortalised using for example the method of
Kohler et al, Eur. J. Immunol. 6, 511, (1976), the resulting cells being
segregated to obtain a single genetic line producing monoclonal
anti-fungal stress proteins. Antibody fragments may be produced using
conventional techniques, for example by enzymatic digestion, e.g. with
pepsin (Parham, J. Immunol, 131, 2895 (1983)! or papain ›Lamoyi and
Nigonoff, J. Immunol. Meth., 56, 235, (1983)!. Where it is desired to
produce recombinant antibodies according to the invention these may be
produced using for example the methods described in European Patent
Specifications Nos. 171496, 173494, 194276 and 239400.
Antibodies according to the invention may be labelled with a detectable
label or may be conjugated with effector molecule for example a drug e.g.
an anti-fungal agent such as amphotericin B or flucytosine or a toxin,
such as ricin, or an enzyme, using conventional procedures and the
invention extends to such labelled antibodies or antibody conjugates.
The antibodies according to the invention have a diagnostic and/or
therapeutic use. Thus for diagnostic use the antibodies may be employed to
detect whether the stress protein is present in a host organism, to
confirm whether the host has a particular fungal infection, for example an
infection due to a Candida, Cryptococcus, Histoplasma or Aspergillus
organism, for example in the diagnosis of fungal abcesses, especially
hepatic Candidiasis, and/or to monitor the progress of therapeutic
treatment of such infections. Diagnostic methods of this type form a
further aspect of the invention and may generally employ standard
techniques, for example immunological methods such as enzyme-linked
immunosorbent methods, radioimmuno-methods, lates agglutination methods or
immunoblotting methods.
Antibodies according to the invention also have a therapeutic use in the
treatment of fungal infections, for example those just described and may
be used alone or conjugated to an effector molecule, in the latter case to
target the effector molecule, e.g. an anti-fungal agent such as
amphotericin B or flacytosine, to the infecting organism. For therapeutic
use the antibody may be formulated in accordance with conventional
procedures, for example with a pharmaceutically acceptable carrier or
excipient, e.g. isotonic saline for administration at an appropriate
dosage, depending on the nature of the infection to be treated and the age
and condition of the patient.
If desired, mixtures of antibodies may be used for diagnosis or treatment,
for example mixtures of two or more antibodies recognising different
epitopes of a fungal stress protein according to the invention, and/or
mixtures of antibodies of a different class, e.g. mixtures of IgG and IgM
antibodies recognising the same or different epitope(s) of a fungal stress
protein of the invention.
The stress proteins according to the invention may be prepared by a variety
of processes, for example by protein fractionation from appropriate fungal
cell extracts, using conventional separation techniques such as ion
exchange and gel chromatography and electrophoresis, or by the use of
recombinant DNA techniques, as more particularly described in the Examples
hereinafter. The use of recombinant DNA techniques is particularly
suitable for preparing substantially pure stress proteins according to the
invention.
Thus according to a further aspect of the invention we provide a process
for the production of a fungal stress protein having an amino acid
sequence which includes at least the sequence of formula (1) or an
analogue thereof, comprising the steps of (1) culturing a host organism
transformed with a vector including a gene coding for a precursor of said
protein, (2) cleaving said precursor to produce said protein and (3)
recovering said protein.
Preferably the precursor cleaved in this aspect of the invention is a
fusion protein comprising at least a portion of a protein produced in a
transformed host organism and at least the amino acid sequence of formula
(1). Such fusion proteins form a further aspect of the invention.
Desirably the fusion protein includes a protein produced at a high level
by a transformed host organism. Suitable such proteins include at least a
portion of a chloramphenicol acetyltransferase (CAT) protein or,
preferably at least a portion of the .beta.-galactosidase protein.
According to a still further aspect of the invention we provide a DNA
sequence coding for a fungal stress protein having substantially the
nucleotide sequence of formula (2) (SEQ.ID.NO:2):
##STR2##
and homologues thereof.
DNA with this sequence may be obtained from fungal genomic DNA as described
in the Examples hereinafter.
The DNA sequence according to this aspect of the invention may be
incorporated in an expression vector using conventional techniques. Thus
in a further aspect of the invention we provide an expression vector
including substantially a DNA sequence of formula (2) or a homologue
thereof.
The vector may be adapted for use in a given host cell by the provision of
suitable selectable markers, promoters and other control regions as
appropriate. Host cells transformed with such vectors form a further
aspect of the invention. Suitable host organisms include bacteria (e.g. E.
coli), and mammalian cells is tissue culture.
The DNA sequence of formula (2) may also be used to design DNA probes for
use in identifying the presence of fungal stress proteins in the infected
state and the invention extends to such DNA probes. Such probes may also
be of use for detecting circulating fungal nucleic acids, for example
using a polymerase chain reaction, as a method of diagnosing fungal
infections. The probe may be synthesised using conventional techniques and
may be immobilised on a solid phase, capable of immobilisation on a solid
phase, or may be labelled with a detectable label.
