Back to EveryPatent.com
| United States Patent |
5,316,935
|
|
Arnold
, et al.
|
May 31, 1994
|
Subtilisin variants suitable for hydrolysis and synthesis in organic
media
Abstract
In accordance with the present invention, there are provided novel,
modified subtilisin enzyme(s) having improved catalytic activity and/or
stability in organic media.
| Inventors:
|
Arnold; Frances H. (Pasadena, CA);
Chen; Keqin (Pasadena, CA)
|
| Assignee:
|
California Institute of Technology (Pasadena, CA)
|
| Appl. No.:
|
864298 |
| Filed:
|
April 6, 1992 |
| Current U.S. Class: |
435/222; 435/68.1; 435/69.1; 435/219; 435/252.3; 435/320.1; 536/23.2 |
| Intern'l Class: |
C12N 009/50; C12N 009/56; C12N 015/57; C12P 021/00 |
| Field of Search: |
435/221,222,69.1,172.3,252.31,320.1
536/23.2
|
References Cited
U.S. Patent Documents
| 4760025 | Jul., 1988 | Estell et al. | 435/222.
|
| 4980288 | Dec., 1990 | Bryan et al. | 435/222.
|
| 4990452 | Feb., 1991 | Bryan et al. | 435/222.
|
| 5116741 | May., 1992 | Bryan et al. | 435/87.
|
| Foreign Patent Documents |
| 130756 | Jan., 1985 | EP | 435/222.
|
Other References
Hwang, J. Y. and Arnold, F. H., 1991, in Applied Biocatalysis, Blanch, H.
W. et al., Eds., Marcel Dekker, Inc., publisher, pp. 53-86.
Russell, A. J., et al., 1987, Journal of Molecular Biology, 193:803-813.
Martinez, P. and Arnold, F. H., 1991, Journal of the American Chemical
Society, 113(16):6336-6337.
Melonn, B., et al., 1985, FEBS Letters 183(2):195-200.
Economou, C., et al., 1992, Biotechnology and Bioengineering 39(6):658-662.
Wong, C.-H., et al., 1990, Journal of the American Chemical Society,
112(3):945-953.
Roseman, M. A., 1988, Journal of Molecular Biology, 200:513-522.
Bott, R., et al., 1988, The Journal of Biological Chemistry,
263(16):7895-7906.
Richelli, F., et al., 1982, Biochemical Journal, 207:201-205.
Gorman, L. A. S., et al., 1992, Biotechnology and Bioengineering,
39(4):392-397.
Zhong, Z., et al., 1991, Journal of the American Chemical Society,
113(1):683-684.
Russell, A. J., et al., 1989, Journal of Cellular Biochemistry, 13A, p. 77,
Abstract A240.
Evnin, L. B., et al., 1989, Journal of Cellular Biochemistry, 13A, Abstract
A110.
Gupta, M. N., 1992, European Journal of Biochemistry, 203(1/2):25-32.
Arnold, Frances H., "Engineering enzymes for non-aqueous solvents", in
Tibtech, vo.l. 8:244-249 (1990).
Chen, Keqin, et al., "Enzyme Engineering for Nonaqueous Solvents. II.
Additive of Subtilisin E in Polar Organic Media", in Biotechnol. Prog.,
vol. 7:125-129 (1991).
Chen, Keqin and Arnold, Frances H., "Enzyme Engineering for Nonaqueous
Solvents: Random Mutagenesis to Enhance Activity of Subtilisin E in Polar
Organic Media", Biotechnology, vol. 9:1073-1077 (1991).
Siezen, Roland J., et al., "Homology modeling and protein engineering
strategy of subtilases, the family of subtilisin-like serine proteinases",
Protein Engineering, vol. 4:719-737 (1991).
Martinez, Pascal, et al., "Stabilization of Subtilisin E in Organic
Solvents by Site-Directed Mutagenesis", Biotechnology and Bioengineering,
vol. 39:141-147 (1992).
|
Primary Examiner: Wax; Robert A.
Assistant Examiner: Moore; William W.
Attorney, Agent or Firm: Poms, Smith, Lande & Rose
Goverment Interests
ACKNOWLEDGEMENT
This invention was made with Government support under Grant No. 66766,
awarded by the Department of Energy (Advanced Industrial Concepts Program)
and Grant No. N0004-91-J-1397, awarded by the Office of Naval Research.
The Government has certain rights in the invention.
Claims
That which is claimed is:
1. A substantially pure modified subtilisin enzyme having improved
stability and/or catalytic activity in organic media, relative to the
stability and/or catalytic activity of unmodified subtilisin enzymes in
organic media, wherein said modified subtilisin enzyme is selected from
among the group consisting of mature, Class I subtilisins and wherein the
modification consists of an amino acid substitution at amino acid sequence
position 181 of said Class I subtilisin enzyme which corresponds
substantially to position 181 of the mature subtilisin BPN', said
substitution consisting of N181S.
2. A modified subtilisin enzyme according to claim 1 wherein said Class I
subtilisin enzyme is selected from BASBPN, BSS168, BSSDY, BLSCAR, BAPB92,
BYSYAB, BLS147, BSEPR, BSISP1, TVTHER, DNEBPR, XCEXPR, BSBPF, EFCYLA,
SEEPIP, SPSCPA, LLSK11, SMEXSP, AVPRCA, MMPPC3, HSIPC2, HSFURI, DMFUR1,
KLKEX1, or SCKEX2.
3. A modified subtilisin enzyme according to claim 2, wherein said Class I
subtilisin enzyme is selected from BASBPN, BSS168, BSSDY, BLSCAR, BAPB92,
BYSYAB, BLS147, BSEPR, BSISP1, or TVTHER.
4. An isolated DNA segment consisting essentially of a region encoding the
modified enzyme of claim 1.
5. An expression vector containing DNA according to claim 4.
6. Host cells containing DNA according to claim 4.
7. Host cells containing expression vector according to claim 5.
8. Process for the production of modified enzyme according to claim 1, said
process comprising expressing DNA encoding said modified enzyme in a
suitable host.
9. A modified subtilisin enzyme according to claim 1 wherein said
modification consists of one or more additional amino acid substitutions
at amino acid sequence positions of said Class I subtilisin enzyme
corresponding substantially to those of the amino acid sequence of the
mature subtilisin BPN', said substitutions selected from the group
consisting of D60N, D97G, Q103R, G131D, S182G, S188P, D248A, D248L, D248N
or T255A, and optionally E156G and/or N218S.
10. A modified subtilisin enzyme according to claim 9 wherein said
substitution consists of D60N.
11. A modified subtilisin enzyme according to claim 9 wherein said
substitution consists of D97G.
12. A modified subtilisin enzyme according to claim 9 wherein said
substitution consists of Q103R.
13. A modified subtilisin enzyme according to claim 9 wherein said
substitution consists of G131D.
14. A modified subtilisin enzyme according to claim 9 wherein said
substitution consists of E156F.
15. A modified subtilisin enzyme according to claim 9 wherein said
substitution consists of S182G.
16. A modified subtilisin enzyme according to claim 9 wherein said
substitution consists of S188P.
