Back to EveryPatent.com
United States Patent |
5,541,314
|
McGraw
,   et al.
|
July 30, 1996
|
Method for automated synthesis of oligonucleotides
Abstract
Apparatus and method for the automated synthesis of DNA segments utilizing
multiple reaction columns, all of which are open at the inlet end to the
atmosphere of a reaction chamber. A movable reagent supply line outlet is
positioned adjacent to the column inlet end to apply reagent to each of
the columns according to an input sequence of delivery. The delivery
sequence is under processor control. Reagents are removed from all columns
simultaneously through the application of vacuum at the outlet end of each
column. The device enables the parallel synthesis of large numbers of
different oligonucleotide sequences of different lengths.
Inventors:
|
McGraw; Royal A. (Athens, GA);
Grosse; William M. (Athens, GA)
|
Assignee:
|
University of Georgia Research Foundation, Inc. (Athens, GA)
|
Appl. No.:
|
291109 |
Filed:
|
August 2, 1994 |
Current U.S. Class: |
536/25.31; 525/54.11; 530/334; 530/335 |
Intern'l Class: |
C07H 021/00; C07K 001/06 |
Field of Search: |
422/111,116,131,134
435/287,289
935/88
530/333,334,335
525/54.11
536/25.3,25.31
|
References Cited
U.S. Patent Documents
3531258 | Sep., 1970 | Merrifield et al. | 422/116.
|
4517338 | May., 1985 | Urdea et al. | 935/88.
|
4671941 | Jun., 1987 | Niina et al. | 435/287.
|
4690165 | Sep., 1987 | Leytes et al. | 137/112.
|
4701304 | Oct., 1987 | Horn et al. | 422/131.
|
4746490 | May., 1988 | Saneii | 422/116.
|
4748002 | May., 1988 | Neimark et al. | 422/116.
|
4811218 | Mar., 1989 | Hunkapiller et al. | 435/6.
|
4861866 | Aug., 1989 | Durrum et al. | 422/134.
|
5053454 | Oct., 1991 | Judd | 422/131.
|
5055408 | Oct., 1991 | Higo et al. | 436/48.
|
5104621 | Apr., 1992 | Pfost et al. | 422/67.
|
5112575 | May., 1992 | Whitehouse et al. | 935/88.
|
5175209 | Dec., 1992 | Beattie et al. | 422/131.
|
5213761 | May., 1993 | Sakagami | 436/49.
|
Foreign Patent Documents |
1058340 | Jun., 1989 | JP.
| |
2118189 | Oct., 1983 | GB.
| |
WO90/05293 | May., 1990 | WO.
| |
Other References
B. D. Warner et al. (1984) "Laboratory Methods, Construction and Evaluation
of an Instrument for the Automated Synthesis of Oligodeoxyribonucleotdes",
pp. 403, 405-6.
S. J. Horvath et al. (1987) "An Automated DNA Synthesizer Employing
Deoxynucleoside 3'-Phosphoramidites", p. 316.
J. W. Giles (1986) "Advances in Automated DNA Synthesis".
Christenson et al. (1982) "Automated Solid Phase Oligonucleotide
Synthesizer", Research Disclosure.
Applied Biosystems, Model 380A DNA Synthesizer Users Manual (1985).
|
Primary Examiner: Warden; Robert J.
Assistant Examiner: Snider; Theresa T.
Attorney, Agent or Firm: Greenlee, Winner and Sullivan, P.C.
Parent Case Text
This application is a division of application Ser. No. 08/016,739, filed
Feb. 11, 1993, now U.S. Pat. No. 5,368,823.
Claims
We claim:
1. An automated method for synthesizing oligonucleotides comprising
providing apparatus that includes a supply system with a plurality of
reagents such as the phosphoramidite bases A, C, T, and G, deblocking
chemicals, wash chemicals, capping chemicals and oxidizing chemicals,
multiple reaction columns each with an inlet end open to the atmosphere of
a reaction chamber and an outlet end, at least one of said reaction
columns having a support for producing an oligonucleotide, means for
applying and removing a pressure differential across said reaction columns
to drain said columns, at least one supply outlet located within said
reaction chamber, said outlet connected to a supply line for delivering
from said supply system to said reaction columns by aligning the position
of said supply outlet and the inlet end of a selected reaction column,
said apparatus controlled by a control system including means for
selecting which reaction column is to be aligned with said supply outlet,
for controlling the alignment of the selected reaction column and supply
outlet, and controlling the addition and removal of the reagents and
chemicals in the selected reaction column, said method including the
machine-implemented steps of:
deblocking supports to be coupled by aligning the supply outlet and the
inlet end of each selected reaction column having such a support and
thereupon supplying deblocking chemical to each such column;
applying a first pressure differential between the inlet end and the outlet
end of each reaction column to remove deblocking chemical from each
support to be coupled;
removing said first pressure differential and equalizing pressure on the
inlet and outlet ends of said reaction columns;
washing deblocked supports by aligning the supply outlet and the inlet end
of each reaction column having such a support and thereupon supplying an
appropriate wash chemical to each such reaction column;
applying a second pressure differential between the inlet end and the
outlet end of each reaction column to remove said wash chemical from each
support to be coupled;
removing said second pressure differential and equalizing pressure on the
inlet and outlet ends of said reaction columns;
coupling supports to be coupled by aligning the supply outlet and the inlet
end of each reaction column having such a support and thereupon supplying
an appropriate reagent coupling chemical to such reaction columns;
applying a third pressure differential between the inlet end and the outlet
end of each reaction column to remove said reagent coupling chemical from
each coupled support;
washing coupled supports by aligning the supply outlet and the inlet end of
each reaction column having a coupled support and thereupon supplying an
appropriate wash chemical to each such reaction column;
applying a fourth pressure differential between the inlet end and the
outlet end of each reaction column to remove said wash chemical from said
coupled supports;
removing said fourth pressure differential and equalizing pressure on the
inlet and outlet ends of said reaction columns;
oxidizing coupled supports by aligning the supply outlet and the inlet end
of each reaction column having a coupled support and thereupon supplying
an appropriate oxidizing chemical to each reaction column having a coupled
support;
applying a fifth pressure differential between the inlet end and the outlet
end of each reaction column to remove said oxidizing chemical from each
oxidized support;
removing said fifth pressure differential and equalizing pressure on the
inlet and outlet ends of said reaction columns;
washing oxidized supports by aligning the supply outlet and the inlet end
of each reaction column having an oxidized support and thereupon supplying
an appropriate wash chemical to each such reaction column;
applying a sixth pressure differential between the inlet end and the outlet
end of each reaction column to remove said wash chemical from each
oxidized support;
removing said sixth pressure differential and equalizing pressure on the
inlet and outlet ends of said reaction columns;
capping oxidized supports by aligning the supply outlet and the inlet end
of each reaction column having a coupled support and thereupon supplying
an appropriate capping chemical to each such reaction column;
applying a seventh pressure differential between the inlet end and the
outlet end of each reaction column to remove said capping chemical from
each capped support;
removing said seventh pressure differential and equalizing pressure on the
inlet and outlet ends of said reaction columns;
washing capped supports by aligning the supply outlet and the inlet end of
each reaction column having a capped support and thereupon supplying an
appropriate wash chemical to each such reaction column;
applying an eighth pressure differential between the inlet end and the
outlet end of said reaction columns to remove said wash chemical from each
such reaction column having a capped support;
removing said eighth pressure differential and equalizing pressure on the
inlet and outlet ends of said reaction columns.
2. The method of claim 1 wherein each step of coupling requires a multiple
number of additions of each reagent to each support requiring that
reagent, and wherein each step of coupling further includes waiting for an
incubation period after a single addition to all supports requiring that
reagent is complete.
3. The method of claim 2, wherein said apparatus includes a flush/prime
column having an inlet end open to the atmosphere of said reaction chamber
and an outlet end, and wherein between each step of coupling a different
reagent chemical, the following steps are carried out:
aligning the supply outlet to the inlet end of said flush/prime column; and
washing said supply line by application of an appropriate wash chemical,
then priming said supply line with the next coupling reagent.
4. The method of claim 1 wherein each step of coupling requires a multiple
number of additions of each reagent to each support, and wherein a single
addition of all coupling reagents is performed prior to waiting for an
incubation period.