It will also be appreciated that by suitable epitope mapping, using
conventional procedures, for example as described in Example 2 hereinafter
peptide fragments of the stress proteins may be identified which can be
chemically synthesised. Synthetic peptide antigens of this type may be
used to raise antibodies for use in diagnosis and/or therapy, as
previously described, or to produce antiseras, e.g. non-specific
polyclonal antisera, for use as a vaccine, and as discussed above form a
further aspect of the invention.
BRIEF DESCRIPTION OF THE DRAWINGS
In the following description various embodiments of the present invention
are described with reference to the accompanying drawings to which:
FIG. 1 shows immunoblots of C. albicans probed with antigen-selected
antibodies.
FIG. 2 shows immunoblots of recombinant lysogen prepared from clone CA-1
FIG. 2B shows immunoblots of recombinant lysogen CA-1 probed with
monoclonal antibody against .beta.-galactosidase
FIG. 2C shows immunoblots of recombinant lysogen CA-1 probed with sera from
patients having antibody to the 47 Kd antigen
FIG. 3 is a comparison of the predicted amino acid sequence of the C.
albicans open reading frame (CA-orf) (SEQ.ID.NO.1) with S. cerevisae hsp
90 (SEQ.ID.NO:3)
FIG. 4 shows immunoblots of C. albicans in the yeast phase probed with
rabbit antiserum raised against LKVIRKNIVKKMIE-Cys-KLH (SEQ ID NO:8)
FIG. 5 shows immunoblots of C. albicans in the mycelial phase probed with
rabbit antiserum raised against LKVIRKNIVKKMIE-Cys-KLH (SEQ ID NO:8)
DESCRIPTION OF SPECIFIC EMBODIMENTS
The following Examples illustrate the invention, in which Example 1
describes the preparation of a stress protein according to the invention;
Example 2 describes the epitope mapping of a stress protein according to
the invention, the preparation of particular peptide epitopes and their
use in detecting Candida infections; Example 3 describes the preparation
of a monoclonal antibody against a particular epitope; and Example 4
describes the use of a particular monoclonal antibody ›raised against an
epitope of a stress protein according to the invention! to protect against
Candida infection in mice.
EXAMPLE 1
Strain and culture conditions
A fully characterised strain of C. albicans (serotype A, morphotype A1,
biotype 157), responsible for the first London hospital outbreak of
systemic candidiasis ›Burnie, J. P. et al, Brit. Med. J., 290, 746-748
(1985)! was grown at 37.degree. C. overnight with seration in 2% glucose
broth.
Preparation and screening of genomic library
Genomic DNA was prepared by the method of Wills et al ›J. Bacteriol. 157,
918-924 (1984)!, as modified by Scherer and Stevens ›Proc. Natn. Acad.
Sci. USA 85, 1452-1456, (1988)!. It was partially digested with EcoRI and
fragments 2-7 kilobase pairs long were cloned into the unique EcoRI
restriction enzyme site of the expression vector lambda gt 11 ›Huynh, T.
et al in DNA Cloning Techniques: A Practical Approach, Glover, D. Ed, pp.
49-78, IRL Press, Oxford (1985), and Young, R. A. and Davis, P. W., Proc.
Natn. Acad. Sci. USA 80, 1194-1198, (1983)!. The library was screened with
rabbit antiserum raised against soluble candidal antigens produced by
fragmenting C. albicans yeast cells at -20.degree. C. in an X-press
›Matthews, R. C. et al, J. Clin. Microbiol. 25, 230-237 (1987)-(1)!.
Immunoblotting against C. albicans, as previously described ›Matthews, R.
C. et al, Lancet ii, 1415-1418, (1984)-2); Matthews, R. C. et al J. Clin.
Microbiol. ibid!, confirmed that the antiserum contained high titre
antibody to many antigens including the 47 KD antigen. Five positive
clones were identified by screening approximately 10.sup.5 plaques.
Characterisation of positive clones
The epitope expressed by each of the positive clones was identified by
antigen-selection as described by Lyon et al ›Proc. Natn. Acad. Sci. USA,
83, 2989-2993, (1986)!. For this the polyspecific rabbit antiserum was
affinity purified against positive recombinant plaques and the bound
antibody, eluted with glycine buffer pH 2.8, screened against an
immunoblot of C. albicans ›Matthews, R. C. et al. (1), (2) ibid!. Lysogens
were prepared in E. coli Y1089 as described by Huynh et al ›ibid!. To
determine whether expression of the fusion protein was under the control
of the lac Z promoter, lysates of the recombinant lysogens were examined,
by immunoblotting, after: 1) heat-induction at 45.degree. C. followed by
growth at 37.degree. C. for 60 min. with 10 mM isopropyl
.beta.-d-thiogalactoside (EPIG); 2) heat induction following by growth at
30.degree. C. without IPIG; and 3) growth at 32.degree. C. in the presence
of 10 mM IPTG.