17. A modified subtilisin enzyme according to claim 9 wherein said
substitution consists of N218S.
18. A modified subtilisin enzyme according to claim 9 wherein said
substitution consists of D248N.
19. A modified subtilisin enzyme according to claim 9 wherein said
substitution consists of T255A.
20. A modified subtilisin enzyme according to claim 9 wherein said
substitution consists of D60N, Q103R and N218S.
21. A modified subtilisin enzyme according to claim 9 wherein said
substitution consists of D60N, D97G, Q103R and N218S.
22. A modified subtilisin enzyme according to claim 9 wherein said
substitution consist of D60N, G131D and S188P.
23. A modified subtilisin enzyme according to claim 9 wherein said
substitution consists of D97G, Q103R, E156G, and T255A.
24. A modified subtilisin enzyme according to claim 9 wherein said
substitution consists of D60N, D97G, Q103R, G131D, E156G, S182G, S188P and
N218S.
25. A modified subtilisin enzyme according to claim 9 wherein said
substitution consists of D60N, D97G, Q103R, G131D, E156G, S182G, S188P,
N218S, D248L and T255A.
Description
FIELD OF INVENTION
The present invention relates to the production of proteins using
recombinant techniques. More specifically, the invention relates to the
generation and production of subtilisin variants using recombinant means.
BACKGROUND OF THE INVENTION
Subtilisin is a proteolytic enzyme that has considerable utility in food
processing and laundry applications for degrading proteinaceous materials.
In addition to these applications, subtilisin is also capable of promoting
a wide variety of chemical conversions, such as peptide synthesis; the
resolution of racemic alcohols, esters and amines; the regioselective
acylation of polyhydroxy-compounds such as glycols, steroids and sugars,
and the like. Many of these chemical reactions must be carried out in
organic media in order to be practically useful. While useful to some
extent for conducting such reactions in organic media, subtilisins exhibit
relatively low levels of enzymatic activity in organic media. This
relative lack of activity in organic solvents severely limits the
commercial and industrial applications of subtilisin enzymes in chemical
synthesis. In view of this, it would be desirable to be able to produce
modified subtilisins which have improved activities in organic media.
Subtilisin has found considerable utility in industrial and commercial
applications [see, for example, U.S. Pat. No. 3,623,957 and J. Millet, J.
Appl. Bact. 33:207 (1970)]. For example, subtilisins and other proteases
are commonly used in detergents for the removal of protein-based stains.
They also are used in food processing to accommodate the proteinaceous
substances present in the food preparations to their desired impact on the
composition.
Subtilisins have also been employed in organic synthesis to catalyze a wide
variety of chemical reactions in organic media. For example, the
resolution of racemic alcohols employing hydrolases is reviewed by
Klibanov in Accts. Chem. Res. Vol. 23:114 (1990). The use of subtilisin
for the resolution of racemic amines in anhydrous organic solvent is
described by Kitaguchi et al., in J. Am. Chem. Soc. Vol. 111:3094 (1989).
Regioselective acylation of 5.alpha.-androstane-3.beta., 17.beta.-diol,
promoted by subtilisin in anhydrous acetone, has been described by Riva
and Klibanov in J. Am. Chem. Soc. Vol. 110:3291 (1988). Similarly,
subtilisin has been used for the regioselective acylation of the primary
hydroxyls of unprotected mono- and oligosaccharides in anhydrous
dimethylformamide and pyridine [see Riva et al, J. Am. Chem. Soc. Vol.
110:584 (1988)].
Subtilisin has also been used for the synthesis of peptides in organic
solvents [see, for example, Ferjancic et al., Appl. Microbiol. Technol.
Vol. 32:65 (1990)]. In addition to solubilizing the reactants, organic
solvent alters the relative amidase and esterase activities of the enzyme,
providing a catalyst that is well-suited to peptide synthesis by
aminolysis [see, for example, Wong and Wang, Experientia 47:1123 (1991)].
The ability of enzymes such as subtilisin to discriminate between optical
isomers of a substrate can also be altered by carrying out such reactions
in organic solvents. For example, D-amino acid-containing peptides can be
prepared using subtilisin in anhydrous tert-amyl alcohol [see Margolin et
al., J. Am. Chem. Soc. Vol. 109:7885 (1987)].
Enzymes having characteristics which vary from available stock are
required. In particular, enzymes having enhanced catalytic activity and/or
stability in non-aqueous media will be useful in extending the range of
processes for which such enzymes can be employed. Other characteristics
which one may wish to vary relative to available stock include enzyme
shelf life and an enzyme's ability to withstand exposure to high
temperatures. Because many industrial processes are conducted at
temperatures that are above the stability range of many enzymes, highly
stable proteases not only will be advantageous to certain industries such
as detergent and hide dehairing, that already require stable proteases,
but may be useful in industries that currently use chemical means to carry
out the reactions described earlier: peptide synthesis, resolution of
racemic compounds, acylation reactions, and the like.
Chemical modification of enzymes is known. Such modifications have been
carried out primarily to improve the stability of the target enzyme. For
example, see Svendsen, I., Carlsberg Res. Commun. 41(5): 237-291 (1976).
The ability of chemical modification to impart improved catalytic activity
(rather than stability), however, has not been reported. While chemical
modification of active-site residues of the serine protease chymotrypsin
results in dramatic change in the ratio of esterase-to-amidase activities
(Wong and Wang, supra), the modifications drastically reduce the reaction
rates.
Chemical modification methods, moreover, suffer from numerous
disadvantages, e.g., being dependent upon the presence of amino acid
residues convenient for such modification. In addition, these methods are
frequently nonspecific in that all accessible residues with common side
chains are modified, and such methods are not capable of reaching
sterically and/or electronically inaccessible amino acid residues without
further processing (e.g., denaturation; once denatured, it is generally
not possible to fully reinstitute enzyme activity). To the extent that
such methods have the objective of replacing one amino acid residue side
chain for another side chain or equivalent functionality, then mutagenesis
promises to supplant such methods.
Substantial work has been done to develop variants of subtilisin which
exhibit useful new properties, including increased thermostability
[Pantoliano et al., Biochemistry Vol. 28:7205 (1989); Pantoliano et al.,
Biochemistry Vol. 26:2077 (1987); Takagi et al., J. Biol. Chem. Vol.
265:6874 (1990)], to increase the ratio of esterase to amidase activity
for peptide synthesis [Abrahmsen et al., Biochemistry Vol. 30:4151
(1991)], to alter the pH dependence of the catalytic activity [Thomas et
al., Nature Vol. 318:375 (1985); Wells and Estell, TIBS Vol. 13:291
(1988)], to increase resistance to chemical oxidation [Estell et al., J.
Biol. Chem. Vol. 260:6518 (1985)], to increase amidase activity [Takagi et
al., J. Biol. Chem. Vol. 263:19592 (1988)], and to alter substrate
specificity [Wells et al., Proc. Natl. Acad. Sci. USA Vol. 84:5167 (1987);
Carter and Wells, Science Vol. 237:394 (1987)].
Modifying the activity/stability/pH-activity profiles of subtilisins
(especially in organic media) would be desirable in making these enzymes
more widely applicable in a wide variety of processes. For example,
enhancing the enzymatic activity of subtilisins in organic media will make
it possible to use such enzymes in reactions which are preferably
conducted in organic media, such as, for example, peptide synthesis, and
the like.
