Back to EveryPatent.com
United States Patent |
5,587,472
|
Dattagupta
,   et al.
|
December 24, 1996
|
Coumarin-labeled nucleoside 5'-triphosphates
Abstract
A fluorescent label compound having the formula
A--B.sup.1 --B.sup.2 --B.sup.3 --C
wherein
A represents the residue of a natural or synthetic nucleotide or nucleoside
or a derivative thereof;
B.sup.1 represents a divalent spacer radical or a single bond;
B.sup.2 represents a divalent spacer radical;
B.sup.3 represents a divalent spacer radical or a single bond; and
C represents a coumarin radical having the formula
##STR1##
in which R.sup.1 represents hydrogen or cyano;
R.sup.2 represents phenyl or thiazolyl bonded in the 2-, 4- or 5-position,
wherein the phenyl is unsubstituted or substituted by nitro, cyano, amino,
--NH--C.sub.1-4 -alkyl, --(CH.sub.2).sub.1-4 --NH.sub.2,
--(CH.sub.2).sub.1-4 --NH--(CH.sub.2).sub.1-3 --CH.sub.3, carboxy,
C.sub.1-4 -alkoxycarbonyl, C.sub.1-4 -alkoxycarbonyloxy, hydroxy,
C.sub.1-4 -alkylaminocarbonyl, or C.sub.1-4 -alkylcarbonylamino and either
further unsubstituted or substituted by C.sub.1-4 -alkyl, fluorine,
chlorine or bromine, and where the thiazolyl is unsubstituted or
monosubstituted or disubstituted by chlorine, cyano, carboxyl, or
C.sub.1-4 -alkoxycarbonyl, or the thiazolyl is fused in the 4- and
5-position with a benzene ring which is either unsubstituted or
substituted by carboxyl, amino, or hydroxyl;
R.sup.3 represents hydrogen, C.sub.1-4 -alkyl, C.sub.1-4
-alkoxycarbonyl-C.sub.1-4 -alkyl, or phenylsulphonyl, where the C.sub.1-4
-alkyl is unsubstituted or substituted by hydroxyl, amino, carboxyl, or
C.sub.1-4 -alkoxycarbonyl, and where the phenylsulphonyl is unsubstituted
or monosubstituted or disubstituted by chlorine, bromine, or C.sub.1-4
-alkyl;
or where one of the radicals R.sup.2 or R.sup.3 denotes or is substituted
by a primary or secondary amino group, hydroxyl, carboxyl, or C.sub.1-4
-alkoxycarbonyl, or can be converted into such a group by hydrolysis or
hydrogenation.
Inventors:
|
Dattagupta; Nanibhushan (San Diego, CA);
Kocher; Jurgen (West Haven, CT)
|
Assignee:
|
Bayer Corporation (Tarrytown, NY)
|
Appl. No.:
|
460027 |
Filed:
|
June 2, 1995 |
Current U.S. Class: |
536/26.2; 536/24.31; 536/24.32 |
Intern'l Class: |
C07H 019/10; C07H 019/20; C07H 021/04 |
Field of Search: |
536/24.31,24.32,26.2
|
References Cited
U.S. Patent Documents
4472301 | Sep., 1984 | Buckler et al. | 435/7.
|
4617261 | Oct., 1986 | Sheldon, III et al. | 435/6.
|
4711955 | Dec., 1987 | Ward et al. | 536/29.
|
4828979 | May., 1989 | Klevan | 435/6.
|
4857455 | Aug., 1989 | Khanna et al. | 435/7.
|
4948882 | Aug., 1990 | Ruth | 536/27.
|
5015733 | May., 1991 | Smith et al. | 536/23.
|
5026840 | Jun., 1991 | Dattagupta et al. | 536/27.
|
5124247 | Jun., 1992 | Ansorge | 435/6.
|
5300656 | Apr., 1994 | Kuckert et al. | 549/288.
|
Foreign Patent Documents |
2030243 | May., 1991 | CA.
| |
0063879 | Mar., 1982 | EP.
| |
0429907 | Nov., 1990 | EP.
| |
4026613 | Feb., 1992 | DE.
| |
Other References
Nucleosides & Nucleotides, 8 (5&6), pp. 1161-1163 (1989).
Nucleic Acids Research, vol. 18, No. 19, pp. 5843-5851 (1990).
Proc. Nat. Acad. Sci. USA, vol. 71, No. 9, pp. 3537-3541 (1974).
Archives of Biochemistry and Biophysics 178, pp. 8-18, (1977).
Analytical Biochemistry, 177, pp. 85-89, (1989).
Langer et al., Proc. Natl. Acad. Sci., 78(11): 6633-6637, 1981.
Chemical Abstracts, vol. 114, 1991, Columbus, Ohio, US; abstract No.
185914q, S. V. Chekalin et al. `Laser Fentosecond MPI Mass Spectroscopy of
Dye-Labeled Nucleotides.`, p. 835; col. 1.