Immunoblots of recombinant lysogens were examined for reactivity of the
fusion protein with: 1) rabbit candidal antiserum (diluted 1:2 in 3%
bovine serum albumin in buffered saline); 2) a monoclonal antibody to
.beta.-galactosidase, obtained commercially from Promega Biotec, Liverpool
(1:5,000 dilution); and 3) sera (1:10) from patients with antibody to the
47 KD antigen, including five patient with AIDS and one patient recovering
from systemic candidiasis who seroconverted to the 47 KD antigen; sera
from five HIV antibody-positive patients with no evidence of candidiasis
were use as controls.
DNA sequencing and analysis
Restriction enzyme mapping inserts from the five positive clones identified
an overlapping region, suggesting that the epitopes expressed by each
clone were encoded by a single genomic segment. This region from clone
CA-1, extending 2 KB from the 5' termini of the insert, was subcloned into
the EcoRI site of pUC19. It was sequenced by the dideoxy chain termination
method of Sanger et al ›Proc. Natn. Acad. Sci. USA 74 5463-5467 (1977)!.
Reading frame analysis revealed a single open reading frame (CA-orf)
extending from the EcoRI cloning site. The FASTA programme (Pearson, W. E.
and Lipman, D. J., Proc. Natn. Acad. Sci. USA, 85, 2444-2448, (1988)!was
used to compare the predicted polypeptide with the PIR protein database.
RESULTS
All five clones expressed epitopes which cross-reacted with the 47 KD
antigen and a 92 KD antigen of C. albicans (FIG. 1). Immunoblots of
recombinant lysogens, grown with and without IPTG, demonstrated that
expression was under the regulation of the lac promotor (FIG. 2A). The
cloned antigen was fused to .beta.-galactosidase. The fusion protein
produced by clone CA-1 had an elevated molecular weight, Mr 160 KD,
compared to native .beta.-galactosidase (Mr 116 KD) (FIG. 2B). A lower Mr
band was also seen reacting with the anti-galactosidase monoclonal
antibody, indicating the fusion protein was inherently less stable than
native .beta.-galactosidase.
As well as the rabbit candidal antiserum, the fusion protein also reacted
with sera from AIDS patients with antibody to the 47 KD antigen, but not
HIV antibody positive patients without this antibody. A patient with
systemic candidiasis who seroconverted to the 47 KD antigen also
seroconverted to the fusion protein (FIG. 2C). The patients' sera, which
had not been absorbed with E. coli, reacted with several other bands in
the recombinant lysogens and the .lambda.gt 11 control, and therefore
these bands were considered to be E. coli antigens.
Nucleotide analysis of the insert DNA from clone CA-1 revealed a single
partial open reading frame (orf) which continued in from the cloning site
and coded for a polypeptide of 395 amino acids (Mr 45 KD). This orf was in
phase with the .beta.-galactosidase gene. Since fusion with
.beta.-galactosidase (Mr 116 KD) results in removal of the C-terminal 19
residues from the lac Z gene, the calculated size of the fusion protein
was 159 KD. This agrees with the estimated value of 160 KD for the fusion
protein produced by clone CA-1.
A database search, with the polypeptide sequence derived from this orf,
revealed significant (>45%) homologies with heat shock proteins (haps)
from Drosophila ›Blackman, R. K. and Meselson, M. (1986) J. Mol. Biol.
188, 499-515! and chickens ›Kxlomaa, M. S., et al (1986) Biochemistry 25,
6244-6251! and microsomal glucose-regulated proteins (grps) from hamsters
›Sorger, P. E. and Pelham, H. R. B., (1987) J. Mol. Biol. 194, 341-344!
and mice ›Smith, M. J. and Koch, G. L. E., (1987) J. Mol. Biol. 194,
345-347!. The most extensive sequence similarity was found with the yeast
hap 90 protein of Saccharomyces cerevisiae ›Farrelly, F. W. and
Finkelstein, D. B. (1984) J. Biol. Chem. 259, 5745-5751!, with 83.5%
identity in the 395 amino acid overlap (FIG. 3).
The following figures are referred to above. In the figures:
FIG. 1 shows immunoblots of C. albicans probed with: antigen-selected
antibodies from two of the positive clones showing cross-reactivity with
the 92 KD and 47 KD antigens, and weakly, two intermediate components
(tracks a and b); negative control eluate from non-recombinant plaques
(c); rabbit candidal antiserum (d); AIDS patient's serum containing high
titre antibody to the 47 KD antigen (e).
FIG. 2A shows immunoblots of recombinant lysogen prepared from clone CA-1,
probed with rabbit candidal antiserum, showing the 160 KD fusion protein
is present when heat induction at 45.degree. C. is followed by growth at
37.degree. C. for 60 min. with 10 mM IPTG (tracks c and d, showing two
different lysogenic preparations). It is not produced when lysogens are
grown at 32.degree. C. (track b) or heat-induced but grown without IPTG
(tracks e and f). Molecular weight markers (KD) shown in track a.