Mutations of proteases such as subtilisins will hopefully provide a variety
of different proteases having modified properties such as improved
K.sub.m, k.sub.cat, K.sub.m /k.sub.cat ratio and substrate specificity.
These mutations would then allow such enzymes to be tailored for the
particular medium to be employed, or the substrate which is anticipated to
be present, for example in peptide synthesis, or for hydrolytic processes
such as laundry uses.
BRIEF DESCRIPTION OF THE INVENTION
In accordance with the present invention, we have developed modified
subtilisin enzyme(s) having improved catalytic activity and/or stability
in organic media.
Invention enzymes are useful for the catalysis of a variety of reactions
which are preferably carried out in organic media, such as
transesterification, peptide polymer synthesis, selective acylation
reactions, and the like.
BRIEF DESCRIPTION OF THE FIGURES
FIG. 1 shows the scheme used for construction of plasmid pKWC and random
mutagenesis of subtilisin E, whose coding region is framed in pKWZ. In
addition, the figure includes a partial restriction map of plasmid pKWC.
FIG. 2 shows the catalytic efficiency (k.sub.cat /K.sub.M) for hydrolysis
of suc-Ala-Ala-Pro-Met-p-nitroanilide (sAAPM-pna) by wild-type subtilisin
E (.quadrature.), triple subtilisin mutant 3M (Q103R+D60N+N218S; O) and
multiple subtilisin mutant PC3 (D60N+Q103R+N218S+D97G+E156G+N181S+
G131D+S182G+S188P+T255A; ).
FIG. 3 shows deactivation of wild-type ( ) and Q103R+D60N+N218S ( )
subtilisin E in 40% aqueous DMF at 50.degree. C.
FIG. 4 shows the secondary structural topology of subtilisins.
.alpha.-helices are shown as cylinders, B-sheet strands as arrows. Solid
lines indicate regions of conserved amino acids (SCRs), dashed lines
indicate variable regions (VRs). Locations of amino acid substitutions
listed in Table V are indicated by .
DETAILED DESCRIPTION OF THE INVENTION
In accordance with the present invention, there are provided "subtilisin
enzymes" having improved catalytic activity and/or stability in organic
media, relative to the catalytic activity and/or stability of subtilisin
enzymes in organic media, said modified enzymes characterized by having at
least one of residues 60, 97, 103, 131, 181, 182, 188, 248 or 255, and
optionally 156 and/or 218, replaced with a residue which does not
naturally occur at the corresponding position, wherein the position of
each residue is given relative to subtilisin type BPN'.
Mature Bacillus subtilisin molecules are composed of a single polypeptide
chain of different lengths, depending on the source from which the
subtilisin is obtained. For example, for subtilisin type Carlsberg
produced by Bacillus licheniformis [Smith et al., J. Biol. Chem.,
243:2184-2191 (1968)]; and the subtilisin produced by Bacillus subtilis
(strain DY; [Nedkov et al., Hoppe-Seyler's Z, Physiol. Chem. Vol.
364:1537-1540 (1983)] each contain 274 residues; or subtilisin type BPN'
produced by Bacillus amyloliquefaciens [Markland et al., J. Biol. Chem.
242: 5198-5211 (1967)]; the aprA gene product of Bacillus subtilis [also
known as subtilisin I168 or subtilisin E, see Stahl et al., J. Bacteriol.,
158:411-418 (1984)]; and the subtilisin of Bacillus mesentericus [Svendsen
et al., FEBS Letters 196: 220-232 (1986)], each contain 275 residues;
while subtilisins obtained from other sources have longer or shorter
sequences.
When comparing amino acid sequences of subtilisin from different strains of
Bacillus herein, the sequence of subtilisin BPN' is used as a standard.
For example, based on an alignment of sequences that gives the highest
degree of homology between subtilisin Carlsberg and subtilisin BPN', the
serine at the active site of the former is referred to a serine 221, even
though it is located at position 220 of the amino acid sequence. On the
same basis, position 220 of the amino acid sequence of subtilisin
Carlsberg may be said to "correspond" to position 221 of subtilisin BPN'.
See e.g., Nedkov et al., supra.
In the family of Bacillus subtilisins, complete amino acid sequences are
presently available for at least fourteen subtilisins [see Siezen et al.,
in Protein Engineering 4:719-737 (1991)]. Subtilisin Carlsberg and
subtilisin BPN' (sometimes referred to as subtilisin Novo) differ by 84
amino acids and one additional residue in BPN' (subtilisin Carlsberg lacks
an amino acid residue corresponding to residue 56 of subtilisin BPN').
Subtilisin DY comprises 274 amino acids and differs from subtilisin
Carlsberg in 32 amino acid positions and from subtilisin BPN' by 82 amino
acid replacements and one deletion (subtilisin DY lacks an amino acid
residue corresponding to residue 56 of subtilisin BPN'). The amino acid
sequence of the aprA gene product is 85% homologous to the amino acid
sequence of subtilisin BPN'. Thus, there is extensive homology between
amino acid sequences of subtilisins from different strains of Bacillus.
There is also strong homology between the amino acid sequences of
subtilisin-like enzymes from different organisms (see Siezen et al.,
supra). This homology is particularly strong in certain regions of the
molecule and especially in those that play a role in the catalytic
mechanism and in substrate binding. Examples of such conserved sequences
are the primary and secondary substrate binding sites, Ser.sup.125
-Leu.sup.126 -Gly.sup.127 -Gly.sup.128 and Tyr.sup.104 respectively and
the sequence around the reactive serine (221), ASN.sup.218 -Gly.sup.219
-Thr.sup.220 -Ser.sup.221 -Met.sup.222 -Ala.sup.223. Conserved regions of
the subtilisin sequences are indicated in Siezen et al., supra.
Subtilisins contemplated for use in the practice of the present invention
are preferably Class I subtilisin enzymes, as defined by Siezen et al.,
supra. Exemplary Class I subtilisin enzymes include subtilisin BPN'
(BASBPN), subtilisin I168 (aprA or BSS168), subtilisin DY (BSSDY),
subtilisin Carlsberg (BLSCAR), subtilisin PB92 (BAPB92), alkaline elastase
YaB (BYSYAB), subtilisin 147 (BLS147), minor extracellular protease
(BSEPR), intracellular serine protease 1 (BSISP1), thermitase (TVTHER),
basic protease (DNEBPR), extracellular protease, obtained from Xanthomonas
campestris (XCEXPR), bacillopeptidase F (BSBPF), cytolysin component A
(EFCYLA), epidermin leader protease (SEEPIP), C5a peptidase (SPSCPA), SK11
cell wall proteinase (LLSK11), extracellular serine protease, obtained
from Serratia marcescens IF03046 (SMEXSP), Ca-dependent protease (AVPRCA),
pituitary PC3 protease (MMPPC3), insulinoma PC2 protease (HSIPC2), furin
(HSFURI), furin 1 (DMFUR1), Kexl serine protease (KLKEX1), Kex2 serine
protease (SCKEX2), alkaline protease, obtained from Bacillus sp. DSM 4828
(BDSM48), intracellular serine protease, obtained from Bacillus subtilis
A50 (BSIA50), extracellular serine protease, obtained from Bacillus
thuringiensis (BTFINI), extracellular serine protease, obtained from
Bacillus cereus (BCESPR), and the like.