IEEE J. Quantum Electron. vol. 26, No. 12, 1990, pp. 2158-2161.
Chemical Abstracts Formula Index, vol. 114, 1991, Formulas C24-Z p. 3298F,
formula C24H28N709PS; *Adenosine, 5'(S-(2-((2-((4-methyl-2-oxo-2
H-1-benopyran-7-yl)amino)ethyl)amino)-2-oxoethyl) hydrogen
phosphorothioate), (133395-32-1), 185914q *Guanosine,
5'-(S-(2-((2-((4-methyl-2-oxo-oxoethyl) hydrogen phosphorothioate),
(133395-33-2), 1895914q*.
|
Primary Examiner: Kunz; Gary L.
Attorney, Agent or Firm: Sprung Horn Kramer & Woods
Parent Case Text
This application is a continuation of application Ser. No. 07/799,470,
filed Nov. 26, 1991, now abandoned, which application is a
continuation-in-part of U.S. application Ser. No. 07/744,555 filed Aug.
13, 1991, now abandoned.
Claims
What is claimed is:
1. A fluorescent label compound having the formula:
A--B.sup.1 --B.sup.2 --B.sup.3 --C
wherein
A represents a radical selected from the group consisting of dATP-8-yl and
dUTP-5-yl;
B.sup.1 --B.sup.2 --B.sup.3 collectively represent a spacer moiety selected
from the group consisting of:
--CH.dbd.CH--CH.sub.2 --NH--CO--(CH.sub.2).sub.5 --NH--CO--(CH.sub.2).sub.3
--a
and
--NH--(CH.sub.2).sub.6 --NH--CO--(CH.sub.2).sub.5
--NH--CO--(CH.sub.2).sub.3 --a
wherein
"a" represents the point of attachment to A; and
C represents a coumarin radical having the formula:
##STR26##
2. The fluorescent compound according to claim 1 having the formula
##STR27##
3. The fluorescent label compound according to claim 1 having the formula
##STR28##
4. In a test for the presence of a particular nucleic acid sequence in a
sample, wherein the sample is subjected to a labeled probe under
hybridizing conditions and the sample is thereafter assayed for
hybridization product, the improvement wherein the probe is labeled with a
fluorescent label compound according to claim 1.
5. A diagnostic kit for use in detecting the presence of a particular
nucleic acid sequence in a sample, said kit comprising a fluorescent label
compound according to claim 1.
Description
BACKGROUND OF THE INVENTION
1. Field of the Invention
The present invention relates to a novel fluorescent label compound, which
can be enzymatically incorporated into a nucleic acid. The labeled nucleic
acid can be used to detect the presence of a DNA or RNA sequence of
interest in a sample nucleic acid.
2. Description of the Related Art
The technique of hybridization of a labeled oligonucleotide to a sample DNA
to afford sequence-specific nucleic acid detection has become a powerful
tool in analytical molecular biology. Initially, labeling was accomplished
mainly with radioactive isotopes. However, radioactive labeled probes
typically have the disadvantage of instability, low resolution, and all
the pitfalls of handling radioisotopes. In order to circumvent labeling
with radioactive isotopes, a number of methods have been recently
developed for non-radioactive labeling and detection.
For example, K. Muhlegger et al., "Synthesis and Use of New
Digoxigenin-Labeled Nucleotides in Non-Radioactive Labeling and
Detection-Labeled Nucleic Acids", Nucleosides & Nucleotides, 8 (5 & 6),
pp. 1161-1163 (1989), describe the chemical synthesis and incorporation
into DNA of novel digoxigenin-derivatized
5-aminoallyl-2'-deoxyuridine-5'-triphosphates. Hybridization and
subsequent detection by ELISA technique allows the detection of homologous
DNA down to 0.1 pg.
Hans-Joachim Holtke et al., "Non-Radioactive Labeling of RNA Transcripts In
Vitro with the Hapten Digoxigenin (DIG); Hybridization and ELISA-Based
Detection", Nucleic Acids Research, 18 (19), pp. 5843-5851 (1990),
describe an alternative method for labeling nucleic acid probes with the
cardenolide digoxigenin. However, the detection of digoxigenin
disadvantageously requires a secondary reagent, such as an antibody linked
to an enzyme.
EP-A2-63879 describes chemically stable new nucleotide derivatives that
contain biotin, imino-biotin, lipoic acid and other determinants attached
covalently to the pyrimidine or purine ring and their synthesis. These
compounds will interact specifically and uniquely with proteins such as
avidin or antibodies. This can be utilized for the detection and
localization of nucleic acid components.
U.S. Pat. No. 4,617,261 discloses non-radioactive labeling reagents
consisting of an alkylating intercalation moiety, such as a psoralen
moiety, a divalent linker, and a monovalent label moiety, like biotin.
These reagents are used to label nucleic acids.