FIG. 2B shows immunoblots of recombinant lysogen CA-1 probed with
monoclonal antibody against .beta.-galactosidase. The 160 KD fusion
protein and breakdown product are shown after growth with IPTG (track a),
and without IPTG (track b); a non-recombinant .lambda.gt11 lysogen, grown
with and without IPTG shows the position of native .beta.-galactosidase
(Mr 116 KD) (tracks c and d).
FIG. 2C shows immunoblots of recombinant lysogen CA-1 probed with sera from
patients having antibody to the 47 KD antigen. Serum from an AIDS patient
with antibody to the 47 KD antigen cross-reacting with 160 KD fusion
protein (track a); and early (b) and late (c) sera from a patient
recovering from systemic candidiasis who seroconverted to the 47 KD
antigen, showing seroconvertion to the 160 KD fusion protein.
FIG. 3 is a comparison of the predicted amino acid sequence of the C.
albicans open reading frame (CA-orf) (SEQ ID NO:1) with S. cerevisae hsp90
(SCHS90) (SEQ ID NO:3). Over the CA-orf sequence they showed >83% direct
homology (:) or >98% conserved homology (.).
EXAMPLE 2
The sequenced carboxy end of a C. albicans stress protein according to the
invention was epitope mapped using the method described by Geysen H. M. et
al in Journal of Immunological Methods 102, 259-274 (1987). This technique
involves the synthesis of large numbers of overlapping peptides and
identifies continuous antigenic peptides on a protein antigen. It will not
detect carbohydrate or discontinuous epitopes. By way of example further
details of two of these epitopes are given below:
1. STDEPAGESA (SEQ ID NO:4)
This epitope occurs just before the carboxy terminal 5 amino acid residues
of the sequence of formula (1). It reacted with: (1) hyperimmune sera from
2 out of 3 rabbits immunised with C. albicans pressate ›as described in
Burnie J. P., et al J. Clin. Pathol. 38, 701-106 (1985)!; (2) sera from 3
out of 5 patients with systemic candidiasis, two of whom seroconverted to
this epitope; (3) pooled sera from 4 patients who were HIV antibody
positive ›who have antibody to the 47 Kd antigen--see Matthews R. C., et
al Lancet ii; 263-266 (1988)!. It did not react with sera from 7 normal
control patients or a patient with chronic mucocutaneous candidiasis
(CMC).
This epitope was synthesised and conjugated to keyhole limpet haemocyanin
(KLH) via the terminal cysteine to give KLH-Cys-STDEPAGESA (SEQ ID NO:9).
A rabbit polyclonal antiserum raised against this, on immunoblotting
against C. albicans, recognised a heat-inducible antigen at about 92 Kd
(present AT 37.degree. C. but not 23.degree. C.) and a constitutive
antigen at about 40 Kd (present when grown at 23.degree. C. or 37.degree.
C.). It did not detect the 47 Kd antigen. It did not cross-react with S.
cerevisiae or A. fumigatus.
2. LSREM-LKVIRK
These two epitopes are situated close to each other, 316-332 amino acid
residues from the carboxy end of the sequence of formula (1). The LSREM
(SEQ ID NO:5) epitope reacted with; (1) 2 out of 3 rabbit hyperimmune
candidal antisera; (2) 4 out of 5 sera from patients with systemic
candidiasis, one of whom seroconverted to it; (3) pooled sera from 4 HIV
antibody positive patients and (4) serum from the CMC patient. It did not
react with sera from 7 negative control patients. A rabbit immunised with
KLH-Cys-LPLNLSREML (SEQ ID NO:10) failed to produce antibody to it.
The LKVIRK (SEQ ID NO:6) epitope was specifically detected by infected
patients' sera. None of the hyperimmune rabbit sera recognized it nor any
of the 7 negative control patients. All five patients with systemic
candidiasis had antibody to this epitope and in two case, where serial
sera were available, seroconverted to it. The pooled sera from 4 HIV
antibody positive patients and the patient with CMC also recognised this
epitope. A rabbit polyclonal antiserum raised against the epitope
(LKVIRKNIVKKMIE-Cys-KLH, (SEQ ID NO:8) recognised both the 47 Kd antigen
and the antigen of about 92 Kd on immunoblots of various strains of C.
albicans (including serotypes A and B) in both the yeast and mycelial
phase (FIGS. 4 and 5). It also recognised the fusion protein produced by a
positive clone. Cross-absorption with the synthesised peptide epitope
removed this antibody activity. The antibody also recognised antigens on
immunoblots of (1) Candida parapsilosis--giving a band at about 52 Kd (an
antigen of this size was previously reported by Belder M. A., et al
European heart Journal 10, 858-862 ›1989!); (2) A. fumigatus--giving bands
at about 88 Kd, 51 Kd and 40 Kd ›these antigens have previously been
reported, Matthews R. C., et al J. Clin. Pathol. 38, 1300-1303 (1985)! and
(3) S. cerevisiae--at about 84 Kd and 45 Kd, compatible with S. cerevisiae
hsp 90. This therefore suggests the presence of a stress protein according
to the invention in A. fumigatus of about 88 Kd.