5. The method of claim 4, wherein said apparatus includes a flush/prime
column having an inlet end open to the atmosphere of said reaction chamber
and an outlet end, and wherein between each step of coupling a different
reagent chemical, the following steps are carried out:
aligning the supply outlet to the inlet of said flush/prime column; and
washing said supply line by application of an appropriate wash chemical,
then priming said supply line with the next coupling reagent.
Description
This invention relates to apparatus and method for carrying out the
automated chemical synthesis of oligodeoxynucleotides and, in particular,
the synthesis of multiple different oligodeoxynucleotides in a concurrent
manner.
BACKGROUND OF THE INVENTION
The art of synthesizing DNA has progressed to include automated instruments
for concurrently producing multiple DNA segments, that is,
oligodeoxyribonucleotides, a term that is frequently shortened to
oligodeoxynucleotides and shortened further to oligonucleotides. These
machines often make use of reaction columns in which a support material
for the reaction is positioned within the columns between inert, porous
filters, referred to as "frits." The reaction columns are placed within
the automated apparatus so that chemicals can be added to the columns in
sequence and in appropriate amounts in an automated fashion. The object is
to synthesize the desired oligonucleotides from a starter material bound
to the support.
Currently known automated synthesizers can produce only a few
oligonucleotides at a time limited by the number of reaction columns
located within the machines. The number of reaction columns is limited as
a practical matter by the increased complexity of the plumbing and valving
network as the number of columns increase since currently known
synthesizers provide a tightly plumbed network from the several reagent
supply reservoirs to each reaction column. As a result, conventional
automated synthesizers typically provide for automated synthesis of only
one to four primer length (typically 20-mer) oligonucleotides in several
hours. If a four column unit is operated three times in an 8-hour workday,
twelve primers can be produced. To produce 100 oligonucleotide primers per
day requires eight of these expensive machines. Also, the cost of the
expensive reagents and the labor associated with the synthesis of 100
primers is high. While improvements in the production of primers holds
great promise for research and development activities in many areas,
including, for example, the effort needed to sequence the entire human
genome, the automated synthesizers currently available are inappropriate
for many applications in terms of throughput, operating costs and yields.
In addition to the production of primer length oligonucleotides currently
known synthesizers can produce much longer oligonucleotides, i.e., greater
than 100 nucleotides in length. The time to produce a 100 nucleotide DNA
is approximately five times longer than the production of a 20 nucleotide
DNA.
It is, therefore, an object of this invention to provide an instrument that
uses considerably less reagent material for equivalent yields, reduces
labor cost in the operation, keeps the initial expense of the machine
within reasonable limits by limiting the complexity of the machine and
enables the production of hundreds of primers each day.
SUMMARY OF THE INVENTION
In the apparatus of this invention a reaction chamber contains one or more
reaction columns in which a particular oligonucleotide sequence is
synthesized. The inlet end of each reaction column is open to the
atmosphere within the chamber and the chamber itself is preferably sealed
and filled with an inert gas. The instrument has a movable supply line
outlet located within the chamber. The outlet can be positioned above the
inlet end of each of the columns so that nucleotide reagents, capping
reagents, deblocking reagents, wash chemicals etc. can be provided to each
of the columns. All of these reagents are located in a supply system which
includes reservoirs and valving to connect the reservoirs with the supply
line. A flush/prime column is also located within the chamber so that the
supply line can be flushed and primed between each different chemical
reagent addition. After supplying the appropriate reagent to each of the
reaction columns, a pressure differential is applied to the columns to
drain the reagent. Preferably a vacuum source is connected to the outlet
end of the reaction columns to rapidly draw the chemicals from all of the
columns simultaneously thus leaving the columns dry and ready to receive
the next reagent.
A removable carrier plate is provided for holding a plurality of reaction
columns and enabling ease of movement of the reaction columns into and out
of the reaction chamber. When assembled with the reaction chamber, the
carrier plate seals the reaction chamber from an exit basin, allowing
atmospheric communication between the chamber and the basin to occur only
through the reaction columns.
The reaction columns are comprised of a porous material and a reaction
support material. The porous material sustains reagents to saturate and
interact with the reaction support material until a pressure differential
is applied to draw the reagents through the porous material to the exit
basin. The support material may be a derivatized support such as
controlled pore glass (CPG), placed in the column on a porous material
such as a glass frit. Alternatively, the porous material may itself be
appropriate for derivatization thereby combining the frit and support
material within the reaction column. A process of directly derivatizing
the support material can be carried out in the apparatus prior to the
synthesizing process.
In operating the apparatus according to a desired sequence of reagent
application, each of the reaction columns is designated to receive a
specific reagent. A computer with associated electronics and software
controls all aspects of the process including the opening and closing of
valves for the proper time period and in correct sequence, the movement of
the supply line outlet, the provision of the proper incubation period for
each reagent addition to the columns and the evacuation of the columns
after the incubation period is complete.
Asynchronous coupling is used, that is, when coupling the nucleotide
reagents, a first such reagent is delivered to all columns requiring that
base regardless of the position of the column. Columns not requiring the
first reagent are skipped over by the movable outlet.
The apparatus can be used for automating various processes by utilizing
appropriate reagents in the supply system, appropriate control programs
and appropriate reaction supports. As mentioned above, for example,
reaction supports for synthesizing oligonucleotides may be directly
derivatized in the apparatus and if performed directly prior to the
synthesizing process, the carrier plate can remain in the apparatus for
both the derivatization and synthesizing processes.
BRIEF DESCRIPTION OF THE DRAWINGS
FIG. 1A is a block diagram showing the major components of the inventive
apparatus. FIG. 1B shows a carrier plate with reaction columns for
assembly with the apparatus of FIG. 1A. FIG. 1C is a sectional view
showing reaction support material located in the reaction columns of FIG.
1B.
FIG. 2 is a schematic diagram of a laboratory prototype providing a
specific version of the apparatus set forth in FIG. 1.
FIG. 3 shows details of the reagent supply system used with the laboratory
prototype of FIG. 2.
FIG. 4 shows details of the reaction chamber of FIG. 2, with 32 reaction
columns located therein.
FIG. 5 is a side view of the reaction chamber.
FIG. 6 shows a typical reaction column used within the reaction chamber.
FIG. 7 is a block diagram of the major components in the control center of
FIG. 1.
FIG. 8 is a flow diagram of the method of operating the inventive
apparatus.
FIGS. 9A and 9B show detailed steps to implement each of the major steps of
the method set forth in FIG. 8. FIG. 9C shows a variation on the method of
FIG. 9B.
FIGS. 10A and 10B show an alternate approach to the methods of FIGS. 9B and
9C.
DETAILED DESCRIPTION OF THE INVENTION
With reference to the drawings, like numbers indicate like parts and
structural features in the various figures.
FIG. 1A shows a sealed reaction chamber 10 in which a multiplicity of
reaction columns 11 are located. A flush column 12 is also situated within
the reaction chamber. Each reaction column 11 contains an open inlet end
13 and an outlet end 14 which empties into exit basin 17. The columns 11
are formed into a carrier plate 8, the details of which are shown in FIGS.
1B and 1C. Carrier plate 8, when inserted into the reaction chamber,
fastens to a bulkhead 16 to seal the reaction chamber 10 from the exit
basin, thereby allowing atmospheric communication between reaction chamber
10 and exit basin 17 only through the reaction columns 11. A movable
reagent outlet 18 is mounted on a sliding carriage 30 which is driven by
motive means 19 to position the outlet 18 over the inlet end of each of
the reaction columns in the reaction chamber
Chemical agents are stored in reservoirs R.sub.1 through R.sub.n and are
delivered through valves and tubing in the supply system 20 over supply
line 33 to the movable reagent outlet 1375 18. An inert gas supply 21
supplies gas under pressure over line 35 to each of the reservoirs R.sub.1
through R.sub.n. By pressurizing the reservoirs, the liquid reagent is
caused to move into the supply line when the outlet valve associated with
the reservoir is opened. Inert gas is also provided from supply 21 through
lines 36 and 36' together with bleeder valve V.sub.1 to the reaction
chamber 10. Inert gas is sent to the exit basin 17 through lines 36 and
36" together with valve V.sub.2. Preferably, a vacuum pump 22 is connected
to the exit basin through valve V.sub.3 and line 46 in order to evacuate
basin 17 and draw any reagent chemicals located in the reaction columns to
waste reservoir 37. Vacuum pump 22 also acts to evacuate the flush column
12 through valve V.sub.4 and line 45 in order to draw any chemicals which
have been flushed into column 12 into the waste reservoir 37.