Finally, Dirks et al., Experimental Cell Research, 194, pp. 310-315 (1991),
describe the use of fluorescein-, digoxigenin- and biotin -(di)deoxyXTPs
and terminal deoxynucleotidyl transferase for small scale labeling of
synthetic oligonucleotides for use as probes in the in situ detection of
multiple RNA sequences. Apparently, Boehringer Mannheim has now made
available fluorescein-12 -dUTP for this purpose. See, BM Biochemica, 8
(5), p. 15 (September 1991).
Despite these known methods, there continues to exist a need for labels for
nucleic acids which are easy to obtain, easy to incorporate into nucleic
acid probes, and easy to detect.
SUMMARY OF THE INVENTION
To meet this need there has now been developed a novel fluorescent label
compound having the formula
A--B.sup.1 --B.sup.2 --B.sup.3 --C
wherein
A represents the residue of a natural or synthetic nucleotide or nucleoside
or a derivative thereof;
B.sup.1 represents a divalent spacer radical or a single bond;
B.sup.2 represents a divalent spacer radical;
B.sup.3 represents a divalent spacer radical or a single bond; and
C represents a coumarin radical having the formula
##STR2##
in which R.sup.1 represents hydrogen or cyano;
R.sup.2 represents phenyl or thiazolyl bonded in the 2-, 4- or 5-position,
wherein the phenyl is unsubstituted or substituted by nitro, cyano, amino,
--NH--C.sub.1-4 -alkyl, --(CH.sub.2).sub.1-4 --NH.sub.2,
--(CH.sub.2).sub.1-34 --NH--(CH.sub.2).sub.1-3 --CH.sub.3, carboxy,
C.sub.1-4 -alkoxycarbonyl, C.sub.1-4 -alkoxycarbonyloxy, hydroxy,
C.sub.1-4 -alkylaminocarbonyl, or C.sub.1-4 -alkylcarbonylamino and either
further unsubstituted or substituted by C.sub.1-4 -alkyl, fluorine,
chlorine or bromine, and where the thiazolyl is unsubstituted or
monosubstituted or disubstituted by chlorine, cyano, carboxyl, or
C.sub.1-4 -alkoxycarbonyl, or the thiazolyl is fused in the 4- and
5-position with a benzene ring which is either unsubstituted or
substituted by carboxyl, amino, or hydroxyl;
R.sup.3 represents hydrogen, C.sub.1-4 -alkyl, C.sub.1-4
-alkoxycarbonyl-C.sub.1-4 -alkyl, or phenylsulphonyl, where the C.sub.1-4
-alkyl is unsubstituted or substituted by hydroxyl, amino, carboxyl, or
C.sub.1-4 -alkoxycarbonyl, and where the phenylsulphonyl is unsubstituted
or monosubstituted or disubstituted by chlorine, obromine, or C.sub.1-4
-alkyl;
it also being possible that one of the radicals R.sup.2 or R.sup.3 denotes
or is substituted by a primary or secondary amino group, hydroxyl,
carboxyl, or C.sub.1-4 -alkoxycarbonyl, or can be converted into such a
group by hydrolysis or hydrogenation.
Because the novel fluorescent label compound comprises the residue of a
natural or synthetic nucleotide or nucleoside or a derivative thereof, the
novel fluorescent label can be easily incorporated into nucleic acids
enzymatically using enzymes such as terminal transferase and DNA and RNA
polymerases. (The use of DNA or RNA polymerases will usually require a
primer and template according to the conventional methods). Moreover,
because the novel fluorescent label compound also comprises a coumarin
fluorescent dyestuff residue, the novel fluorescent label fluoresces,
thereby giving a visual signal indicative of the presence in a nucleic
acid sample of a nucleic acid sequence of interest.
The invention, thus, also comprises a test for the presence of a particular
nucleic acid sequence in a sample, wherein the sample is subjected to a
labeled probe under hybridizing conditions and the sample is thereafter
assayed for hybridization product, the improvement wherein the probe is
labeled with the novel fluorescent label compound.
The invention further comprises a diagnostic test kit for use in the
detection of a particular nucleic acid sequence in a sample, the kit
comprising the novel fluorescent label compound.
DETAILED DESCRIPTION OF THE INVENTION
In the novel fluorescent label compound having the forementioned formula,
the residue A preferably represents the residue of a natural or synthetic
nucleotide selected from the group consisting of AMP, ADP, ATP, GMP, GDP,
GTP, CMP, CDP, CTP, UMP, UDP, UTP, TMP, TDP, TTP, 2Me AMP, 2Me ADP, 2Me
ATP, 1Me GMP, 1Me GDP, 1Me GTP, 5Me CMP, 5Me CDP, 5Me CTP, 5MeO CMP, 5MeO
CDP, 5MeO CTP, deoxy-, dideoxy-nucleotides thereof, and other derivatives
thereof.
B.sup.1, B.sup.2 and B.sup.3 preferably independently or collectively
represent a spacer chain of up to about 50 atoms selected from carbon,
hydrogen, oxygen, nitrogen, and sulfur, it also being possible for B.sup.1
or B.sup.3 to represent a single bond. More particularly, B.sup.1, B.sup.2
and B.sup.3 independently or collectively represent a spacer chain of
about 2-20 atoms selected from carbon, hydrogen, oxygen, nitrogen, and
sulfur, it also being possible for B.sup.1 or B.sup.3 to represent a
single bond.