Presently preferred subtilisins for use in the practice of the present
invention include subtilisin BPN' (BASBPN), subtilisin I168 (aprA or
BSSI68), subtilisin DY (BSSDY), subtilisin Carlsberg (BLSCAR), subtilisin
PB92 (BAPB92), alkaline elastase YaB (BYSYAB), subtilisin 147 (BLS147),
minor extracellular protease (BSEPR), intracellular serine protease 1
(BSISP1), and thermitase (TVTHER).
Presently preferred amino acid substitutions are those that enhance the
activity and/or stability of subtilisins in organic solvents.
Substitutions which are effective for this purpose include the following,
which are reported starting from the amino acid sequence of subtilisin E
(subtilisin I168):
______________________________________
Amino acid position
Substitution
Abbreviation
______________________________________
60 Asp .fwdarw. Asn
D60N
97 Asp .fwdarw. Gly
D97G
103 Gln .fwdarw. Arg
Q103R
131 Gly .fwdarw. Asp
G131D
156 Glu .fwdarw. Gly
E156G
181 Asn .fwdarw. Ser
N181S
182 Ser .fwdarw. Gly
S182G
188 Ser .fwdarw. Pro
S188P
218 Asn .fwdarw. Ser
N218S
248 Asp .fwdarw. Asn
D248N
248 Asp .fwdarw. Ala
D248A
248 Asp .fwdarw. Leu
D248L
255 Thr .fwdarw. Ala
T255A
______________________________________
as well as combinations of any two or more thereof.
Amino acids are referred to throughout this specification with reference to
their usual, three- and one-letter abbreviations routinely used in the
art, i.e.:
______________________________________
Amino Acid Abbreviation
______________________________________
L-Alanine Ala A
L-Arginine Arg R
L-Asparagine Asn N
L-Aspartic acid Asp D
L-Cysteine Cys C
L-Glutamine Gln Q
L-Glutamic Acid Glu E
L-Glycine Gly G
L-Histidine His H
L-Isoleucine Ile I
L-Leucine Leu L
L-Lysine Lys K
L-Methionine Met M
L-Phenylalanine Phe F
L-Proline Pro P
L-Serine Ser S
L-Threonine Thr T
L-Tryptophan Trp W
L-Tyrosine Tyr Y
L-Valine Val V
______________________________________
Nearly all of the above-recited amino acid substitutions, which have been
found to enhance subtilisin (e.g., subtilisin I168) activity in organic
media, are individually found in subtilisins from other sources. Thus, the
specific residue identified herein for incorporation into a modified
subtilisin derivative refers to a subtilisin which does not naturally
contain that residue. Naturally occurring subtilisins which have the
individual substitutions identified herein include:
______________________________________
Amino
acid
Sub- Subtilisins containing the specified
stitution
amino acid residue
______________________________________
D60N TVTHER, AVPRVA, HSFURI
D97G BASBPN, BAPB92, BYSYAB, BSISP1, DNEBPR,
XCEXPR, SEEPIP
Q103R None
G131D BSEPR, BSISPI, SMEXSP, MMPPC3, HSFURI,
KLKEXI, DMFURI, SCKEX2
E156G AVPRCA, MMPPC3, HSIPC2, HSFURI, DMFUR1,
KLKEX1, SCKEX2
N181S BSISP1, SPSCPA, SMEXSP, MMPPC3
S182G None
S188P DNEBPR, KLKEX1, SCKEX2
N218S BLS147, BSEPR, TVTHER, SEEPIP, SPSCPA,
LLSK11, SMEXSP, HSIPC2
T255A None
______________________________________
In addition, due to the additive benefits of the subtilisin modifications
described herein, a multiplicity of the above-described modifications can
be incorporated into a subtilisin derivative to improve the activity
thereof.
As employed herein, the phrase "catalytic activity", when used in reference
to subtilisin enzymes, means an increase in the k.sub.cat or a decrease in
the K.sub.M for a given substrate, reflected in an increase in the
k.sub.cat /K.sub.M ratio. Catalytic activity can be conveniently measured
by determining the ability of subtilisin to hydrolyze a substrate such as
succinyl-Ala-Ala-Pro-Phe-p-nitroanilide or
succinyl-Ala-Ala-Pro-Met-p-nitroanilide to produce para-nitroaniline.
A change in substrate specificity is defined as a difference between the
k.sub.cat /K.sub.m ratio of the precursor enzyme and that of the mutant.
The k.sub.cat /K.sub.m ratio is a measure of catalytic efficiency.
Subtilisins with increased or diminished k.sub.cat /K.sub.m ratios are
described in the examples. Generally, the objective will be to secure a
mutant having a greater (numerically larger) k.sub.cat /K.sub.m ratio for
a given substrate, thereby enabling the use of the enzyme to more
efficiently act on such target substrate. An increase in k.sub.cat
/K.sub.m ratio for one substrate may be accompanied by a reduction in
k.sub.cat /K.sub.m for another substrate. This is a shift in substrate
specificity, and mutants exhibiting such shifts have utility where the
precursors are undesirable, e.g. to prevent undesired hydrolysis of a
particular substrate in an admixture of substrates.
k.sub.cat and K.sub.m are measured in accord with known procedures, or as
described in Example X.
As employed herein, the term "stability", when used in reference to the
stability of subtilisin enzymes, means the half-life of said enzyme when
exposed to elevated temperature and/or organic media. In general, the
higher the temperature to which the enzyme is exposed, the shorter the
half-life of said enzyme (i.e., the shorter the enzyme retains its
activity). Similarly, the greater levels of organic solvent to which said
enzymes are exposed, the shorter the half-life of said enzyme. Some of the
invention subtilisins are found to have substantially higher half-lives
than are the precursor enzymes from which they are derived.
As employed herein, the phrase "organic media", refers to solvent systems
containing polar organic compounds such as dimethylformamide (DMF),
dimethyl acetamide acetonitrile, ethanol, methanol, butanol, acetone,
tetrahydrofuran, dioxane, and the like; non-polar organic compounds such
as hexane, benzene, toluene, and the like; as well as mixtures of any two
or more thereof, and aqueous solutions containing same.
In accordance with additional embodiments of the present invention, there
are contemplated DNA sequence(s) encoding the above-described modified
enzyme(s), expression vector(s) containing such DNA, and host cells
containing such DNA sequence(s) and/or expression vector(s) as described
above. In addition, there is also provided a process for the production of
the above-described modified enzyme, said process comprising expressing
DNA encoding said modified enzyme in a suitable host.
In accordance with still another embodiment of the present invention, there
is provided a method for identifying amino acid substitutions which render
a subtilisin derivative more active and/or more stable in organic media
than is the parental subtilisin from which said derivative is derived,
said method comprising:
effecting a mutation of wild-type subtilisin or a derivative thereof, and
testing for an increase in activity and/or stability in organic media
resulting from said mutation.