A reaction control center 23 is connected to control all of the valves
within the system as well as the motive means 19 in order to control the
additions of reagent chemicals in the proper sequence to each of the
reaction columns.
FIGS. 1A-1C show a movable carrier plate 8 with reaction columns 11 formed
therein. Each of the reaction columns contain a porous support material 7
appropriately derivatized for the desired reaction. When reagent chemicals
are added to the reaction columns 11, each chemical will be sustained by
the porous material to saturate and interact with the derivatized support
for a desired incubation period until drawn through the porous support 7
by the application of a pressure differential to the inlet and outlet ends
of the reaction columns. The reaction columns are conveniently formed in
the carrier plate 8 for manual movement of the columns into and out of
reaction chamber 10. FIG. 1B shows a carrier plate 8 with the columns 11
in a two dimensional matrix with 48 reaction columns in the array. The
invention contemplates carrier plates with 100 or more reaction columns
for concurrent synthesis of 100 or more sequences. Motive means 19
provides two dimensional motion to movable outlet 18 so that it can be
positioned over any selected column.
FIG. 2 shows a laboratory prototype built according to the principles of
the invention shown in FIG. 1. A reaction chamber 10 contains a multiple
number of reaction columns 11 which are positioned in a single row rather
than in a two dimensional array. The actual number of reaction columns in
the laboratory prototype may be as high as 32 although FIG. 2 does not
show quite that many. Reaction columns 11 in the prototype were built to
utilize Luer fittings as explained in detail below and are therefore of a
different construction from the carrier plate arrangement shown in FIGS.
1B and 1C.
The movable reagent outlet (supply line outlet) 18 is positioned on a
sliding carriage 30 which is moved back and forth along rails 31. Carriage
30 is connected to a drive belt 32 which is driven through motive means 19
(shown in FIG. 1). The supply line outlet 18 is connected through line 33
to a reagent supply system 20. System 20 contains a valve manifold shown
in detail in FIG. 3, together with all of the chemical reservoirs needed
for the particular process to be performed by the apparatus. Ten
reservoirs are shown in FIG. 2 for an exemplary process performed by the
prototype. The pressurized inert gas supply 21 is connected through line
35 to all of the reservoirs although the connections to each reservoir are
not specifically shown in FIG. 2. Line 36 carries inert gas to the
reaction chamber 10 and to the exit basin. Basin 17 is also connected to
the vacuum pump 22 through waste reservoir 37.
In the laboratory prototype, a personal computer 38 is used to control the
sequence through which chemicals are added to the reaction columns to
produce the desired oligonucleotide in each column. The computer 38 acts
to control the movement of outlet 18, the operation of the valves, the
timing of the reactions, in short, the entire process. Output of computer
38 is provided through an input/output (I/O) board 39 and a relay board
40. The system also includes a 24 volt power supply 41 and a parallel
expansion board mounted within the frame of computer 38.
A stepper motor is used as the motive means 19 (shown in FIG. 1) to
position the reagent outlet 18 in accordance with the control sequence.
The motive means 19 is under the control of a stepper motor controller 42.
The controller 42 is connected to the computer 38 which is the ultimate
control over the positioning of the reagent outlet 18 by the stepper
motor. FIG. 2 also shows a pressure regulator 43 for regulating inert gas
pressure and a vacuum gauge 44.
FIG. 3 shows some details of the prototype reagent supply system 20. The
system consists of reagent bottle reservoirs 50-59, valves 60-71, reagent
outlet supply lines 33, 33' and 33", and inert gas pressurization line 35
connected to each of the reservoirs. FIG. 3 shows that the wash chemical
located in reservoir 50 is located within the supply system so as to flush
out the entire supply line when the associated valves are operated. For
example, operation of valve 71 acts to wash lines 33' and 33 while
operation of valve 60 acts to wash lines 33" and 33. Obviously, the system
can be easily expanded or contracted to supply a different number of
reagents.
FIG. 4 is a close-up view of the reaction chamber 10 showing the 32
reaction columns 11 in the laboratory prototype. FIG. 4 shows the reagent
supply line outlet 18 located on a slide 30 which moves back and forth on
rail 31 (and rail 31' shown in FIG. 5). Slide 30 is connected to drive
belt 32 which is mounted on pulleys 80 and 81. While not shown in FIG. 4,
motive means 19 is connected to drive pulley 81. Inert gas is introduced
into the reaction chamber 10 through line 36' and into the exit basin 17
by line 36". Vacuum is supplied to the flush column 12 by means of line 45
while line 46 applies a vacuum to the exit basin 17.
FIG. 5 is an end or side view of the reaction chamber 10 with the side wall
removed, and shows clearly that the slide 30 is mounted on two guide rails
31 and 31'. The drive pulley 81 is connected to stepper motor 19 through a
flexible coupling 94. The reaction chamber 10 is sealed to the atmosphere
of the room in which it is located through top, back and bottom walls 92,
93, and 96, respectively, through side walls, not shown, and through a
removable front transparent face 90 which is sealed to the top, bottom and
side walls of the reaction chamber through seal 91. In the prototype, the
exit basin 17 is a hollowed out portion of a solid frame 17'. The bulkhead
16 is sealed to the top of the solid frame 17' by means of the seal 95
such that the exit basin 17 is not connected to the atmosphere in the
reaction chamber 10 except through the Luer fittings 15 which receive the
reaction columns 11.
FIG. 6 shows a close-up view of a cylindrically-shaped reaction column 11
used with the prototype of FIG. 2. The column 11 has a conically-shaped
outlet end for insertion into a mating Luer fitting 15. The reaction
column contains a porous frit 9 with the support 100 placed on the frit 9.
A second frit 9A is located over the support 100. The support is made of
Controlled Pore Glass (CPG) which is of a specified bead size with pores
therein of a specified size. Starter material for the reaction desired is
comprised of a support material such as CPG, appropriately derivatized
with a protected nucleoside (A, C, T or G) as dictated by the 3'
nucleoside of each sequence to be synthesized. The CPG support of
specified size with the proper derivatized nucleoside is commercially
available and is placed in the reaction column. The derivatized nucleoside
support may also be produced using the apparatus of this invention.
FIG. 7 shows the major components of the reaction control center 23. A
processor 110 is connected to a read-only memory (ROM) 111 and a random
access memory (RAM) 112. A hard disk drive 113 and a diskette drive 114
are included in the system for conveniently storing the sequences of
oligonucleotides to be produced. An input means such as keyboard 115 and
an output screen 116 enable interactive communication between the user of
the system and the processor 110. The output line 117 carries output
signals to the valve control unit 118 and the motor control unit 119 in
order to position the reagent supply line outlet 18 to the correct
reaction column and place into that reaction column the correct chemical
reagent in accordance with the sequence being processed by the apparatus.
In the laboratory prototype a Zenith personal computer, model Z-100, was
used together with a parallel expansion board from Qua-Tech (POPXB-721)
and a Qua-Tech relay board (OPOUT-241), together with an externally
mounted 24-bit digital I/O board (Qua-Tech UIO-10).
With the description of the apparatus now complete, a description of a
particular process using the inventive apparatus follows.
Prior to the operation of the instrument, the various oligonucleotide
sequences to be produced by the device are entered into a text file and
located on either a diskette for use in the diskette drive 114, or on a
hard disk located in the disk drive 113. A program to control the
operation of the valves and the motor is located in RAM 112. The control
program accesses the desired text file and directs the automated synthesis
of DNA according to the sequences found therein. An example of 32
nucleotide sequences for synthesizing 32 particular oligonucleotides is
shown in Table 3 infra.
Also, prior to the beginning of the operation, the 32 columns of the
prototype device are filled with the appropriate support material. The
columns are conveniently located on a carrier plate 8 which is moved from
the preparation area and inserted into the reaction chamber 10. As
previously noted, the supports can contain different nucleoside materials
one from another so that different sequences can be produced concurrently
in the inventive device.
After moving the carrier plate 8 with the reaction columns to the reaction
chamber 10 and securing each of the reaction columns into its associated
Luer fitting 15, the transparent front plate 90 is fastened in place to
produce an airtight reaction chamber
Reagent bottles are filled with appropriate reagents and capped tightly.