For example, such spacer has a chain length between the radicals A and C of
up to about 50 atoms, not taking into account the possibility of branches.
Such spacer may be the polyfunctional radical of a peptide; hydrocarbon,
such as an alkylene, an alkenylene, an alkynylene, an arylene, and
substituted derivatives thereof; polyalcohol; polyalkoxide; polyether;
polyamine; polyimine; carbohydrate, --C.dbd.CH--CH.sub.2 --NH--;
--glycyl--glycyl--glycyl--; --NH(CH.sub.2).sub.5 --CO--; the radical of
spermine; the radical of spermidine; --NH--(CH.sub.2).sub.6 --NH--; or
--NH--CH.sub.2 --CH.sub.2 --NH--; --CH.dbd.CH--CH.sub.2
--NH--CO--(CH.sub.2).sub.5 --NH--CO--(CH.sub.2).sub.3 ;
--NH--(CH.sub.2).sub.6 --NH--CO--(CH.sub.2).sub.5
--NH--CO--(CH.sub.2).sub.3 --.
The coumarin radical is preferably selected from among those having the
forementioned formula wherein R.sup.2 represents phenyl or thiazolyl
bonded in the 2-, 4- or 5-position, where phenyl is unsubstituted or
substituted by carboxyl, C.sub.1-4 -alkylcarbonyloxy, amino,
--NH--C.sub.1-4 -alkyl, --(CH.sub.2).sub.1-4 --NH.sub.2, C.sub.1-4 -alkyl,
cyano, fluorine, chlorine, or bromine, and where thiazolyl is
unsubstituted or substituted by chlorine, cyano, or carboxyl, or the
thiazolyl is fused in the 4- and 5-position with a benzene ring which is
either unsubstituted or substituted by carboxyl or amino; R.sup.3
represents hydrogen, methyl, ethyl, --(CH.sub.2).sub.1-4 --OH,
--(CH.sub.2).sub.1-4 --NH.sub.2, or --(CH.sub.2).sub.1-4 --COOH; it also
being possible that one of the radicals R.sup.2 and R.sup.3 denotes or is
substituted by a primary or secondary amino group, hydroxyl, carboxyl, or
C.sub.1-2 -alkoxycarbonyl.
Particularly preferred are coumarin radicals having the forementioned
formula, wherein R.sup.2 represents phenyl or thiazolyl bonded in the
2-position, where phenyl is unsubstituted or substituted by para-carboxyl,
para-amino, para-NH-C.sub.1-4 -alkyl, para-CH.sub.2 --NH.sub.2, cyano,
methyl, or ethyl, and where thiazolyl is unsubstituted or substituted by
chlorine, cyano, or carboxyl, or the thiazolyl is fused in the 4-and
5-position with a benzene ring which is either unsubstituted or
substituted by carboxyl or amino; it also being possible that one of the
radicals R.sup.2 and R.sup.3 denotes or is substituted by a primary or
secondary amino group, hydroxyl, or carboxyl.
Preferably, as an example, the fluorescent label compound is the compound
having the formula:
##STR3##
or the compound having the formula
##STR4##
The novel fluorescent label compounds can be prepared by any of a number of
well known methods of preparation. In general, they will be "built" from
the coumarin dyestuff component and the nucleotide or nucleoside
component, both of which will possess a site that can be derivatized. The
derivatizable sites on the two components will then be chemically linked
by the spacer.
For example, the novel fluorescent label compounds according to the present
invention can be prepared as follows:
(1) reacting a compound of the formula A--Z with a compound of the formula
L--B.sup.11 --M to form A--B.sup.1 --H wherein Z represents e.g., hydrogen
or bromine, L represents a reactive double bond or an amino group, M
represents an amino group. The product obtained will have the formula
A--C.dbd.C--B.sup.11 --NR--H or A--NR--B.sup.11 --NR--H, wherein R
represents hydrogen, alkyl, or phenyl, the moieties --C.dbd.C--B.sup.11
--NHR-- and --NHR--B.sup.11 --NHR-- constituting B.sup.1 ; or
(2) if B.sup.1 is a single bond, reacting the compound A--Z with a compound
of the formula V--B.sup.22 --W to form A--B.sup.1 --B.sup.2 --H, wherein V
represents --COOR, R represents C.sub.1-4 -alkyl, and W for example
represents amino. In this instance, the product obtained has the formula
A--CO--B.sup.22 --NR--H, wherein R represents hydrogen, alkyl, or phenyl,
and the moiety --CO--B.sup.22 --NR-- represents the combination --B.sup.1
--B.sup.2 --; then
(3) if B.sup.3 is not a single bond, reacting a compound of the formula
C--Q with a compound of the formula X--B.sup.33 --Y to form C--B.sup.3
--OR, wherein Q represents, e.g., hydrogen, X represents COOR', R'
represents C.sub.1-4 -alkyl, and Y represents halogen, e.g., Br. In this
instance, the product obtained has the formula C--B.sup.33 --COOR, the
moiety --B.sup.33 --CO-- constituting B.sup.3 ; then
(4) reacting the product of step (1) with V--B.sup.22 --W and then with the
product of step (3) or, if B.sup.3 is a single bond, with C--Q; or
(5) reacting the product of step (2) with the product of step 3 or, if
B.sup.3 is a single bond, with C--Q.
