Back to EveryPatent.com
United States Patent | 5,576,176 |
Adams ,   et al. | November 19, 1996 |
A marker and method for detection and monitoring of HIV latency and activation and an assay for detection of the marker. The assay sensitively detects HIV transcription and monitors HIV transcriptional activity by detecting the presence of short and long transcripts, quantifying both and determining the ratio of short to long transcripts. Short transcripts are abundant and a low ratio correlates with a latent-type transcriptional activity of HIV whereas the appearance of long transcripts signifies increased efficiency of transcriptional activity of HIV and the transition from latency to activation. The size difference between the TAR fragments appearing predominantly in latency and the full length transcripts appearing predominantly during the HIV activation is detected by RT-PCR assay that utilizes novel primers and probes. The results are expressed as a ratio of short to long transcripts. The obtained ratio is a sensitive tool in detection of HIV infection, the analysis of load of latent and active virus and monitoring the transition from the latent to active state of HIV replication.
Inventors: | Adams; Melanie (San Francisco, CA); Romeo; Joseph (San Francisco, CA); Peterlin; Boris M. (San Francisco, CA); Busch; Michael P. (Corte Madera, CA) |
Assignee: | The Regents of the University of California (Oakland, CA) |
Appl. No.: | 206384 |
Filed: | March 3, 1994 |
Current U.S. Class: | 435/5; 435/6; 435/91.2; 435/91.21; 435/91.51; 536/23.1; 536/24.1; 536/24.32; 536/24.33 |
Intern'l Class: | C07H 021/04; C12Q 001/70; C12Q 001/68; C12P 019/34 |
Field of Search: | 435/5,91.2,91.21,91.51 536/24.32,24.33,23.1,24.1 935/8,17,18,77,78 |
Foreign Patent Documents | |||
9202228 | Feb., 1992 | WO. |
United States Biochemical Catalog (1990) pp. 158-161. Buck et al, Science (1990) 248: 208-212. Steven M. Schnittman, et al., Frequent Detection of HIV-1-Specific mRNAs in Infected Individuals Suggests Ongoing Active Viral Expression in All Stages of Disease, Aids Research and Human Retroviruses, vol. 7, No. 4, (1991), pp. 361-367. Thikkavarapu Seshamma, et al., Blocked early-stage latency in the peripheral blood cells of certain individuals infected with human immunodeficiency virus type 1, Proc. Natl., Acad. Sci. USA., vol. 89, (Nov. 1992) pp. 10663-10667. Michael Sheldon, et al., Characterization of the Inducer of Short Transcripts, a Human Immunodeficiency Virus Type 1 Transcriptional Element That Activates the Synthesis of Short RNAs, Molecular and Cellular biology, (Feb. 1993), pp. 1251-1263. M. Piatak, et al., High Levels of HIV-1 in Plasma During All Stages of Infection Determined by Competitive PCR, Science, vol. 259, (Mar. 19, 1993), pp. 1749-1754. Janet Embretson, et al., Massive covert infection of helper T lymphocytes and macrophages by HIV during the incubation period of AIDS, Nature, vol. 362, (Mar. 25, 1993), pp. 359-362. Bryan R. Cullen, Does HIV-1 Tat Induce a Change in Viral Initiation Rights?, Cell, vol. 73, (May 7, 1993), pp. 417-420. Mark B. Feinberg, et al., The role of Tat in the human immunodeficiency virus life cycle indicates a primary effect on transcriptional elongation, Proc. Natl. Acad. Sci. USA, vol. 88, (May 1991), pp. 4045-4049. Kalle Saksela, et al., Human immunodeficiency virus type 1 mRNA expression in peripheral blood cells predicts disease progression independently of the numbers of CD4+ lymphocytes, Proc. Natl. Acad. Sci. USA, vol. 91, (Feb. 1994), pp. 1104-1108. Melanie Adams, et al., Cellular latency in human immunodeficiency virus-infected individuals with high CD4 levels can be detected by the presence of promoter-proximal transcripts, Proc. Natl. Acad. Sci. USA, vol. 91, (Apr. 1994), pp. 3862-3866. Manohar R. Furtado, et al., Quantification of Human Immunodeficiency Virus Type 1 tat mRNA as a Marker for Assessing the Efficacy of Antiretroviral Therapy, The Journal of Infectious Diseases, 167:213-6, (1993). |
__________________________________________________________________________ SEQUENCE LISTING (1) GENERAL INFORMATION: (iii) NUMBER OF SEQUENCES: 7 (2) INFORMATION FOR SEQ ID NO:1: (i) SEQUENCE CHARACTERISTICS: (A) LENGTH: 59 base pairs (B) TYPE: nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear (ii) MOLECULE TYPE: synthetic oligonucleotide (iii) SEQUENCE DESCRIPTION: SEQ ID NO: 1: GGGTCTCTCTGGTTAGACCAGATTTGAGCCTGGGAGCTCT40 CTGGCTAACTAGGGAACCC59 (2) INFORMATION FOR SEQ ID NO:2: (i) SEQUENCE CHARACTERISTICS: (A) LENGTH: 17 base pairs (B) TYPE: nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear (ii) MOLECULE TYPE: synthetic oligonucleotide (iii) SEQUENCE DESCRIPTION: SEQ ID NO: 2: GGGTCTCTCTGGTTAGA17 (2) INFORMATION FOR SEQ ID NO:3: (i) SEQUENCE CHARACTERISTICS: (A) LENGTH: 17 base pairs (B) TYPE: nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear (ii) MOLECULE TYPE: synthetic oligonucleotide (iii) SEQUENCE DESCRIPTION: SEQ ID NO: 3: GGGTTCCCTAGTTAGCC17 (2) INFORMATION FOR SEQ ID NO:4: (i) SEQUENCE CHARACTERISTICS: (A) LENGTH: 21 base pairs (B) TYPE: nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear (ii) MOLECULE TYPE: synthetic oligonucleotide (iii) SEQUENCE DESCRIPTION: SEQ ID NO: 4: GGGCGCCACTGCTAGAGATTT21 (2) INFORMATION FOR SEQ ID NO:5: (i) SEQUENCE CHARACTERISTICS: (A) LENGTH: 29 base pairs (B) TYPE: nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear (ii) MOLECULE TYPE: synthetic oligonucleotide (iii) SEQUENCE DESCRIPTION: SEQ ID NO: 5: AGACCAGATCTGAGCCTGGGAGCTCTCTG29 (2) INFORMATION FOR SEQ ID NO:6: (i) SEQUENCE CHARACTERISTICS: (A) LENGTH: 30 base pairs (B) TYPE: nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear (ii) MOLECULE TYPE: synthetic oligonucleotide (iii) SEQUENCE DESCRIPTION: SEQ ID NO: 6: GTGGCGGCCGCTCTAGAACTAGTGGATCCC30 (2) INFORMATION FOR SEQ ID NO:7: (i) SEQUENCE CHARACTERISTICS: (A) LENGTH: 62 base pairs (B) TYPE: nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear (ii) MOLECULE TYPE: synthetic oligonucleotide (iii) SEQUENCE DESCRIPTION: SEQ ID NO: 7: CTCGAGAGACCGATTGATCCCTTGGGTTTCCCAGAGAGAC40 CAATCTGGTCTAGACTCGGACC62 __________________________________________________________________________