The reagent supply system is pressurized to about 7.5 psi with inert gas,
for example, argon. Reagent lines from the bottles to the valves are
primed by individually switching the appropriate valves. The vacuum pump
is turned on and the vacuum adjusted to about 20 inches of mercury. Manual
valve V.sub.1, FIG. 1, as well as any manual valves associated with the
argon tank 21 are opened to flood the reaction chamber.
When the synthesis program is started, the instrument enters the first
synthetic cycle. As in conventional instruments, a cycle consists of the
following reactions: deblocking (detritylation), coupling, oxidation and
capping. An acetonitrile wash follows each reaction. To illustrate, the
deblocking step proceeds as follows. First, the outlet 18 is moved by
motor 19 to the flush column 12. Valve 70 is operated so that deblocking
reagent 51 flows into the supply lines 33 and 33' in sufficient quantity
to prime them. Flow occurs through two position latching valve 66 which is
positioned to connect supply lines 33 and 33'. During the flushing and
priming operation, vacuum is applied to the flush column 12 through valve
V.sub.4 so as to remove reagent from column 12 through the line 45 to the
waste reservoir 37.
After priming the supply lines, valve 70 is closed and the outlet 18 is
moved successively to each position in the support array. While outlet 18
is positioned over each support, valve 70 is briefly opened for the time
needed to deliver an appropriate volume of reagent to each support. The
deblocking reaction proceeds for an appropriate incubation time after
which the reagent is removed from the reaction columns. Removal of the
deblocking reagent from the reaction columns is accomplished by opening
valve V.sub.3 to apply vacuum to the exit basin. Through that action all
columns which have received the deblocking reagent are evacuated. After
closing valve V.sub.3 valve V.sub.2 is opened to admit argon into the exit
basin 17 in order to equalize pressure above and below the frit 9.
Equalization of pressure on the frit is needed so that when a reagent is
applied to a column, it will saturate the support for the entire
incubation period until removal of the reagent occurs through application
of vacuum.
In the deblocking step, a second pass of the movable outlet 18 is made over
all of the columns to be coupled to provide the deblocking reagent a
second time, after which incubation and removal is once again carried out.
The deblocking operation often consists of four passes. The deblocking
reagent used in a typical DNA synthesis is a dichloroacetic acid as shown
in Table 1 below. Table 1 also presents other examples of chemical
reagents for use in synthesizing the oligonucleotide sequences shown in
Table 3, infra. It should be understood that the particular chemicals
shown in Table 1 are illustrative of those chemicals used in a successful
operation but the apparatus and methodology of the invention are not
limited to any specific coupling chemistry.
TABLE 1
______________________________________
DNA Synthesis Reagents
Common
Name Composition
______________________________________
WASH Acetonitrile
DEBLOCK 2.5% dichloroacetic acid in methylene chloride
ACTIVATOR 3% tetrazole in acetonitrile
A, C, G, T
2.5% cyanoethyl phosphoramidite in acetonitrile
OXIDIZER 2.5% iodine in 9% water, 0.5% pyridine, 90.5%
THF
CAP A 10% acetic anhydride in tetrahydrofuran (THF)
CAP B 10% 1-methylimidazole, 10% pyridine, 80%
THF
______________________________________
Incubation times and the number of reagent additions at each step in the
synthetic cycle vary depending on the reagent. Values for a successful
protocol are given in Table 2 below. Two of the steps require mixing of
reagents. That is, the coupling step requires mixing of amidite and
activator and the capping step requires mixing of the Cap A and Cap B
solutions. Mixing is accomplished in line 33 by rapidly opening first one
valve and then the other during priming of the reagent line and during
reagent additions to the reaction columns. For example, to mix the
activator and the amidite "A", two position latching valve 66 is
positioned to connect lines 33" and 33, and valves 61 and 62 are
alternately opened and closed in a rapid manner to place amidite and
activator into the supply lines 33" and 33. The valves 61 and 62 are
operated under the control of computer 38 to provide a desired mixture
ratio, which is shown as 1.8:1 activator to amidite in Table 2. When the
capping step is performed, valve 66 is positioned to connect lines 33' and
33 and valves 68 and 69 are alternately opened and closed in a rapid
manner to place Cap A and Cap B solutions into the supply lines 33' and
33. The desired mixture ratio of Cap A and Cap B is 1:1 as shown in Table
2.
TABLE 2
______________________________________
Incubation times (sec) for each reagent addition,
numbers of additions, and approximate total volumes
used (ml/oligonucleotide/cycle) for each step in the
synthetic cycle.
Time Additions Total Vol.
Reagent (sec) (no.) (ml)
______________________________________
Deblock 15 4 0.7
Wash 2 5 0.4
Couple A (+activator)*
15 3 0.3
Couple C (+activator)*
15 3 0.3
Couple G (+activator)*
15 3 0.3
Couple T (+activator)*
15 3 0.3
Wash 2 5 0.4
Oxidize 3 2 0.1
Wash 2 5 0.4
Cap (A + B)** 10 3 0.3
Wash 2 5 0.4
______________________________________
*Combined in line at a ratio of 1.8:1, activator to amidite.
**Combined in line at a ratio of 1:1, Cap A to Cap B.
The step of coupling in the inventive procedure makes use of an
asynchronous coupling concept in that the addition of each nucleotide
reagent proceeds to non-adjacent columns until each support requiring that
reagent has received it. At the beginning of each coupling, the control
program determines which of the 32 supports require "A," carries out the
addition of A to all identified supports, then determines which require
"C," carries out the C additions, and so forth, until all supports have
received the required nucleotide reagent.
Asynchronous coupling leads to economy in reagent use and to speed of
operation. Economy occurs by avoiding the flushing and priming steps which
might otherwise repeatedly occur in a sequential column to directly
adjacent column operation when one column calls for A, the next for C, the
third for A again, then T, etc. By limiting the need for incubation
periods and flush and prime operations, the speed of operation is
improved, and as the number of columns increase the benefit becomes more
pronounced. This advantage results since the time to move the outlet from
column to column is small compared to incubation times.
The inventive procedure allows for the parallel synthesis of
oligonucleotides of different lengths. A support bearing an
oligonucleotide whose synthesis has been completed will be ignored until
the other syntheses are completed. All supports are oxidized and capped
and if desired, all oligonucleotides are then detritylated simultaneously
during a final detritylation step.
The instrument allows for synthesis of less than 32 oligonucleotides. If
the input file contains only one sequence, or only six sequences, for
example, reagents are delivered to only one column or to only six columns,
respectively.
When the synthesis of all oligonucleotides is complete, the reaction
columns are removed from the instrument. Front plate 90 is unfastened and
the carrier plate 8 is removed from the reaction chamber 10 to a work
bench, carrying with it all of the reaction columns 11. The DNA products
may then be cleaved from their supports and subjected to conventional
deprotection as is known. If desired, the DNA products may also be further
purified according to well-known methods.
While the automated synthesis operation is being carried out, a second
carrier plate 8 can be prepared with the proper supports inserted into
each of the columns in the second carrier plate for a second synthesis
operation. When the first synthesis is complete and the first carrier
plate is removed from the reaction chamber, the second carrier plate is
then moved to the reaction chamber so that a second automated synthesis
operation can commence immediately. While the second synthesis operation
is carried out, the deprotection steps on the first batch can be
performed, after which the first carrier plate can be readied with the
proper supports for a third batch. In that manner, economy of labor is
achieved. All of these manual steps, however, can be avoided by using the
machine to produce the derivatized supports directly in the appropriate
column.
Details of one implementation of the reaction control center 23 are shown
in FIG. 7 and described above. As is well known in the art, the control
program for the process is read into the system from either the disk drive
113 or the disk drive 114 and stored in RAM 112 for the actual processing
operation. The input data (text files) for the sequence of adding the base
reagent chemical, that is A, C, T or G, for each sequence to be produced,
such as in Table 3, must also be read into the system. This may be
accomplished from the disk drive or diskette drive if the sequences have
been previously prepared, or they may be entered into the system from the
keyboard 115 with an interactive display on output screen 116 for the
computer user. To initialize the reaction control center, both the control
program and the input data for the sequences to be produced must be read
into RAM 112. The input data represented in Table 2 must also be read into
RAM to provide the number of additions for each reagent and the timing of
the various steps of the process.