In FIGS. 4 and 5 referred to above, the following is shown:
FIG. 4 shows immunoblots of C. albicans in the yeast phase probed with
rabbit antiserum raised against LKVIRKNIVKKMIE-Cys-KLH (SEQ ID NO:8) both
before (PRE) and after (POST) cross-absorption with this peptide.
Molecular weight markers shown on left hand side. Lane number 1, outbreak
strain of C. albicans ›Burnie J. P., et al B.M.J. 290, 746-748 (1985)!;
lane no. 2, C. albicans strain MCTC3153 (serotype A); lane no. 3, C.
albicans strain NCTC3156 (serotype B). The 47 Kd antigen and the antigen
at about 92 Kd are arrowed. Notice these antigens are missing after
cross-absorption.
FIG. 5 Lanes 1-3 are as in FIG. 5 but with the yeast in the mycelial phase.
Probed with the same antiserum as in FIG. 4, pre and post cross-absorption
with the peptide. Lane no. 4 is a positive clone showing the fusion
protein disappearing after cross-absorption, as do the 47 Kd and 92 Kd
antigens in lanes no. 1-3.
Antibody raised against the peptide STDEPAGESA (SEQ ID NO:4) or
LKVIRKNIVKKMIE (SEQ ID NO:7) was used to examine the sera of patients with
systemic candidiasis as follows:
Antigen was detected by dot-blotting serum directly onto nitrocellulose
membrane. Briefly, 100 .mu.l of antiserum was loaded into each well of a
Bio-Dot microfiltration apparatus (Biorad laboratories). This had been
previously loaded with a sheet of nitrocellulose membrane prewashed in pH
7.5 Tris buffered saline (TBS). The sample was allowed to drain through
under gravity. Each well was loaded with a further 100 .mu.l of TBS which
drains under gravity control. This is followed by 2.times.100 .mu.l TBS
drained by vacuum. The membrane was then blocked in 3% BSA in TBS at
4.degree. C. overnight. In the morning it was incubated with 30 .mu.l of
the appropriate rabbit serum in 3% BSA in TBS for 2 hours at room
temperature. It was then washed in 20 mM Tris, 500 mM NaCl, 0.05% Tween
20, pH 7.5 for 30 minutes and incubated with alkaline phosphatase
conjugated antirabbit (1:1000) (Sigma) for 1 hour at room temperature. It
was washed again and stained for 15 minutes at room temperature in a
freshly prepared and filtered mixture of equal volumes of naphthol AS-MX
phosphate (Sigma; 0.4 mg/ml in distilled water) and fast red TR salt
(Sigma; 6 mg/ml in 0.2M Tris, pH 8.2). Antibody intensity was compared by
eye with that of controls whose density had been measured previously with
a Joyce Loebl scanning densitometer. The results were classified as
positive or trace according to the criteria of Matthews, R. C. and Burnie,
J. P. (J. Clin. Micro., 26: 459-463 (1988).
Three groups of sera were examined. The Control sera came from patients who
had been screened for systemic candidiasis but where there was no clinical
or cultural evidence for the infection. The second group was patients who
were colonized at clinically significant sites (intravenous lines, wound,
faeces, urine and vagina) and where there was no evidence of
dissemination. The third group consisted of either suspected or proven
cases. In the suspected cases a clinically significant pyrexia resolved on
systemic amphotericin B therapy. The patients were neutropenic and
although some cultures were positive for Candida albicans this was
insufficient to prove the infection. In the proven cases there was either
cultural and histological evidence from a deep site at autopsy or two sets
of positive blood cultures taken from separate sites on two different
occasions during life.
The sera were examined against antibody raised against the peptide
STDEPAGESA (SEQ ID NO:4) or the peptide LKVIRKNIVKKMIE (SEQ ID NO:7). The
former detected (trace or positive response) 90.4% of cases. The latter
detected 88.2% of proven and all the suspected cases. There was also a
positive response in four patients where a localized infection required
treatment with systemic amphotericin B. Both antibodies detected
circulating candidal antigen specific to disseminated candidiasis.
______________________________________
Results of Dot-Blotting
Nil Trace Positive
______________________________________
1. Antibody against STDEPAGESA
(SEQ ID NO. 4)
Controls 65
Colonized 6 1
Systemically infected
2 8 11
(proven)
2. Antibody against LKVIRKNIVKKMIE
(SEQ ID NO. 7)
Controls 404
Colonized 10 5 .sup. 4.sup.a
Systemically infected
(proven) 6 9 36
(suspected) 4 6
______________________________________
.sup.a required systemic therapy for N line infection (1), urinary tract
infection (2) and wound infection (1) with amphotericin B.
EXAMPLE 3
A murine monoclonal antibody was raised against LKVIRKNIVKKMIE-Cys-KLH (SEQ
ID NO:8) (see Example 2). Balb/c and CBA.times.Balb/c F1 mice were
injected subcutaneously with 50 .mu.g of immunogen in sterile complete
Freund's Adjuvant and thereafter at intervals of 14 days,
intraperitoneally with 50 .mu.g immunogen in Incomplete Freund's Adjuvant
until seroconvertion.