See, e.g., P. R. Langer et al., Proc. Natl. Acad. Sci. USA, 78, 6633
(1981); DE 4,026,613; and H. Heitzmann and F. M. Richards, Proc. Natl.
Acad. Sci. USA, 71, p. 3537 (1974).
The coumarin compounds of the formula C--Q can be prepared by
(a) reacting an m-aminophenol of the formula
##STR5##
in which R.sup.3 and Q have the forementioned meanings, with a
formylacetic acid derivative of the formula
##STR6##
in which R.sup.2 has the forementioned meaning and R.sup.5 represents
cyano, C.sub.1-4 -alkoxycarbonyl, or carboxyl;
provided that wherein if R.sup.5 =CN, first an imino derivative of the
formula
##STR7##
is formed and this imino derivative is hydrolyzed with elimination of the
imino group; or
(b) reacting a salicylaldehyde of the formula
##STR8##
in which R.sup.3 and Q have the forementioned meanings with an acetic acid
derivative of the formula
##STR9##
in which R.sup.2 has the forementioned meaning and R.sup.6 represents
cyano, C.sub.1-4 -alkoxycarbonyl, or carboxyl;
provided that wherein if R.sup.6 =CN, first an imino derivative of the
formula
##STR10##
is formed and this imino derivative is hydrolyzed with elimination of the
imino group; or
(c) in the case where R.sup.1 denotes cyano, the intermediate or product in
(a) and (b) is reacted with cyanide ions to give the imino-cyano
intermediate of the formula
##STR11##
or the cyano intermediate of the formula
##STR12##
wherein in each R.sup.2, R.sup.3 and Q have the forementioned meanings and
this intermediate is oxidized to the cyanocoumarin derivative and
optionally additionally hydrolyzed.
Details of process parameters for the preparation of the coumarin starting
materials are detailed in U.S. Ser. No. 07/610,864, the disclosure of
which is incorporated herein by reference.
The starting materials L--B.sup.11 --M, V--B.sup.22 --W, and X--B.sup.33
--Y are very well known products.
The starting materials, A--Z, are well-known to those of ordinary skill in
the art and are commercially available.
The novel fluorescent label compounds according to the present invention
can be incorporated into nucleic acids using techniques well-known to
those of ordinary skill in the art. For example, if desired, the novel
fluorescent label compound could be incorporated into a nucleic acid
sequence by subjecting the probe sequence to the novel fluorescent label
compound in the presence of terminal transferase. The novel fluorescent
label compound should thereby be incorporated at the end of the then
existing nucleic acid probe sequence and without the requirement for a
template.
Such labeled nucleic acid probe can be Used to detect the presence of a
nucleic acid sequence of interest in a nucleic acid sample. The labeled
nucleic acid is applicable to all conventional hybridization assay formats
and, in general, to any format that is possible based on formation of a
hybridization product or aggregate comprising the labeled nucleic acid.
Such formats are well-known to those of ordinary skill in the art.
Like other coumarin dyestuffs, the novel fluorescent label compounds
according to the present invention are strong dyes and possess excellent
light fastness properties. As such, nucleic acids labeled with the novel
fluorescent label compound according to the invention can be usually
detected visually and at low concentration.
The present invention will now be described with reference to the following
non-limiting examples.
EXAMPLE 1: Preparation of compound 3
##STR13##
has been prepared by converting the corresponding carboxylic acid 1
##STR14##
by known methods, as it is already described for the activation of biotin,
see e.g. H. Heitzmann and F. M. Richards, Proc. Natl. Acad. Sci. USA, 71,
3537 (1974). The carboxylic acid and its preparation has been described in
the patent application DE 4026613.
A solution of 500 mg 6-aminocaproic acid (3.45.times.10.sup.-3 mol) in 3 ml
H.sub.2 O, adjusted to pH 9 with 0.1 m Na.sub.2 CO.sub.3, is .added to a
solution of 50 mg of compound 2 (10.sup.-4 mol) in 50 ml DMF at room
temperature. A yellow material precipitates immediately. The reaction
mixture is stirred for 5 hours at room temperature. Thin layer
chromatography (TLC) indicates that the desired reaction has occurred
(Toluene/Methanol 5:4, Silicagel).
compound 1: r.sub.f (retention factor)=0.90
compound 1 after the hydrolysis of the NHS-ester: r.sub.f =0.29
new product compound 3: r.sub.f -0.25
The reaction mixture is evaporated to dryness under vacuum, and 15 ml
H.sub.2 O is added to the remaining yellow residue. The formed suspension
is adjusted to pH=1 with 8 N HCl and centrifuged. The supernatant, which
is almost colorless, is removed, and another 15 ml of H.sub.2 O is added
to resuspend the precipitate. The suspension is centrifuged and the
supernatant removed. After thorough vacuum drying of the precipitate, the
yield of compound 3 having the formula
##STR15##
is 43 mg (83%).