TABLE 3
__________________________________________________________________________
Input nucleotide sequence data for thirty-two
oligonucleotides to be synthesized concurrently on the prototype.
oligo ID #
column #
sequence (5'-3') length
__________________________________________________________________________
096A 1 TCGCAAAAAGTTGGACAAGACT
22
096B 2 TTAGCAGGGTGCCTGACACTT
21
099A 3 CCAAAGAGTCTAACACAACTGAG
23
099B 4 ATCCGAACCAAAATCCCATCAAG
23
203A 5 TACAGTCTATGAGGTTGCAAAGA
23
203B 6 ATCTTAGTTCATGACAGAATTGAA
24
209A 7 GTAGAAGTTAGTGACTGTCATCC
23
209B 8 CCTCAGAGCCCCATACATTTCC
22
212A 9 ACTCTCCGTCCTCCCAGCTC 20
212B 10 GCCCCCCAAAATCTGAGGCTC
21
214A 11 CGCTTGCTCACGTACATGCAG
21
214B 12 TCTCTCCAGGTTCCTGAAGACT
22
TSH3 13 GATAATTTTATAATAGTTTTACTCC
25
TSH4 14 AGATTCCTTAGTCTCATTCC 20
TSH5 15 TCAGGATATCAATGGCAAAC 20
TSH6 16 CTCTACCCCTAAGGAGACAA 20
066A 17 GGCGCTATGGTGCATAGGGTC
21
066B 18 GATCAATAACATGTGTTTCTAATTT
25
067A 19 TGAGTAATGCAATAGATACAGTATT
25
067B 20 GCTTTGGCCATATGAAGAGCTTT
23
074A 21 GTGCTGATGCACTCTCCATATC
22
074B 22 ATTTATCCGTCTGTGCCATTACCT
24
075A 23 CAGTCCACAGGGTCGTAAAGAG
22
075B 24 ACTTACTGTACAACCAATTTCCAG
24
084A 25 GGGAGGGGAAATTCTTTGCATTC
23
084B 26 GTGACTGGAGGTCTCAGCCT 20
088A 27 GATCCTCTTCTGGGAAAAGAGAC
23
088B 28 CCTGTTGAAGTGAACCTTCAGAA
23
090A 29 CCACTGTCAGGTGATGAGGAATC
23
090B 30 ATCCTGAGAAAGGGTCTTGTGTC
23
095A 31 TCCATGGGGTCGCAAACAGTGG
22
095B 32 ATCCCTCCATTTGTTGTGGAGTT
23
__________________________________________________________________________
To operate the process, in addition to the initialization of the reaction
control center as outlined above, the initial set up process calls for the
loading of each of the reagent chemicals into the proper reservoir in
accordance with the scheme shown in FIG. 3.
An important aspect of the set up procedure is to load the columns to be
coupled onto the carrier tray 8. This is conveniently done on a work bench
from which the carrier tray is moved for insertion into the reaction
chamber where each column is positioned properly within its associated
Luer fitting 15. The reaction chamber is sealed by fastening plate 90 onto
the front of the reaction chamber 10. It should be noted that the location
of specific supports in specific columns to be coupled must be coordinated
with the sequence data in the control center. In that manner, the addition
of chemicals in the proper order will be made to the proper column in the
proper sequence. For example, with reference to Table 3, columns
containing the proper support corresponding to the 3' end of the Table 3
sequence are loaded into the carrier tray in the order shown. Therefore,
columns containing T support are placed into positions 1, 2, 12, 18, 19,
20, 22, 26 and 32. Columns containing G support are placed into positions
3, 4, 11, 23, 24 and 31. Likewise, columns with A support and columns with
T support are located on the carrier tray at positions corresponding to
the 3' data of Table 3.
Manual valves associated with the gas supply tank 21 are opened so that the
pressurized inert gas flows into line 35 to pressurize each of the
reservoirs. The gas also flows into line 36 and to the reaction chamber 10
to flood the chamber with inert gas. A manual bleeder valve, not shown,
for the reaction chamber may be opened during this operation so that all
of the air in the chamber is displaced as the inert gas enters. If needed,
valve V.sub.2 may be opened and valve V.sub.3 closed so that inert gas
flows into the exit basin.
After the set up and initializing procedures are carried out, the apparatus
is ready to begin the process of synthesizing oligonucleotides. The
operation of the control program is shown in FIG. 8 where the first step
200 is to deblock all supports to be coupled. It should be observed that
while 32 supports may be positioned within the prototype unit, the actual
number of supports to be coupled may vary from 1 to 32 on any particular
run.
The chemistry of synthesizing DNA is well known and therefore will not be
explained in detail. The general object of the deblocking operation at
step 200 is to remove the 5' blocking elements from the derivatized
nucleosides attached to the supports. Removal of the blocking elements
enables the nucleosides to be reactive to the application of coupling
reagents.
Once the deblocking step has been performed, the supply line is flushed and
all of the deblocked supports are washed at step 201. This step ensures
that all of the deblocking chemical reagent has been removed prior to
performing the next step 202 which is the coupling of all supports
requiring addition of the nucleotide reagent "A" which is the common
designation for reagent containing the base "adenine".
After flushing and repriming the supply line, the next step 203 in the
inventive process is to couple all supports requiring the nucleotide
reagent "C" which is the common designation for reagent containing the
protected "cytosine" precursor. At step 204, after washing and repriming
the supply line, coupling of all supports requiring the addition of
nucleotide reagent "G" is carried out. G is the common designation of the
nucleotide reagent containing the base "guanine." Similarly, at step 205,
coupling all supports requiring the base "T" is carried out. T is the
common designation for the nucleotide reagent containing the base
"thymine." It should be noted that operation of the inventive apparatus is
herein exampled through the use of a specific coupling chemistry making
use of the above named A, C, T and G nucleotide reagents. Collectively,
these reagents are often referred to as "phosphoramidite" or "amidite"
reagents to distinguish them from other currently known coupling
chemistries such as the "phosphotriester" and "phosphonate" chemistries.
The inventive apparatus, appropriately programmed, can be used with
coupling chemistries other than the one chosen herein to exemplify the
operation of the machine.
After the appropriate incubation period, vacuum is applied to remove the
reagents from the columns to the waste reservoir. All of the coupled
supports are washed at step 206 to remove any unreacted A, C, G and T
reagents. All of the coupled supports are oxidized at step 207 and washed
again at step 208. A blocking compound is added to cap any nascent
oligonucleotides that failed to couple at step 209. The coupled supports
are washed again at step 210 and additional reagents added through the
repetition of steps 200 through 210 to provide the next base in the
sequence. When synthesis of the sequences shown in Table 3 has been
completed, the query at step 211 results in a branch to step 212 for
deblocking the supports and washing them at step 213. The supports may
then be removed from the reaction chamber to the work bench for final
workup involving conventional deprotection.
FIGS. 9A-9B are a more detailed description of the procedure performed in
carrying out each of the steps of the process shown in FIG. 8. For
example, when the deblocking step 200 (FIG. 8) is entered, the detailed
operations of step 250-263 are performed. The first operation as shown at
step 250 in FIG. 9 is to set the number of times, n, that the deblocking
reagent is to be added to each column in order to provide a total of 0.7
ml of the reagent. To do that, the control program makes reference to
input data shown in Table 2, to ascertain the number of additions for the
deblocking step. That data shows that the deblocking step takes four
additions, that is, the supply line outlet must make four passes over the
columns in order to provide the needed total volume (0.7 ml) of deblocking
reagent to each column, each pass delivering 0.175 ml. Therefore, the
control program sets the control parameter n to equal four at step 250. At
step 251 the reagent supply line outlet 18 is moved to the flush column
12. At step 252, the appropriate valves are opened in order to prime the
supply line 33 with the deblocking reagent in reservoir 51. With reference
to FIG. 3, valve 66 is positioned to connect lines 33 and 33' and valve 70
is actuated to connect reservoir 51 with line 33'. After flushing and
priming the supply line 33 with deblocking reagent, valve 70 is closed. At
step 253, which is performed concurrently with step 252, the valve V.sub.4
is operated to drain the flush column.
The column numbers to be coupled are read by the control program at step
254 from input data such as Table 3 and the outlet 18 is moved by the
stepper motor to the first column to be coupled at step 255. With
reference to the example shown in Table 3, all 32 columns of the device
are to be coupled. Oligo ID # 096A will be synthesized in the first column
of the linear column array and oligo ID # 095B will be synthesized in the
32nd and last column of the array. As previously mentioned, the prototype
device can operate to synthesize any number of oligonucleotides from one
to 32, with input data such as Table 3 for any particular operation read
into the computer system. In this example, since all 32 columns are in
use, outlet 18 is first moved to the first column at step 255.