Those of skill in the art recognize that mutagenesis of subtilisin can be
carried out in a variety of ways. A presently preferred way to conduct
such mutagenesis is described in greater detail in Example II, employing a
modified polymerase chain reaction (PCR) protocol. By using PCR primers
which each fall within, or near, the targeted coding region for
subtilisin, and then carrying out multiple cycles of PCR in medium
containing a small amount of dimethyl sulfoxide (DMSO) and limiting
quantities of dATP, genes encoding variants of subtilisin are generated at
moderate frequency.
Alternatively, random mutagenesis of the subtilisin gene can be carried out
using chemical mutagens, as described by Bryan et al., Proteins: Struct.
Funct. Genet. 1:326 (1986). Another alternative for the mutagenesis is
site-directed mutagenesis, which can be employed to introduce specific
modifications into the subtilisin sequence at specified positions.
Site-directed mutagenesis can be used to randomly incorporate DNA
mutations at a specific position in the corresponding amino acid sequence,
as described by Martinez and Arnold, J. Am. Chem. Soc. Vol. 113:6336
(1991). Sets of subtilisin genes containing various mutations are produced
by these techniques.
The mutated genes are then incorporated into an expression vector which is
used to transform suitable host cells. The variant enzymes are expressed
by the host cells, which are screened in order to identify those that
express an enzyme variant exhibiting desired characteristics, e.g.
enhanced activity, stability, or altered substrate specificity in organic
solvent.
The screening process of this invention consists of a rapid (preferably
visual) assay for subtilisin activity in the presence of a polar organic
solvent. Active enzyme forms a visible halo surrounding the bacterial
colony on agar plates containing the broad subtilisin substrate casein.
Halo formation on casein plates has been used previously to screen for
thermostable subtilisin variants (Bryan et al., supra). In the current
procedure, those enzyme variants that exhibit enhanced activity in organic
solvents are found by screening on casein plates that contain a polar
organic solvent, as described in Example IV. However, it is not possible
to use high concentrations of polar solvents in these plates because 1)
the activities of wild-type subtilisin and derivatives are too low to be
visible in higher concentrations of the solvent and 2) the casein appears
to dissolve more readily in some of these solvents, also making the halos
indistinguishable. Therefore relatively low concentrations of organic
solvent, such as dimethylformamide (DMF), are used (27-35% DMF) for the
screening. This, however, does not pose a serious problem. It is
demonstrated herein that the enzyme variants found using this screening
method exhibit enhanced activities in the presence of very high
concentrations of solvent as well (Example XII and XX). It is also
demonstrated herein that it is critical to use the organic solvent in the
screening process (see Example XV). It has also been demonstrated that
useful mutations identified in the presence of one polar solvent,
dimethylformamide, are also effective in enhancing activity in the
presence of other organic solvents (see Example XX).
Once colonies with larger halos have been identified, the enzymes can be
purified from these cells and subjected to further characterization. In
fact, additional screening on different substrates (e.g. specific amide or
ester substrates) can be performed. In accordance with the present
invention, it has been found that the particular substrate used in any
subsequent screening step is reflected in the properties of the resulting
enzyme variant. For example, mutations that affect substrate specificity
and K.sub.M in organic solvents can be found when a second screening is
performed using a specific peptide substrate,
succinyl-Ala-Ala-Pro-Phe-p-nitroanilide, as described in Example XIV.
If mutations that enhance enzyme stability in organic solvents are desired,
then the screening is carried out in a slightly different way. Mutants
with higher catalytic activity than wild-type will quickly cause larger
halos to form on the casein plates. On the other hand, screening for
enhanced stability is carried out after incubating the enzymes for a given
period of time in the presence of the organic solvent (or at high
temperatures) (see Example V). In this process, one selects those enzymes
that remain active after the wild-type no longer is able to produce a
halo.
Organic solvents, both polar and nonpolar, dramatically reduce the
catalytic efficiency of subtilisins and other enzymes. In addition to
reducing k.sub.cat, the catalytic constant, organic solvents have a major
effect on the Michaelis constant K.sub.M, which reflects substrate binding
to the enzyme binding pocket. Because the increases in K.sub.M are so
large in polar organic solvents, mutations that reduce K.sub.M (an
increased affinity for the substrate) are useful. In addition, mutations
that increase k.sub.cat are useful. Generally, the objective is to
identify mutants that increase the ratio k.sub.cat /K.sub.M, known as the
enzyme's catalytic efficiency for the target substrate, in organic
solvents, thereby enabling the use of the enzyme to more efficiently act
upon such target substrate. Such mutations are described in the examples.
The enzymes herein may be obtained as salts. It is clear that the
ionization state of a protein will be dependent on the pH of the
surrounding medium, if it is in solution, or of the solution from which it
is prepared, if it is in solid form. Acidic proteins are commonly prepared
as, for example, the ammonium, sodium, or potassium salts; basic proteins
as the chlorides, sulfates, or phosphates. Accordingly, the present
application includes both electrically neutral and salt forms of the
designated subtilisin, and the term subtilisin refers to the organic
structural backbone regardless of ionization state.
The mutants described herein can be used in organic synthetic applications
such as peptide synthesis, resolution of chiral racemic mixtures,
regioselective acylation, and the like. In accordance with a further
embodiment of the present invention, there is provided an improved process
for subtilisin-promoted polymerization of amino acid esters in organic
media, said method comprising carrying out said reaction with modified
enzyme as described herein, under suitable reaction conditions (see
Example XXI). The modified subtilisins described herein are capable of
carrying out peptide synthesis in higher concentrations of organic
solvent, where the features of the resulting peptide product can be
dramatically altered. The modified subtilisins also exhibit higher
activities than wild-type enzyme in the organic solvent.
In accordance with a further embodiment of the present invention, there is
provided an improved process for subtilisin-promoted transesterification
in organic media, said method comprising carrying out said reaction with
modified enzyme as described herein, under suitable reaction conditions
(see, for example, Example XX). The modified subtilisins exhibit higher
activities than wild-type enzyme in the organic solvent.
Other subtilisin-promoted reactions contemplated by the present invention
include synthesis of specific peptides, regioselective acylation of
carbohydrates and other polyhydroxy-compounds, resolution of racemic
esters, alcohols, and amines, and the like.
In accordance with the present invention, subtilisin-promoted reactions are
preferably carried out in polar or non-polar organic reaction media as
described above, as well as aqueous media containing same.
The mutants described herein can also be used in the food processing and
cleaning arts. The carbonyl hydrolases, including mutants, are produced by
fermentation as described herein and recovered by suitable techniques. See
for example K. Anstrup, Industrial Aspects of Biochemistry, ed. B. Spencer
pp. 23-46 (1974). They are formulated with detergents or other surfactants
in accord with methods known per se for use in industrial processes,
especially laundry. In the latter case the enzymes are combined with
detergents, builders, bleach and/or fluorescent whitening agents as is
known in the art for proteolytic enzymes. Suitable detergents include
linear alkyl benzene sulfonates, alkyl ethoxylated sulfate, sulfated
linear alcohol or ethoxylated linear alcohol. The compositions may be
formulated in granular or liquid form. See for example U.S. Pat. Nos.