EXAMPLE 2: Preparation of compound 6
15.8 mg of compound 3 (3.times.10.sup.-5 mol) and 5 mg N-Hydroxysuccinimide
(5.05.times.10.sup.-5 mol) are dissolved in 3 ml DMF. To this solution,
10.7 mg Dicyclohexylcarbodiimide (5.19.times.10.sup.-5 mol), dissolved in
2 ml DMF, is added. The mixture is stirred at room temperature for about 7
hours, additional 27 mg solid N-Hydroxysuccinimide (2.7.times.10.sup.-4
mol) and 53 mg solid Dicyclohexylcarbodiimide (2.57.times.10.sup.-4) mol
are added to the reaction solution. After stirring for additional 17 hours
most of the carboxylic acid 3 has been converted to the
N-Hydroxysuccinimide ester 4 having the formula
##STR16##
according to TLC (Toluene/Methanol 5:4, Silicagel, r.sub.f of new compound
4 - 0.83).
A solution of 4.9 mg 5-allylamino-dUTP (compound 5 having the formula
##STR17##
8.times.10.sup.-6 mol), which is prepared according to P. R. Langer et
al., Proc. Natl. Acad. Sci. USA 78, 6633 (1981), in 7 ml H.sub.2 O is
adjusted to pH=9.4 with 0.1M Na.sub.2 CO.sub.3. The reaction mixture
containing the activated compound 4 (see above) is added to the
5-allylamino-dUTP-solution at room temperature. A yellow material
precipitates immediately. TLC can detect the new fluorescing nucleotide
(t-BuOH 3.5/acetone 2.5/ conc. NH.sub.3 /1.5 HOAc 1.5/H.sub.2 O 1,
cellulose, r.sub.f =0.72.)
The suspension is stirred for 4.5 hours at room temperature and evaporated
to dryness under vacuum. Consecutive chromatography of the residue on a
Sephadex G 10 column (Pharmacia) with H.sub.2 O as eluent gives 1.4 mg of
the compound 6 (16%), having the formula
##STR18##
EXAMPLE 3: Incorporation of compound 6 into an 18 mer oligonucleotide by
the enzyme terminal deoxynucleotidyl transferase
The fluorescing nucleotide 6 is incorporated into an 18 mer oligonucleotide
(sequence: CTC TAT TGA TTA CCA TGA) by terminal deoxynucleotidyl
transferase (Boehringer Mannheim) as follows: 5.9 .mu.g 18 mer
oligonucleotide (synthesized in an Applied Biosystems Inc. (Foster City,
Calif.)'s automated oligonucleotide synthesizer using their reagents) and
140 .mu.g compound 6 were dissolved in a reaction buffer containing 140
mmol/1K-cacodylate, mmol/1 Tris-buffer pH 7.6 1 mmol/1 CoCl.sub.2 and 0.1
mmol/1 dithiothreitol (DTT) (total volume 50 .mu.l). Enzymatic
incorporation was achieved by addition of 21 U terminal deoxynucleotidyl
transferase and incubation for 19 hours at 37.degree. C.
20% denaturing polyacrylamide gel electrophoresis (57 V/cm, 1 hour, buffer:
90 mM tris-borate, 1 mM EDTA, pH 8, at room temperature) showed a
fluorescent DNA band which can already be detected visually.
Electrophoresis of the same control mixture without incubation at
37.degree. C. results in no detectable fluorescent DNA. This indicates
that the new fluorescent nucleotide 6 is covalently incorporated into the
oligonucleotide and not just nonspecifically bound to it.
Ethidium bromide staining also indicates that an elongation of the
oligonucleotide has occurred.
EXAMPLE 4: Incorporation of compound 6 into a hairpin oligonucleotide by
the Klenow fragment of DNA polymerase
5 .mu.l 5 .times. reaction buffer (containing 650 mmol/1 potassium
phosphate pH=7.4, 32.5 mmol/1 MgCl.sub.2, 5 mmol/l DTT and 160 .mu.g/ml
BSA) and 5 .mu.l of a 5 .times. nucleosidetriphosphate mixture (containing
2.5 mmol/l of dATP, dCTP, dGTP and the fluorescing nucleotide 6 instead of
dTTP) are combined with 2 .mu.g of a 69 mer hairpin oligonucleotide
(sequence:
AGATTTTCTAGATTTCATCTTCCTCCCTATAGTGAGTCGTATTATTTTTTTTAATACGACTCACT ATAG,
synthesis as described in example 3) and 5.5 U of Klenow fragment of DNA
polymerase (total volume 25 .mu.l ). The mixture is incubated at
37.degree. C. for 50 minutes. 20% denaturing polyacrylamide gel
electrophoresis (experimental conditions see example 3) of the reaction
mixture indicates that incorporation of the fluorescing nucleotide 6 has
occurred because a fluorescent DNA band is visible. Gel electrophoresis of
the same mixture but without the enzyme does not result in a fluorescent
band. This indicates that the fluorescent nucleotide 6 is covalently
incorporated into the DNA and not nonspecifically bound.