Valve 70 is opened at step 256 for the period of time needed to provide the
proper amount of deblocking reagent (0.175 ml) to the first column.
Thereafter, valve 70 is closed, and at step 257 the query is asked whether
the step has been completed for all columns to be coupled (in this
instance, are all columns deblocked). Since at this point in the procedure
the deblocking reagent has only been added to the first column, the answer
is "no," and a return is made to repeat steps 255 through 257 until all
columns to be coupled have received 0.175 ml of deblocking reagent. After
adding deblocking reagent to all appropriate columns (32 in this
instance), reagent outlet 18 is moved to the flush column at step 258 and
at step 259 the system waits until the incubation time needed for the
deblocking reagent to unmask the 5' ends of the nascent oligonucleotides
has been completed. Table 2 identifies that time as 15 seconds.
At step 260, valve V.sub.3 is opened to apply a vacuum to the outlet end of
all of the reaction columns to drain the deblocking reagent from the
columns that are to be coupled. Valve V.sub.3 is then closed and valve
V.sub.2 is opened at step 261 to introduce argon into the vacuum chamber
to equalize pressure on both the inlet and outlet ends of the columns. n
is set equal to n-1 at step 262, which at this point in the deblocking
operation results in setting n to 3. At step 263, the query is whether n
is equal to 0, and since it is not, a return is made to repeat steps 254
through 263 in order to add deblocking reagent for a second time to all of
the columns to be coupled.
After a repetition of the deblocking operation step 200 four times, n is
equal to 0 and the query at step 263 identifies that the deblocking
operation has been completed.
When the washing step 201 (FIG. 8) is initiated to clear the supply line
and the reaction columns of remaining deblocking reagent, the procedure
shown in FIGS. 9A and 9B is again carried out except that n is initially
set to five at step 250, as shown in Table 2, and at step 252, the valve
which is opened and closed is valve 71, as may be seen by reference to
FIG. 3. The flush column is drained at step 253 and at step 254, all
columns to be coupled are identified. Steps 255-257 are performed until
all columns to be coupled (32 in this case) contain the wash chemical.
Steps 258-263 are performed to provide the proper incubation time (2
seconds), to drain the columns to equalize pressure above and below the
frits and to reduce the value of n to 4. Steps 254-263 are repeated until
five passes are completed and n=0.
After the wash process step 201 is completed, step 202 (FIG. 8) is entered
to couple all of the supports requiring the addition of reagent A. Again,
the detailed procedure for carrying out step 202 is shown in FIG. 9. n,
the number of additions for the coupling step, is set equal to 3 at step
250, as shown by Table 2, and valves 61 and 62 are opened and closed at
step 252 to prime the supply line. Valve 66 is also operated to connect
lines 33" and 33. Note that in addition to the amidite reagent A, an
activator is also introduced into the supply line together with the
reagent A. This is preferably accomplished by rapidly opening and closing
valves 61 and 62 during step 252 to mix the amidite and the activator in
the priming of supply line 33. The flush column is drained at step 253 and
the column numbers to be coupled with the amidite A are ascertained at
step 254 by referring to the sequence input data in Table 3.
Table 3 shows the sequence in which couplings are carried out. As described
above, the 3' nucleotide is derived from a previously produced starter
support which is placed in the appropriate column as part of the set-up
procedure. Thus, the first couplings to be produced in the machine add the
second base from the 3' end in Table 3. Therefore, the first addition of A
is to the supports in columns 3, 4, 6, 11, 15, 16, 23, 24, 27 and 28. The
first addition of C is to columns 1, 7, 8, 12-14, 22 and 26. Likewise, for
the first addition of G's and T's. After completion of the first
additions, the second additions are accomplished and so on as the
synthesis proceeds in the 3' to 5' direction for the sequences shown in
Table 3.
With the input data identified, the outlet 18 is moved at step 255 to the
next column to be coupled, that is, the first column to receive the
addition of reagent A, column 3. At step 256, the valves 61 and 62 are
again opened and closed in a rapid manner to deliver a mixture of amidite
A and activator to column 3. In accordance with Table 2, the
amidite/activator mixture is delivered for a time sufficient to provide
0.1 ml to column 3 on this first of three additions so that a total of 0.3
ml is delivered when all three passes are complete.
At step 257, a branch is made to step 255 for positioning the outlet 18 at
the next column to receive amidite A, that is, column 4. Step 256 is
performed to add 0.1 ml of amidite A/activator to column 4 after which the
procedure of steps 255 and 256 are repeated for columns 6, 11, 15, 16, 23,
24, 27 and 28.
At this point in the procedure the first pass for adding amidite A is
completed and a branch is taken at step 257 to steps 258 and 258A where
the outlet is moved to its home position over the flush/prime column 12
and the query of whether an amidite A, C, T or G has been added results in
a branch to step 400. At step 400, one of three procedures is selected for
continuing the operation. These three separate procedures are illustrative
of the many variations which can be made in the processes which utilize
the inventive apparatus without parting from the spirit and scope of the
invention. For example, if procedure E1 is selected, the coupling steps
are performed in the same manner that has already been explained above
with reference to the deblocking and washing steps. If procedure E2 is
selected, the procedure is a variation of the E1 procedure except that
certain steps are skipped as explained below. If procedure E3 is selected,
a considerably different alternative procedure will be performed as
explained below.
In procedure E1 of FIG. 9B, at step 259, the incubation period for the
amidite A (15 seconds) is completed, after which the coupled columns are
drained at step 260 and pressure is equalized at step 261. Since the first
pass of adding the amidite A is now completed, n is set to 2 at step 262,
and since n is not zero, a branch is made at step 263 to step 255 for the
second pass of adding amidite A.
After completion of the second pass, the process continues for a third and
final pass after which the query at step 263 results in a return to FIG.
8, step 203, for adding the amidite C.
The procedure of E1 FIG. 9B, explained above with reference to amidite A,
is repeated for adding amidite C to those columns identified as requiring
C. With reference to Table 3, those columns are identified by the control
program as columns 1, 7, 8, 12-14, 22 and 26. After completing three
passes adding amidite C to each of the columns, n=0 and the supply line is
flushed and washed. Amidite G is then added in the same fashion as
explained above and then amidite T. When all four nucleotide reagents have
been added, a return is made for accomplishing the next step of the
process shown in FIG. 8, that is, step 206 calling for the washing of all
coupled supports.
The process shown in FIGS. 9A and 9B is again carried out for the washing
operation of step 206 with valve 60 opened in order that the supply line
33" for the activator and amidite chemicals may be washed. After
completion of step 206, the process shown in FIGS. 9A and 9B is performed
again during the oxidizing step 207 by activating valve 67 with valve
operated to connect lines 33' and 33. Another wash step is performed at
step 208 involving valve 71 and then all of the coupled supports are
capped at step 209. In order to perform that step, valves 68 and 69 are
alternately opened repeatedly to provide a mixing of the two capping
reagents in supply line 33. The coupled supports are again washed at step
At this point in the synthesis procedure, all of the steps have been
completed for coupling the first nucleotide reagent to each of the starter
materials for the 32 sequences shown in Table 3. That is to say, if all
couplings are successful, the support in column 1 now has a C attached at
the 5' end of the T already there; the support in column 2 has a T
attached at the 5' end of the T already there; the support in column 3 has
an A attached to the 5' end of the G; the support in column 23 has an A
attached to the 5' end of the G, etc. Ideally, all the molecules produced
in a particular column will be of the same length and the same nucleotide
sequence. However, coupling efficiency is not perfect and some small
percentage of the population of molecules may fail to couple. Any nascent
oligonucleotide which failed to couple will be capped in step 209 and thus
will not participate in subsequent coupling reactions. In that manner, the
synthesis of shorter than full length sequences is precluded or minimized.
At step 211, the query of whether any further couplings are to be performed
is answered in the affirmative since only the first coupling has been
completed at this point. Table 3 shows that the particular synthesis under
preparation is to provide oligonucleotide primers with base couplings
ranging from 20 to 25 in length. Consequently, a branch is taken at step
211 to step 200 to repeat the entire process described above in order to
add the second base coupling to each sequence. As shown in Table 3, during
this part of the procedure, the support in column 1 will receive an A; the
support in column 2 will receive a C; the support in column 3 will receive
a G and the support in column 32 will receive a G.