3,623,957; 4,404,128; 4,381,247; 4,404,115; 4,318,818; 4,261,868;
4,242,219; 4,142,999; 4,111,855; 4,011,169; 4,090,973; 3,985,686;
3,790,482; 3,749,671; 3,560,392; 3,558,498; and 3,557,002.
The invention will now be described in greater detail by reference to the
following non-limiting examples.
EXAMPLES
EXAMPLE I
Construction of the B. subtilis expression vector pKWC
The subtilisin E expression vector pKWC was constructed by removing two
HindIII sites, and one BamHI site, from plasmid pKWZ [kindly provided by
R. Doi, UC Davis; see Park et al., J. Bacteriol. Vol. 171:2657-2665
(1989)] The DNA fragment containing the HindIII site from the upstream
region of the subtilisin promoter of vector pKWZ was removed by double
digestion with EcoRI and SalI. The sticky ends of the plasmid were filled
using Klenow fragment and ligated using T4 DNA ligase. A BamHI linker
attached to the PCR 3' primer was used to delete a PstI-BamHI fragment
downstream of the subtilisin gene, which contained another HindIII site. A
restriction map of the resulting vector, pKWC, is shown in FIG. 1. The
sequence of the subtilisin E gene has been published [see Stahl and
Ferrari in J. Bacteriol. 158:411-418 (1984)], and is reproduced herein as
SEQ ID NO: 1.
EXAMPLE II
Random mutagenesis of the subtilisin gene using polymerase chain reaction
(PCR)
The HindIII-BamHI DNA fragment which encodes mature subtilisin E from amino
acid residue 49 to the C-terminus was chosen as the target for random
murtagenesis (see FIG. 1). Two oligonucleotides, SEQ ID NO; 2 and SEQ ID
NO: 3, were used as 5' and 3' PCR primers, respectively:
##STR1##
Two restriction sites, PstI and Bam HI, were added to the 3' primer for
convenience in the subsequent cloning steps. The PCR was carried out
essentially as previously described [see Saiki eta al., Science
239:487-491 (1988); and Leung et al., Teucnique 1:11-15 (1989)] on 50 ng
of single-stranded target DNA. A 100 .mu.l reaction mixture contained 10
mM Tris-HCl, pH 8.0, 20 mM KCl, 1.5 mM MgCl.sub.2, 0.01% (w/v) gelatin, 10
mM .beta.-mercaptoethanol, 10 .mu.l DMSO, 1 mM each of dGTP, dCTP and
dTTP, 0.2 mM dATP, 1.5 .mu.l each of the 5' and 3' primers (0.4 mg/ml),
and 0.5 .mu.l AmpliTaq.TM. DNA polymerase (5U/.mu.l) (Perkin Elmer-Cetus).
PCR was carried out at 94.degree. C. for 1 minute, 42.degree. C. for 2
minutes, and 72.degree. C. for 3 minutes. The last chain extension
reaction was carried out at 72.degree. C. for 7 minutes, and a total of 25
cycles were performed. The size and yield of the amplified DNA fragments
were determined by agarose gel electrophoresis.
EXAMPLE III
Preparations of mutant DNA libraries of subtilisin
To construct a randomly mutated mini-DNA library, plasmid pKWC (prepared as
described in Example I) and the PCR-generated subtilisin DNA fragments
(prepared as described in Example II) were digested with HindIII and
BamHI. Appropriate vector and insert fragments were separated by agarose
gel electrophroesis, purified from the agarose gel and ligated. These
constructs were transformed into a subtilisin-deficient B. subtilis
strain, DB 428 [kindly provided by R. Doi, UC Davis]; using the procedure
of Dubnau et al. [see Dubnau and Davidoff-Abelson, J. Mol. Biol.
56:209-221 (1971); and Gryczan et al., Bacteriol. 134:318-329 (1978)].
EXAMPLE IV
Screening transformed B. subtilis for enhanced subtilisin E activity in DMF
Following transformation, the cells of Example III were plated onto agar
plates containing modified Schaeffer's medium [see Leighton and Doi, J.
Biol. Chem. 246:3189-3195 (1971)] containing 1% casein. Subtilisin enzyme
is secreted by the B. subtilis, and active enzyme creates a visible halo
surrounding the bacterial colony when it hydrolyzes casein. When the
expression of the subtilisin reached a maximal level (determined by the
size of the halo), the bacterial clones were transferred, using filter
paper, to a second set of agar plates containing 27.5% dimethylformamide
(DMF) and 1% casein (referred to herein as "DMf screening plates"). A
clone expressing wild-type subtilisin E and a clone expressing a variant
known to be more active in DMF (N218S) were also plated as controls. These
plates were incubated at 37.degree. C. for 12 to 20 h. Under these
conditions a clone expressing wild-type subtilisin E does not produce a
detectable halo.
Although the transferred bacteria cannot survive on the DMF screening
plates, subtilisin enzyme that is active in the presence of organic
solvent could still produce a halo on the screening plates. For those
clones which exhibited a halo on the DMF screening plates, the
corresponding clones on the original, DMF-free plates were marked for
further study. Each marked clone was then selected from the original
plates and transferred (using nitrocellulose filters) to a new series of
plates containing different DMF concentrations, ranging from 27.5 up to
35%. Those clones showing halos larger than wild-type and N218S mutant
clones were subjected to further kinetic analysis and to DNA sequencing.
Cells from these positive clones were grown in 2 ml modified Schaeffer's
medium at 37.degree. C. for 16 hours to 20 hours. A small volume of
supernatant from each liquid culture was used to assay subtilisin activity
in aqueous buffer (10 mM Tris-HCl, pH 8.0 and 10 mM CaCl.sub.2), with and
without 10% DMF. The activity of the enzyme towards hydrolysis of the
specific peptide substrate:
succinyl-Ala-Ala-Pro-Phe-p-nitroanilide
was measured as described in Example XI, and the resulting activity
compared to the activity of wild-type subtilisin E.
The single mutations Q103R and D97G were identified and isolated by this
screening method, starting from DNA encoding wild-type subtilisin E. For
random mutagenesis by PCR, and screening of the resulting product, one can
also start with a DNA template that contains one or more mutations already
found to enhance the activity and/or stability of the enzyme in organic
solvents. For example, the double mutant, Q103R+D60N, was discovered by
random mutagenesis, starting with DNA encoding the mutant Q103R, and
screening the resultant clones as described in Examples II, III and IV.
EXAMPLE V
Screening transformed B. subtilis for enhanced subtilisin E stability in
DMF
Following transformation, the cells are plated on agar plates of modified
Schaeffer's medium containing 1% casein, as described in Example IV. When
the expression of the subtilisin reaches a maximum level (determined by
the size of the halo), the bacterial clones are transferred, using
nitrocellulose paper, to a second set of agar plates containing a set
percentage of dimethylformamide (DMF) and 1% casein. These DMF-containing
plates are incubated at a specified temperature for a period of time
sufficient for deactivation of wild-type (or another control) subtilisin.