Fusion was performed 4 days after a final immunization of 50 .mu.g
immunogen intravenously in sterile physiological saline. Fusion, hybridoma
screening, clonal selection and antibody analysis were performed according
to standard protocols, essentially as described by de St. Groth S. F. and
Scheidegger D., J. Immunol. Methods 35, 1-21 (1980). Selected hybridomas
were screened for activity against the C. albicans 47 Kd antigen by
immunoblotting against C. albicans. Positive hybridomas were re-cloned and
re-assayed.
A novel hybridoma cell line (CA-STR7-1) was produced which recognised both
the C. albicans 47 Kd antigen and the antigen of approximately 92 Kd on
immunoblots of C. albicans grown at 37.degree. C., in both the yeast and
mycelial forms. At 23.degree. C. the 47 Kd antigen was visible but not the
92 Kd antigen with this monoclonal antibody.
EXAMPLE 4
A monoclonal antibody was raised against the peptide STDEPAGESA (SEQ ID
NO:4) using the method of Example 3, and was used in a mouse model to
determine whether it had a protective effect against challenge with a
lethal dose of C. albicans. The mouse model was as follows:
Male Balb C mice of average weight 2.5 g were injected i.v. with dilutions
of a standardized batch of frozen C. albicans. The injected volume was 100
.mu.l via the lateral tail vein. The following mortality was observed at
the doses and times shown:
______________________________________
Mortality at
Dose 18 hrs 24 hrs n
______________________________________
5 + 10.sup.8 cells
89% 100% 54
1 + 10.sup.8 cells
76% 100% 48
5 + 10.sup.7 cells
0% 0% 24
______________________________________
The viability of injected cells from frozen aliquats was 30% and therefore
the dose could be adjusted downwards.
A challenge of 1.times.10.sup.8 C. albicans cells was used as described
above in mice which had been pre-treated with the antibody against
STDEPAGESA (SEQ ID NO:4) by prior injection as follows:
______________________________________
Mortality at "Protective" Agent
n 24 hrs 48 hrs injected volume
______________________________________
STDEPFAESA
6 66% 83.3% 0.2 ml 1 hr prior to
(SEQ ID NO. 4) challenge
Mab L2 6 100% -- 0.2 ml 1 hr prior to
challenge
Patient 1 6 50% 50% 0.5 ml 30 min prior to
challenge
Patient 2 7 42.8% 42.8% 0.5 ml 30 min prior to
challenge
5 40% 40% 0.5 ml 30 min prior to
challenge
Normal Human
6 100% -- 0.5 ml 30 min prior to
Serum challenge
IG fraction
6 50% 66% 0.5 ml 30 min prior to
Patient 2 challenge
IG fraction
6 100% -- 0.5 ml 30 min prior to
normal human challenge
serum
______________________________________
"Patient 1" and "Patient 2" was serum from patients who developed systemic
Canidada infections, developed an antibody response and recovered.
"IG fraction" was an immunoglobulin fraction obtained by 50% ammonium
sulphate precipitation, dialysed overnight v PBS and resuspended in the
same volume as the original serum.
Mab L2 was an irrelevant IgG antibody.
Conclusion
The monoclonal antibody raised against STDEPAGESA (SEQ ID NO:4) produced
33% survival at 24 hrs in animals challenged with a lethal dose of C.
albicans, whereas the irrelevant IgG and normal human serum produced no
protection. The serum from the previously infected patients produced 55%
protection at 24 hrs.