EXAMPLE 5: Fluorescent nucleotides (comparison)
The following combinations of different nucleoside triphosphates and
fluorescent dyes have been synthesized.
--fluoresceine attached to 5-allylamino-dUTP (compound 7)
##STR19##
--fluorescamine derivative attached to 5-allylamino-dUTP (compound 8)
##STR20##
--fluoresceine derivative attached to 8-(6-aminohexylamino)-dATP (compound
9)
##STR21##
--fluorescamine derivative attached to 8-(6-aminohexylamino)-dATP
(compound 10)
##STR22##
--fluorescamine derivative attached to 8-(6-aminohexylamino)-ATP (compound
11)
##STR23##
Fluorescamine was purchased from Aldrich (Milwaukee, Wis.),
NHS-fluoresceine (5- and 6- isomer mixture) from Molecular Probes (Eugene,
Oreg.) and 8-(6-aminohexylamino)-ATP from Sigma (St. Louis, Mo.).
5-Allylamino-dUTP is obtained as described above and 8-(6-amino
hexylamino)-dATP is synthesized according to a procedure published by C.
-Y. Lee et al., Arch. Biochem. Biophys. 178, 8 (1977). The coupling of the
amino group containing nucleotides to fluorescamine (20 fold excess
compared to the nucleotide) is done in a mixture of acetone and 0.1 M
Na.sub.2 CO.sub.3 pH 10 at room temperature. After proving by TLC that the
reaction is complete, the reaction mixture is evaporated to dryness under
vacuum, and the residue is chromatographed on Sephadex G 10 (Pharmacia)
with water as eluent.
The coupling of NHS-fluoresceine to the nucleotides is done in Na.sub.2
CO.sub.3 -solution (pH 9-9.5). The purification is done in the same way as
described for the fluorescamine-conjugates.
The experiments described in example 3 are repeated with the above
mentioned fluorescing nucleotides. The results of the experiments with
these nucleotides 7-11 indicate no detectable incorporation of fluorescent
moiety into an oligonucleotide by terminal deoxynucleotidyl transferase as
it was described for the fluorescing nucleotide 6 in example 3.
Under the same conditions, 5-allylamino-dUTP can be incorporated 5-10
times, and 8-(6-aminohexylamino)-ATP is incorporable 1-2 times into an
oligonucleotide.
The experiment with compound 7 has been reinvestigated using different
concentrations. It has been found that this compound is also acceptable to
terminal deoxynucleotidyl transferase and can be incorporated into a
single-stranded oligonucleotide as is described in example 3. Important
for a successful experiment is the right concentration of compound 7 in
the reaction mixture. It could be shown that the incorporation rate is
higher at relatively low concentrations (smaller than 0.5 mmol/1), while
higher concentrations of the nucleotide 7 result in decreasing or
non-detectable incorporation.
EXAMPLE 6: Use of the product of example 4 for hybridization
The oligonucleotide described in example 4 can form a partial double
stranded structure before incorporation of any fluorescent dNTPs. The
single stranded part of the molecule is a specific sequence of major outer
membrane protein of chlamydia trachomitis.
The genomic DNA sample from chlamydia trachomitis is denatured in 0.5 M
NaOH and spotted onto a strip of nitrocellulose paper (Schleicher &
Schuell, Inc. Keene, N.H., U.S.A.). The paper is then soaked and rinsed in
an aqueous solution of 0.5 M Tris-HCl (pH 7.5) containing 1.5M NaCl. The
paper is then dried in a vacuum oven for 4 hours at 80.degree. C. The
paper is then prehybridized with the product of example 4 following a
procedure described by Dattagupta et al., Analytical Biochemistry, 177, 85
(1989). After hybridization fluorescence is detected either visually using
a hand held lamp or photographed in a similar fashion as polyacrylamide
gels. Appearance of fluorescence at the sample DNA spot is an indication
of positive results.