The process continues after completion of the second coupling until all
bases have been added to each of the 32 columns. When all couplings are
completed, the procedure of FIGS. 8 and 9 will have been performed 24
times. At this point, at step 211, the query of whether further couplings
are to be performed is answered in the negative and a branch is taken to
step 212.
Steps 212 and 213 are optional steps that contemplate further oligo
processing on a work bench as described above. Since some purification
methods take advantage of the presence of the trityl group, steps 212 and
213 may not be desirable. If the steps are performed at step 212, a
deblocking (detritylation) reagent is added to all columns and, after
deblocking, all columns are washed at step 213. The front cover 90 is
removed and the 32 support columns 11 are removed from the reaction
chamber 10.
TABLE 4
__________________________________________________________________________
Nucleotide sequences, lengths and yields of thirty-
two oligonucleotides synthesized concurrently on the prototype.
oligo ID #
sequence (5'-3') length
yield (.mu.g)
__________________________________________________________________________
096A TCGCAAAAAGTTGGACAAGACT
22 547
096B TTAGCAGGGTGCCTGACACTT
21 608
099A CCAAAGAGTCTAACACAACTGAG
23 568
099B ATCCGAACCAAAATCCCATCAAG
23 425
203A TACAGTCTATGAGGTTGCAAAGA
23 369
203B ATCTTAGTTCATGACAGAATTGAA
24 544
209A GTAGAAGTTAGTGACTGTCATCC
23 541
209B CCTCAGAGCCCCATACATTTCC
22 668
212A ACTCTCCGTCCTCCCAGCTC 20 784
212B GCCCCCCAAAATCTGAGGCTC
21 503
214A CGCTTGCTCACGTACATGCAG
21 336
214B TCTCTCCAGGTTCCTGAAGACT
22 771
TSH3 GATAATTTTATAATAGTTTTACTCC
25 659
TSH4 AGATTCCTTAGTCTCATTCC 20 601
TSH5 TCAGGATATCAATGGCAAAC 20 385
TSH6 CTCTACCCCTAAGGAGACAA 20 230
066A GGCGCTATGGTGCATAGGGTC
21 357
066B GATCAATAACATGTGTTTCTAATTT
25 515
067A TGAGTAATGCAATAGATACAGTATT
25 397
067B GCTTTGGCCATATGAAGAGCTTT
23 255
074A GTGCTGATGCACTCTCCATATC
22 558
074B ATTTATCCGTCTGTGCCATTACCT
24 572
075A CAGTCCACAGGGTCGTAAAGAG
22 471
075B ACTTACTGTACAACCAATTTCCAG
24 648
084A GGGAGGGGAAATTCTTTGCATTC
23 456
084B GTGACTGGAGGTCTCAGCCT 20 556
088A GATCCTCTTCTGGGAAAAGAGAC
23 431
088B CCTGTTGAAGTGAACCTTCAGAA
23 467
090A CCACTGTCAGGTGATGAGGAATC
23 402
090B ATCCTGAGAAAGGGTCTTGTGTC
23 471
095A TCCATGGGGTCGCAAACAGTGG
22 467
095B ATCCCTCCATTTGTTGTGGAGTT
23 597
__________________________________________________________________________
The results of an early run with the 32-place prototype are shown in Table
4, which shows the yields for each of the 32 oligonucleotides produced.
Total yields were based on optical density measurements of purified
oligonucleotide recovered from preparative gels, and show an average total
yield of approximately 500 micrograms for each sequence. The run was
completed in 6 hours, with consumption of reagents during the run only
about one-quarter of that to produce a similar sequence in a prior art
commercial single column synthesizer even though no serious attempt was
made to optimize reagent usage in the prototype. In addition to economy in
reagent consumption, the time required to synthesize 32 oligonucleotides
using the prototype synthesizer, is markedly less than that required by
prior art single column or four column synthesizers. The innovative
principals of operation embodied in the prototype, that is the "open" flow
path with the inlet of each column to be coupled opened to the atmosphere
of the reaction chamber, the motion controlled reagent outlet, which can
move from support to support, the exit basin coupled to each of the
multiple columns, and the controlled atmosphere of the chamber make it
possible to further increase the concurrent production of oligonucleotide
primers by simply increasing the number of columns in the device, either
by adding columns to the linear array or by providing a two dimensional
array of columns. Changes in hardware and software to accommodate
additional columns beyond 32 are minimal, which is in sharp contrast to
prior art systems. Such systems are tightly plumbed from the reagent
supply system to all of the individual columns making the addition of
columns a difficult matter.
One of the advantages of the inventive process described herein is that a
single priming of the delivery line is all that is necessary for each
amidite added during a cycle. As priming consumes significant quantities
of reagent, the saving in reagent consumption is significant compared to
prior art devices which have delivery lines to each column. As larger and
larger numbers of oligonucleotides are prepared concurrently, the
advantages of the inventive process become even more important. The
effective change over of reagents during the various steps improves
reagent economy, but the removal of reagents through the application of
vacuum is also a significant improvement leading to economy in the amount
of reagent needed. As the vacuum draws off the reagent, the column is
dried thus providing more efficient use of the next reagent.
Use of the open flow path currently requires a sealed reaction chamber so
that the atmosphere within the chamber can be controlled. While it might
be possible to synthesize DNA without maintaining a controlled atmosphere,
yields would suffer because the chemistry is very sensitive to moisture.
Should a chemistry be developed that is not sensitive to moisture, it
would be possible to operate the instrument in ambient conditions.
It should be noted that a balance is achieved between the forces which
retain the reagent solutions in the columns, that is, forces such as
surface tension and capillarity, and those forces which cause the reagents
to flow out of the columns, that is, forces such as gravity and pressure
differentials. By providing the balance, the reagent chemicals are allowed
to saturate the column during the incubation period, but are drawn off
quickly and uniformly from all columns when a pressure differential is
applied.
As mentioned above, the inventive apparatus may be operated in several
fashions to produce the synthesis; flexibility is a feature of the
automated apparatus. To illustrate, at step 400, one of three procedures
could be selected. The procedure according to the branch E1 was selected
and explained above. However, should the user of the apparatus have
selected the procedure E2, a branch would be made to FIG. 9C. The first
entry into procedure E2 is when the first pass for adding amidite A is
completed and the movable outlet has been moved to its home position over
the flush/prime column 12. At step 258A, the query of whether an amidite
A, C, T or G has been added, has resulted in a branch to step 400 where
the procedure E2 was selected. Since n was set equal to 3 at step 250 to
provide for three additions of amidite A, and since one pass is now
complete, n is set to two at step 258B. Since n is not zero, a branch is
made at step Z58C to step 258D to wait for completion of the 15 second
incubation period after which return is made to step 255 for the second
pass of adding amidite A.
Note that in this variation of the procedure, a return is made to step 255
without first draining all the coupled columns and equalizing pressure
above and below the frits. These steps can be skipped if the porosity of
the frits are such that the reagent has substantially drained away from
the support during the 15 second incubation period.
The process continues as previously described for the second pass of adding
the amidite A and continues for a third and final pass after which the
query at step 258C results in a branch to step 258F to wait for the
incubation period. When the period is complete, all the coupled columns
are drained at step 258G and pressure above and below the frits is
equalized at step 258H. At this point in the procedure only amidite A has
been added and therefore a return is made to the next major step of the
process as shown in FIG. 8, step 203, for adding the amidite C.
The procedure of FIG. 9 with the E2 variation shown in FIG. 9C selected, is
repeated for adding the amidite C to those columns identified as requiring
C as previously described with reference to Table 3. Those columns are
identified by the control program as columns 1, 7, 8, 12-14, 22 and 26.
After completing three passes of adding amidite C to each of the columns,
n=0, and the supply line is flushed and washed. Amidite G is then added in
the same fashion as explained above and then amidite T. When all four
nucleotide reagents have been added, a return is made for accomplishing
the next step in the process shown in FIG. 8, that is step 206, calling
for the washing of all supports.