The enzymes can then be transferred to another set of 1% casein plates
(containing no organic solvent) to screen for those that exhibit residual
activity. Enzyme that retains activity longer in the presence of the
organic solvent can still produce a halo on these screening plates. Those
clones which exhibit a halo on the screening plates are putative
interesting mutants, and the corresponding clones on the original,
DMF-free plates are marked for further stability analysis and DNA
sequencing.
EXAMPLE VI
Accumulation of beneficial mutations by sequential random mutagenesis
The subtilisin gene coding for enzyme with four amino acid substitutions
D60N+D97G+Q103R+N218S was used as the template for further rounds of
random mutagenesis and screening. For each subsequent round of mutagenesis
and screening, the target DNA fragments were chosen from the clones
identified as positive in the previous round, so that beneficial mutations
could be accumulated in the gene. The PCR conditions were modified with
respect to those described in Example II by increasing the concentration
of dimethylsulfoxide 1.5 times and reducing the concentration of dATP by a
factor of two. Furthermore, 45 reaction cycles were used. Following
digestion, ligation and transformation of the PCR-generated subtilisin DNA
fragments as described in Examples II and III, the clones were screened on
agar plates containing 30% DMF. Positive clones were then grown in 2 mL
cultures, and the supernatants were assayed in 40% DMF as described in
Example XII. The mutant subtilisin DNA was isolated from one positive
clone and used for the next round of random mutagenesis. After three
sequential random mutagenesis and screening steps, the DNA coding for the
mutant subtilisin
D60N+D97G+Q103R+G131D+E156G+N181S+S182G+S188P+N218S+T255A (called PC3) was
obtained, starting from the 4M variant (D60N+D97G+Q103R+N218S).
EXAMPLE VII
Sequencing of the mutant subtilisin genes
The insert HindIII-BamHI DNA fragment of a mutant subtilisin gene was
subcloned into pUC119 for sequencing. E. coli was infected using M13 phage
K07 [see Vieria and Messing, Methods Enzymol. 153:3-11 (1987)] for
producing single-stranded DNA. Single-stranded DNA was isolated as the
sequencing template. Sequencing was carried out using the
dideoxynucleotide-chain-termination method [see Sanger et al., Proc. Natl.
Acad. Sci. USA 74:5463-5467 (1977)] with T7 DNA polymerase [Tabor and
Richardson, Proc. Natl. Acad. Sci. USA 84:4767-4771 (1987)]. A DNA
template of wild-type subtilisin was used as the control.
EXAMPLE VIII
Site-directed mutagenesis using PCR
To incorporate different amino acids at a particular position in the
subtilisin enzyme, site-directed mutagenesis was performed using a
modified PCR technique. In each case, an additional oligonucleotide
containing the codon sequence for the desired amino acid substitution was
used as a primer for the PCR (mutagenic primer). The primer initiated
chain extension at the region between the 5' and 3' PCR primers described
in Example II. In the first PCR reaction, the mutagenic primer and the 5'
primer were used to generate a DNA fragment containing the new base
substitutions. The fragment was separated from the primers and isolated by
agarose gel electrophoresis. The purified fragment was then used as the
new 5' primer in a second PCR reaction with the 3' primer to generate the
desired mutated subtilisin DNA fragment. The following subtilisin variants
were constructed using this method:
______________________________________
Q103S Q103K Q103E E156G
N181S S182G S188P T255A
D60N + D97G + Q103R + N218S (4M)
D60N + D97I + Q103R + N218S
D60N + D97T + Q103R + N218S
D60N + D97G + Q103R + E156G + N181S + N218S (6M)
D60N + D97G + Q103R + G131D + E156G + N181S +
N218S (7M)
______________________________________
EXAMPLE IX
Construction of double mutant (D60N+N218S) and triple mutant
(Q103R+D60N+N218S) subtilisin E derivatives
To construct the double mutant, D60N+N218S, and the triple mutant,
D60N+Q103R+N218S, the appropriate DNA fragments were obtained from the
single mutants by double digestion with HindIII and BamHI, followed by
partial digestion with HaeIII (for which there are two cutting sites
within the HindIII-BamHI insert DNA (see FIG. 1). The appropriate
fragments were purified from an agarose electrophoresis gel and ligated to
the pUC119 vector using T4 ligase. The constructions were confirmed by DNA
sequencing. The HindIII-BamHI DNA fragments containing the multiple
mutations were reinserted into pKWC and transformed into B. subtilis DB428
for expression, purification, and characterization of the mutant enzymes.
EXAMPLE X
Expression and purification of subtilisin E mutants
B. subtilis harboring the pKWC expression vector were grown in modified
Schaeffer's medium for approximately 36 hours at 37.degree. C. The
purification of wild-type and variant subtilisins E was carried out
according to published protocols [Estell et al., J. Biol. Chem.
260:6518-6521 (1985)]. Subtilisin was recovered from the medium by
ammonium sulfate precipitation followed by two acetone precipitation steps
(employing 50% and 65% acetone, respectively). Following each
precipitation, the protein was dialysed against 10 mM sodium phosphate
buffer, pH 6.2. The enzyme was then passed through a CM Sepharose column
equilibrated with this dialysis buffer. Subtilisin was eluted with a
gradient of 0-0.4M NaCl in 10 mM sodium phosphate buffer, pH 6.2. The
resulting enzyme was dialyzed against 10 mM Tris-HCl, pH 8.0 and 2 mM
CaCl.sub.2.
Protein concentrations were determined using the Bio-Rad protein assay, as
described by the supplier. The purities of the variant and wild-type
subtilisin E preparations were determined by SDS PAGE [Laemmli, U.K.,
Nature 227:680-685 (1970)]. A major band with a molecular weight about 27
kD was detected in each protein sample, and the purity was estimated to be
greater than 95%.
EXAMPLE XI
Enzyme kinetics of mutant subtilisins
The amidase activities of subtilisin and derivatives thereof were measured
on the substrate succinyl-Ala-Ala-Pro-Phe-p-nitroanilide (sAAPF-pna) at
37.degree. C. in 0.1M Tris-HCl, pH 8.0 and 10 mM CaCl.sub.2. Assays were
initiated by mixing the enzyme, the substrate and the reaction buffer. The
amount of released p-nitroaniline was measured spectrophotometrically at
410 nm as a function of time. K.sub.M and k.sub.cat values for hydrolysis
of sAAPF-pna by the subtilisin variants were obtained by nonlinear
regression of the data using the program Enzfitter (Biosoft).
Changes in transition-state stabilization energies (.DELTA..DELTA.G*) for
the hydrolysis reaction by the enzyme variants and in the mixed solvents
were determined from the specificity constants K.sub.cat /K.sub.M
[Wilkinson, Biochemistry 22:3581-3586 (1983)]:
##EQU1##
Kinetic constants are reported in Table I for the wild-type enzyme and six
variants with 3-10 amino acid substitutions.