EXAMPLE 7: Preparation of compound 13
11.6 mg of compound 3 (2.2.times.10.sup.-5 mol), 22.6 mg
1-(3-dimethylaminopropyl)-3-ethylcarbodimide methiodide
(7.6.times.10.sup.-5 mol) and 16.2 mg N-hydroxysulfosuccinimide (sodium
salt, 7.5.times.10.sup.-5 mol) in 1 ml DMF are heated to 50.degree. C. for
7.5 hours. According to TLC (toluene/ethanol 5:4, silicagel) most of the
carboxylic acid 3 has been converted to the N-hydroxysulfosuccininimide
ester 12 having the formula
##STR24##
The reaction mixture is cooled to room temperature and a solution of
8-(6-aminohexyl) aminoadenosine-5'-triphosphate (Li-salt, sigma, 10.sup.-5
mol) in 100 .mu.l H.sub.2 O and 20 .mu.l pyridine (2.5.times.10.sup.-4
mol) is added. After stirring at room temperature overnight only traces of
a new compound are detectable. The mixture is then sonicated for 3 hours,
2 mg of 4-dimethylaminopyridine (1.6.times.10.sup.-5) is added and the
mixture is sonicated for an additional 5 hours. According to TLC (t-BuOH
3.5/acetone 2.5/conc. NH.sub.3 1.5/HOAc 1.5/ H.sub.2 O, cellulose, r.sub.f
=0.72) a new product is now easily detectable. The reaction mixture is
evaporated to dryness under vacuum. Chromatography of the residue (3
times) on a Sephadex G 10 column (Pharmacia) with water as eluent gives
3.5 mg of the compound 13 (29%), having the formula
##STR25##
EXAMPLE 8: Incorporation of compound 13 into an 18 mer oligonucleotide by
the enzyme terminal deoxynucleotidyl transferase
The fluorescent ribonucleotide 13 is incorporated into an 18 mer
oligonucleotide (sequence: CTC TAT TGA TTA CCA TGA) by terminal
deoxynucleotidyl transferase (Pharmacia) as follows:
1.8 .mu.g 18 mer oligonucleotide (synthesized in an Applied Biosystems
Inc.'s (Foster City, Calif.) automated oligonucleotide synthesizer using
their reagents) and 2.5 .mu.g compound 13 were dissolved in a reaction
buffer containing 140 mmol/1 K-cacodylate, 30 mmol/1 Tris-buffer pH 7.6, 1
mmol/1 CoCl.sub.2 and 0.1 mmol/1 dithiothreitol (DTT) (total volume 50
.mu.l). Enzymatic elongation was achieved by addition of 22 U terminal
deoxynucleotidyl transferase and incubation for 16.5 hours at 37.degree.
C.
20% denaturing polyacrylamide gel electrophoresis (experimental conditions
see example 3) shows a fluorescent DNA band which can be detected
visually.
Ethidium bromide staining also indicates that an elongation of the
oligonucleotide has occurred.
No incorporation can be detected if the concentration of compound 13 in the
labelling mixture is increased 5-10 times.
EXAMPLE 9: Incorporation of compound 13 into RNA transcripts by T7 RNA
polymerase
RNA transcripts containing the fluorescent ribonucleotide 13 are obtained
according to a method described in the European Patent Applications EP
427073 and EP 427074:
5 .mu.l 5.times. transcription buffer (containing 200 mmol/1 Tris-buffer pH
8, 50 mmol/1 MgCl.sub.2, 50 mmol/1 NaCl, 5 mmol/1 dithiothreitol (DTT) and
350 .mu.g/ml BSA), 5 .mu.l of a 5 .times. ribonucleoside triphosphate
mixture (containing 2.5 mmol/1 CTP, GTP and UTP and the fluorescing
compound 13 instead of ATP), RNA guard (Pharmacia, 36 U) and .sup.32 P-UTP
(10 .mu.Ci) are combined with 100 pg of a 69 mer hairpin oligonucleotide
(sequence as described in example 4) and 67 U of T7 RNA polymerase
(Pharmacia (total volume 25 .mu.l)). The mixture is incubated at
37.degree. C. for 3 hours. 20% denaturing polyacrylamide gel
electrophoresis (experimental conditions see example 3) and subsequent
autoradiography can detect RNA molecules.
It will be appreciated that the instant specification and claims are set
forth by way of illustration and not limitation and that various
modifications and changes may be made without departure from the spirit
and scope of the present invention.
__________________________________________________________________________
SEQUENCE LISTING
(1) GENERAL INFORMATION:
(iii) NUMBER OF SEQUENCES: 2
(2) INFORMATION FOR SEQ ID NO: 1:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 18 nucleotides
(B) TYPE: Nucleic Acid
(C) STRANDEDNESS: Single
(D) TOPOLOGY: Linear
(ii) MOLECULE TYPE: Other nucleic acid
(xi) SEQUENCE DESCRIPTION: SEQ ID NO:1:
CTCTATTGATTACCATGA18
(2) INFORMATION FOR SEQ ID NO: 2:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 69 nucleotides
(B) TYPE: Nucleic Acid
(C) STRANDEDNESS: Single
(D) TOPOLOGY: Linear
(ii) MOLECULE TYPE: Other nucleic acid
(xi) SEQUENCE DESCRIPTION: SEQ ID NO:2:
AGATTTTCTAGATTTCATCTTCCTCCCTATAGTGAGTCGTATTATTTTTT50
TTAATACGACTCACTATAG69
__________________________________________________________________________
Top