The inventive apparatus may also be operated to produce faster turnaround
at the expense of using some additional reagent chemicals by altering the
control program as shown in FIG. 10 through the selection of E3 at step
400. In this version, at the conclusion of the first of the three passes
for a coupling step adding the first reagent, for example, A, to the
designated columns, the supply line is flushed and primed with the next
reagent, for example, C. The operation proceeds to add reagent C without
waiting for the conclusion of the relatively long incubation period of 15
seconds. After adding reagent C, the next reagents T and G are added as
required after which the process waits for a single incubation period of
15 seconds. All coupled columns are then drained simultaneously. The
process then repeats two more times to achieve the three passes indicated
for a completed coupling step. While this alternative uses more reagent
than the E1 and E2 processes shown in FIGS. 9B and 9C, it will still use
considerably less reagent than prior art systems which primed individual
lines for each column. As the number of columns increase, the advantage of
the inventive system becomes greater and greater. The alternative process
of FIG. 10 is superior to the processes shown in FIGS. 9B and 9C in a time
sense since the number of relatively long 15 second incubation time
periods during which the machine is in a wait state is greatly reduced.
To perform the method of FIG. 10, the initial set up procedure is the same
as described above and the first two steps shown in FIG. 8, steps 200 and
201, to deblock and wash all supports to be coupled proceed as previously
described. At step 202 in FIG. 8, the control program first determines
whether the reagent A is to be added. In the example synthesis of Table 3,
A is required and therefore step 202 to add reagent A is performed. As
previously described, the steps 250-258A, shown in FIGS. 9A and 9B, are
performed to complete a first pass of adding A to all supports requiring
that reagent. The query at step 258A results in a branch to step 400 and
to E3 in FIG. 10 in the alternative procedure.
In FIG. 10, step 300, a determination is made that the reagent A has been
added. This determination is made within the control program which calls
for the addition of A at step 202, if required, and the input data of
Table 3, which has required the addition of A. Alternatively, this
determination could be performed by feedback from the process apparatus.
At step 301, the input data of Table 3 is inspected to determine whether
the addition of reagent C is required. Since it is, the supply line is
flushed of A and primed with C at step 302 following which steps 255-257
are repeated until an addition of nucleotide reagent C has been made to
all columns requiring that reagent. The query at step 257 then results in
a branch to step 258 for moving the supply line to the flush/prime column,
and a branch is again taken to E3 in FIG. 10.
Step 300 results in a branch to step 303 since A was not added on this loop
through the procedure. At step 303, the control program notes that the
reagent C has been added. Next, the input data of Table 3 is reviewed at
step 304 to determine whether the reagent G should be added. Since the
input data includes G, the supply line is flushed of C and primed with G
at step 305. Steps 255-257 are again repeated until the addition of G has
been made to all columns requiring that reagent. Steps 258 and 258A are
then performed resulting in another entry E3 to step 300 in FIG. 10.
Since neither A nor C was added on this loop through the procedure, steps
300 and 303 are negative determinations but since G has been added, step
306 results in a branch to step 307 to determine whether reagent T is
required. The input data of Table 3 is reviewed and since the reagent T is
to be added, the supply line is flushed of G and primed with T at step
308. Steps 255-257 are again performed to add T to all supports requiring
that reagent. Steps 258 and 258A again lead to entry at E3 into FIG. 10.
Steps 300, 303, and 306 all result in negative determinations but at step
310 a branch is taken to step 311 to wait for completion of the required
incubation period of 15 seconds. After completion of the incubation
period, all columns are drained at step 312 and pressure differentials
above and below the frits are equalized at step 313.
The control parameter, n, is changed to 2 at step 314 signifying, in this
instance, that a completed first pass has been made for all reagents to be
added. Since n is not zero, a branch is made at step 315 to step 316 to
inquire whether the reagent A is to be added. Since the input data of
Table 3 require A, the supply line is flushed of T and primed with A at
step 317. A return is made to perform steps 255-257 until all supports
requiring reagent A have received an addition. Steps 258 and 258A again
lead to entry E3 into FIG. 10.
The process continues as described above until all required coupling
reagents have been added, that is, all couplings for the synthesis process
corresponding to the input data in Table 3 have been completed. At this
point, step results in a branch to step 206, FIG. 8, to wash all of the
coupled supports. The process is completed through all remaining steps as
previously described.
As mentioned above, the inventive apparatus and procedure is of value in
many situations requiring fast, economical production of large numbers of
DNA (or RNA) oligonucleotides. For example, one such situation is in
molecular genetic research where synthetic DNA's are used as primers in
DNA sequencing by the dideoxy method. One strategy for obtaining long
sequences by the dideoxy method is that of "primer-walking." In this
strategy, a long template is prepared and sequencing is initiated from one
end. The sequence is read as far as possible and a new primer is
chemically synthesized based on sequence near the end of the first "read."
The new primer is used to initiate a second round of sequencing thereby
extending the initial sequence. Repetition of the process generates a long
contiguous sequence which is limited, in principal, only by the length of
the template. However, each step in the walking process requires synthesis
of a new template-specific primer.
Parallel dideoxy sequencing of multiple long templates by a primer-walking
strategy has the potential of dramatically accelerating the acquisition of
sequence data by reducing the labor and expense associated with
preparation of large numbers of short templates and also by reducing the
effort involved in reassembling long contiguous sequences. Cost effective
implementation of the parallel primer-walking approach for large scale
sequencing projects is made practical by this invention.
The specific prototype of FIGS. 2-7 described has one row of columns and
one supply line outlet. A two dimensional array of columns is shown in
FIG. 1B and an outlet capable of two dimensional motion is provided for
use with that array. Also, if desired, the apparatus could have more than
one movable outlet and more than one flush/prime column. In that manner,
during the 15 second incubation period for amidite A, the second outlet
could supply amidite C, for example; or, the second outlet could serve an
entirely different group of columns. The prototype does not include
sensing devices to provide feedback data for closed loop operation. That
type of operation has not been needed to date, but obviously such control
could be added to the instrument, for example, if the device is built to
have 100 or more columns, feedback control might become desirable.
In the above-described procedure as it relates to the prototype machine of
FIGS. 2-7, setting up the machine requires the use of columns containing
the proper support corresponding to the 3' end of the Table 3 sequence
loaded into the carrier plate in a manner that is coordinated with the
sequence data in the control center. Therefore, columns containing the T
support are placed into positions 1, 2, 12, 18, 19, 20, 22, 26 and 32.
Columns containing G supports are placed into positions 3, 4, 11, 23, 24,
and 31. Likewise, columns with A support and columns with T support are
located on the carrier tray at positions corresponding to the 3' data of
Table 3. The manual set up procedure for the prototype requires the
operator to systematically work through the array, placing appropriately
pre-derivatized supports into their correct positions. Such an operation
has not been a problem on prior art instruments with one to four columns.
The possibility of misplacing a support increases for a prototype with 32
columns, and as the number of columns increase the job becomes more and
more tedious and error-prone. The inventive apparatus exampled here by the
32 column prototype can be further developed and expanded to accommodate
concurrent synthesis of 100 or more oligos as mentioned above with respect
to the two dimensional array of FIG. 1B. To alleviate the requirement for
manually placing the supports in the proper column, the inventive
apparatus can also be used to produce the initial derivatized support
material, and it can be done using the same array that will be used in the
subsequent synthesis process.
Various support materials and various chemistries are known for producing
derivatized supports. Polymeric supports, silica gel supports, cellulose
and others are known as well as controlled pore glass (CPG). It is
visualized that the inventive apparatus can be used for directly
derivatizing these various supports. With respect to FIGS. 1B and 1C, the
support material may be a porous frit-like material suitable for direct
derivatization. The appropriate derivatization chemicals are placed in the
reservoirs of FIG. 3 so that supply line 33 can contain the appropriate
reagent in the sequence of the derivatization operation. A control program
to operate the valves and to move outlet 18 must be provided together with
input information providing the amount of reagent to be added, the number
of additions and the incubation periods. Once the supports have been
derivatized and washed, the synthesizing process described above can then
be performed without incurring the danger of a manually misplaced support.
The instrument can be used, if desired, for the production of derivatized
supports in a carrier plate 8 as shown in FIG. 1B without thereafter
directly proceeding to the synthesizing process. In that manner, a number
of derivatized supports can be accumulated for subsequent synthesizing
operations.
While the invention has been described above with respect to specific
embodiments, such as, for example, the particular control program format,
it will be understood by those skilled in the art that various changes in
form and detail may be made therein without departing from the spirit and
scope of the invention. The invention has been described with a vacuum
source to apply a pressure differential between the inlet and outlet ends
of the reactive columns, but it is within the broad spirit and scope of
the invention to provide a pressure differential by any appropriate
measure. Also, while the production of primer length oligonucleotides is
currently visualized as a major use of the apparatus, much longer
oligonucleotides can be produced if desired. The invention receives
definition in the following claims.
Top