__________________________________________________________________________
SEQUENCE LISTING
(1) GENERAL INFORMATION:
(iii) NUMBER OF SEQUENCES: 10
(2) INFORMATION FOR SEQ ID NO:1:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 395 amino acids
(B) TYPE: amino acid
(C) STRANDEDNESS: single
(D) TOPOLOGY: linear
(ii) MOLECULE TYPE: peptide
(xi) SEQUENCE DESCRIPTION: SEQ ID NO:1:
GluPheArgAlaIleLeuPheValProLysArgAlaProPheAspAla
151015
PheGluSerLysLysLysLysAsnAsnIleLysLeuTyrValArgArg
202530
ValPheIleThrAspAspAlaGluGluLeuIleProGluTrpLeuSer
354045
PheIleLysGlyValValAspSerGluAspLeuProLeuAsnLeuSer
505560
ArgGluMetLeuGlnGlnAsnLysIleLeuLysValIleArgLysAsn
65707580
IleValLysLysMetIleGluThrPheAsnGluIleSerGluAspGln
859095
GluGlnPheAsnGlnPheTyrThrAlaPheSerLysAsnIleLysLeu
100105110
GlyIleHisGluAspAlaGlnAsnArgGlnSerLeuAlaLysLeuLeu
115120125
ArgPheTyrSerThrLysSerSerGluGluMetThrSerLeuSerAsp
130135140
TyrValThrArgMetProGluHisGlnLysAsnIleTyrTyrIleThr
145150155160
GlyGluSerIleLysAlaValGluLysSerProPheLeuAspAlaLeu
165170175
LysAlaLysAsnPheGluValLeuPheMetValAspProIleAspGlu
180185190
TyrAlaMetThrGlnLeuLysGluPheGluAspLysLysLeuValAsp
195200205
IleThrLysAspPheGluLeuGluGluSerAspGluGluLysAlaAla
210215220
ArgGluLysGluIleLysGluTyrGluProLeuThrLysAlaLeuLys
225230235240
AspIleLeuGlyAspGlnValGluLysValValValSerTyrLysLeu
245250255
ValAspAlaProAlaAlaIleArgThrGlyGlnPheGlyTrpSerAla
260265270
AsnMetGluArgIleMetLysAlaGlnAlaLeuArgAspThrThrMet
275280285
SerSerTyrMetSerSerLysLysThrPheGluIleSerProSerSer
290295300
ProIleIleLysGluLeuLysLysLysValGluThrAspGlyAlaGlu
305310315320
AspLysThrValLysAspLeuThrThrLeuLeuPheAspThrAlaLeu
325330335
LeuThrSerGlyPheThrLeuAspGluProSerAsnPheAlaHisArg
340345350
IleAsnArgLeuIleAlaLeuGlyLeuAsnIleAspAspAspSerGlu
355360365
GluThrAlaValGluProGluAlaThrThrThrAlaSerThrAspGlu
370375380
ProAlaGlyGluSerAlaMetGluGluValAsp
385390395
(2) INFORMATION FOR SEQ ID NO:2:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 1200 base pairs
(B) TYPE: nucleic acid
(C) STRANDEDNESS: single
(D) TOPOLOGY: linear
(ii) MOLECULE TYPE: DNA (genomic)
(xi) SEQUENCE DESCRIPTION: SEQ ID NO:2:
GAATTCAGAGCTATCTTGTTTGTTCCAAAGAGAGCTCCATTTGATGCCTTTGAATCCAAG60
AAGAAGAAGAACAACATCAAATTATACGTCCGTAGAGTGTTTATCACTGATCATGCTGAA120
GAGTTGATTCCAGAATGGTTAAGTTTCATCAAGGGGGTTGTCGATTCCGAAGACTTGCCA180
TTGAACTTGTCCAGAGAAATGTTGCAACAAAACAAGATTTTGAAAGTTATCAGAAAGAAC240
ATTGTCAAAAAGATGATTGAAACTTTCAATGAAATCTCTGAAGACCAAGAGCAATTCAAC300
CAATTCTACACTGCTTTCTCCAAGAACAYCAAAYYHHHYAYYCAYHAAHAYHCYCAAAAC360
AGACAATCTTTGGCTAAATTGTTGAGATTCTACTCTACCAAATCTTCTGAAGAAATGACT420
TCCTTGTCTGACTACGTTACTAGAATGCCAGAACACCAAAAGAATATCTACTACATCACT480
GGTGAATCCATCAAAGCCGTTGAAAAATCACCATTCTTGGATGCCTTGAAAGCTAAGAAC540
TTTGAAGTCTTGTTCATGGTGGATCCAATCGATGAATATGCCATGACTCAATTGAAGGAA600
TTTGAAGACAAGAAATTGGTTGATATTACCAAAGACTTTGAATTGGAAGAAAGTGACGAA660
GAAAAAGCTGCTAGAGAAAAGGAAATCAAAGAATACGAACCATTGACCAAAGCTTTGAAA720
GATATTCTTGGTGSTCAAGTTGAAAAAGTTGTTGTTTCCTACAAACTTGTTGATGCTCCA780
GCTGCCATTSGAACTGGTCAATTTGGTTGGTCTGCCAATATGGAAAGAATCATGAAGGCT840
CAAGCTTTGAGAGACACCACCATGTCTTCTTACATGTCCTCTAAGAAGACCTTTGAAATT900
TCTCCATCTTCCCCAATTATCAAGGAATTCAAGAAGAAAGTTGAAACCGATGGAGCTGAA960
GACAAGACCGTTAAGGACTTGACCACTTTGTTGTTTGATACTGCATTGTTGACTTCTGGT1020
TTCACCTTGGACGAACCATCCAACTTTGCCCACAGAATTAACAGATTGATTGCCTTGGGA1080
TTGAATATTGACGATGATTCAGAAGAAACTGCTATTGAACCTGAAGCTACTACTACTGCC1140
TCAACTGACGAACCAGCTGGAGAATCTGCTATGGAAGAAGTTGATTAAACACCAGAAGGG1200
(2) INFORMATION FOR SEQ ID NO:3:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 394 amino acids
(B) TYPE: amino acid
(D) TOPOLOGY: linear
(ii) MOLECULE TYPE: peptide
(xi) SEQUENCE DESCRIPTION: SEQ ID NO:3:
GluPheArgAlaIleLeuPheIleProLysArgAlaProPheAspLeu
151015
PheGluSerLysLysLysLysAsnAsnIleLysLeuTyrValArgArg
202530
ValPheIleThrAspGluAlaGluAspLeuIleProGluTrpLeuSer
354045
PheValLysGlyValValAspSerGluAspLeuProLeuAsnLeuSer
505560
ArgGluMetLeuGlnGlnAsnLysIleLeuLysValIleArgLysAsn
65707580
IleValLysLysLeuIleGluAlaPheAsnGluIleAlaGluAspSer
859095
GluGlnPheGluLysPheTyrSerAlaPheSerLysAsnIleLysLeu
100105110
GlyValHisGluAspThrGlnAsnArgAlaAlaLeuAlaLysLeuLeu
115120125
ArgTyrAsnSerThrLysSerValAspGluLeuThrSerLeuSerAsp
130135140
TyrValThrArgMetProGluHisGlnLysAsnIleTyrTyrIleThr
145150155160
GlyGluSerLeuLysAlaValGluLysSerProPheLeuAspAlaLeu
165170175
LysAlaLysAsnPheGluValLeuPheLeuThrAspProIleAspGlu
180185190
TyrAlaPheThrGlnLeuLysGluPheGluAspLysThrLeuValAsp
195200205
IleThrLysAspPheGluLeuGluGluThrAspGluGluLysAlaGlu
210215220
ArgGluLysGluIleLysGluTyrGluProLeuThrLysAlaLeuLys
225230235240
GluIleLeuGlyAspGlnValGluLysValValValSerTyrLysLeu
245250255
LeuAspAlaProAlaAlaIleArgThrGlyGlnPheGlyTrpSerAla
260265270
AsnMetGluArgIleMetLysAlaGlnAlaLeuArgAspSerSerMet
275280285
SerSerTyrMetSerSerLysLysThrPheGluIleSerProLysSer
290295300
ProIleIleLysGluLeuLysLysArgValAspGluGlyGlyAlaGln
305310315320
AspLysThrValLysAspLeuThrLysLeuLeuTyrGluThrAlaLeu
325330335
LeuThrSerGlyPheSerLeuAspGluProThrSerPheAlaSerArg
340345350
IleAsnArgLeuIleSerLeuGlyLeuAsnIleAspGluAspGluGlu
355360365
ThrGluThrAlaProGluAlaSerThrAlaAlaProValGluGluVal
370375380
ProAlaAspThrGluMetGluGluValAsp
385390
(2) INFORMATION FOR SEQ ID NO:4:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 10 amino acids
(B) TYPE: amino acid
(D) TOPOLOGY: linear
(ii) MOLECULE TYPE: peptide
(xi) SEQUENCE DESCRIPTION: SEQ ID NO:4:
SerThrAspGluProAlaGlyGluSerAla
1510
(2) INFORMATION FOR SEQ ID NO:5:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 5 amino acids
(B) TYPE: amino acid
(D) TOPOLOGY: linear
(ii) MOLECULE TYPE: peptide
(xi) SEQUENCE DESCRIPTION: SEQ ID NO:5:
LeuSerArgGluMet
15
(2) INFORMATION FOR SEQ ID NO:6:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 6 amino acids
(B) TYPE: amino acid
(D) TOPOLOGY: linear
(ii) MOLECULE TYPE: peptide
(xi) SEQUENCE DESCRIPTION: SEQ ID NO:6:
LeuLysValIleArgLys
15
(2) INFORMATION FOR SEQ ID NO:7:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 14 amino acids
(B) TYPE: amino acid
(D) TOPOLOGY: linear
(ii) MOLECULE TYPE: peptide
(xi) SEQUENCE DESCRIPTION: SEQ ID NO:7:
LeuLysValIleArgLysAsnIleValLysLysMetIleGlu
1510
(2) INFORMATION FOR SEQ ID NO:8:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 14 amino acids
(B) TYPE: amino acid
(D) TOPOLOGY: linear
(ii) MOLECULE TYPE: peptide
(xi) SEQUENCE DESCRIPTION: SEQ ID NO:8:
LeuLysValArgLysAsnIleValLysLysMetIleGluCys
1510
(2) INFORMATION FOR SEQ ID NO:9:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 11 amino acids
(B) TYPE: amino acid
(D) TOPOLOGY: linear
(ii) MOLECULE TYPE: peptide
(xi) SEQUENCE DESCRIPTION: SEQ ID NO:9:
CysSerThrAspGluProAlaGlyGluSerAla
1510
(2) INFORMATION FOR SEQ ID NO:10:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 11 amino acids
(B) TYPE: amino acid
(D) TOPOLOGY: linear
(ii) MOLECULE TYPE: peptide
(xi) SEQUENCE DESCRIPTION: SEQ ID NO:10:
CysLeuProLeuAsnLeuSerArgGluMetLeu
1510
__________________________________________________________________________
Top