TABLE I
______________________________________
k.sub.cat, K.sub.M, k.sub.cat /K.sub.M and free energies of transition
state stabilization (.DELTA..DELTA.G*) for the hydrolysis
of succinyl-Ala--Ala--Pro--Phe-p-nitroanilide by
wild-type and variant subtilisin E in 0.1M
Tris-HCl, 10 mM CaCl.sub.2, pH 8, 37.degree. C.
k.sub.cat /K.sub.M
.DELTA..DELTA.G*
Mutant k.sub.cat s.sup.-1)
K.sub.M (mM)
(M.sup.-1 s.sup.-1 .times. 10.sup.3)
(kcal mol.sup.-1)
______________________________________
WT 21 0.56 38 --
3M 40 0.11 360 -1.39
4M 43 0.17 249 -1.17
6M 12 0.04 268 -1.2
7M 18 0.03 606 -1.7
PC1 16 0.05 334 -1.35
PC3 27 0.10 274 -1.22
______________________________________
Legend:
WT = wildtype
3M = D60N + Q103R + N218S
4M = D60N + Q103R + N218S + D97G
6M = D60N + Q103R + N218S + D97G + E156G + N181S
7M = D60N + Q103R + N218S + D97G + E156G + N181S + G131D
PC1 = D60N + Q103R + N218S + D97G + E156G + N181S + S182G + S188P
PC3 = D60N + Q103R + N218S + D97G + E156G + N181S + G131D + S182G + S188P
+ T255A
Values of the k.sub.cat /K.sub.M ratio for each of the subtilisin mutants
are higher than that of the wild-type enzyme. .DELTA..DELTA.G* values are
calculated from the ratio of the catalytic efficiencies of the mutant and
wild-type enzymes (as set forth above) and reflect the extent to which the
amino acid substitution is effective in enhancing activity. A large
negative .DELTA..DELTA.G* indicates that the mutation preferentially
stabilizes the transition state for the reaction and thereby improves the
catalytic efficiency of the enzyme.
This example shows that the subtilisin variants are more active than
wild-type subtilisin E in aqueous media. Example XII demonstrates that
they are also more active in the presence of an organic solvent (DMF).
EXAMPLE XII
Mutant subtilisins with improved amidase activity in the presence of DMF
For activity measurements in mixed buffer (containing DMF), a portion of
the aqueous buffer was replaced by the percentage (w/v) of DMF indicated
in Table II. Kinetic constants are reported in Table II for the wild-type
enzyme and six variants with 3-10 amino acid substitutions in 20% and 40%
DMF.
TABLE II
__________________________________________________________________________
k.sub.cat K.sub.M, k.sub.cat /K.sub.M and free energies of transition
state stabilization (.DELTA..DELTA.G*)
for the hydrolysis of succinyl-Ala--Ala--Pro--Phe-p-nitroanilide by
wild-type and variant subtilisin
E in 0.1M Tris-HCl, 10 mM CaCl.sub.2, pH 8, containing 20% and 40% DMF,
37.degree. C.
20% DMF 40% DMF
k.sub.cat
K.sub.M
k.sub.cat /K.sub.M
.DELTA..DELTA.G*
k.sub.cat
K.sub.M
k.sub.cat /K.sub.M
.DELTA..DELTA.G*
(s.sup.-1)
(mM)
(M.sup.-1 s.sup.-1 .times. 10.sup.-3)
(kcal mol.sup.-1)
(s.sup.-1)
(mM)
(M.sup.-1 s.sup.-1 .times. 10.sup.-3)
(kcal mol.sup.-1)
__________________________________________________________________________
WT 17 12.2
1.4 -- 3.3
20.9
0.16 --
3M 63 1.4 44 -2.15 19.9
2.94
6.8 -2.32
4M 76 2.4 31.5 -1.84 41.3
5.54
7.5 -2.38
6M 29 1.0 28 -1.85 11 2.3 4.8 -2.1
7M 64 0.97
66 -2.37 31 2.5 12.5 -2.69
PC1
20 0.3 59.7 -2.33 10 0.99
10.5 -2.59
PC3
73 0.7 98.9 -2.63 62 2.96
20.9 -3.0
__________________________________________________________________________
Legend:
WT = wildtype
3M = D60N + Q103R + N218S
4M = D60N + Q103R + N218S + D97G
6M = D60N + Q103R + N218S + D97G + E156G + N181S
7M = D60N + Q103R + N218S + D97G + E156G + N181S + G131D
PC1 = D60N + Q103R + N218S + D97G + E156G + N181S S182G + S188P
PC3 = D60N + Q103R + N218S + D97G + E156G + N181S + G131D + S182G + S188P
+ T255A
For each set of mutations, the improvement in catalytic efficiency is
greater (more negative .DELTA..DELTA.G*) in the presence of DMF than it is
in the purely aqueous medium (see Example XI, Table I). The mutations are
more effective in improving enzyme amidase activity in 40% DMF than in 20%
or purely aqueous buffer.
The activities of several of the variants towards a different peptide
substrate, succinyl-Ala-Ala-Pro-Met-p-nitroanilide, were measured in
concentrations of DMF as high as 85%. Values of k.sub.cat /K.sub.M are
plotted in FIG. 2 for wild-type enzyme and two variants, 3M and PC3. All
four combination variants 3M, 4M, 7M and PC3, are more active than the
wild-type enzyme over a wide range of DMF concentrations.
These results show that the improvements in catalytic efficiency brought
about by the amino acid substitutions are effective over a wide range of
solvent conditions, from no organic solvent to 85% DMF. The greatest
improvements in catalytic efficiency are observed in high concentrations
of organic solvent (>60% DMF). This example also shows that the mutations
can also improve activity towards a substrate other than the one used
during the screening process.
EXAMPLE XIII
Effects of mutations at position 103 on subtilisin amidase activity and
substrate specificity
The effects of different amino acid substitutions at position 103 on
amidase activity were investigated. The variants Q103E, Q103K, and Q103S
were constructed by PCR site-directed mutagenesis as described in Example
VIII. The amidase activities of these variants and the variant Q103R
identified by random mutagenesis and screening for enhanced activity in
the presence of DMF (Example IV) are compared in Table III. The reactions
were carried out in 10% DMF according to the procedures outlined in
Examples XI and XII.
TABLE III
______________________________________
K.sub.M, k.sub.cat, K.sub.cat /K.sub.M and free energies of transition
state stabilization (.DELTA..DELTA.G*) for the hydrolysis
of succinyl-Ala--Ala--Pro--Phe-p-nitroanilide by
wild-type and variant subtilisin E in 0.1M Tris-HCl,
10 mM CaCl.sub.2, pH 8, with 10% DMF, 37.degree. C.
K.sub.M k.sub.cat
k.sub.cat /K.sub.M
Variant
(mM) (s.sup.-1)
(M.sup.-1 s.sup.-1 .times. 10.sup.3)
.DELTA..DELTA.G* (kcal
______________________________________
mol.sup.-1)
Wild- 2.9 20 7.0 --
type
Q103R 1.3 34 26 -0.81
Q103S 3.0 20 7.0 0.0
Q103K 2.4 13 5.0 +0.21
Q103E 7.1 16 2.3 +0.70
______________________________________
The Q103R substitution results in the highest activity. This example shows
that the random mutagenesis and screening procedure identified an amino
acid substitution that is more effective than other amino acid
substitutions at the same position.
EXAMPLE XIV
Q103R mutation affects substrate binding/specificity and reflects the
substrate used during screening
The effects of the Q103R amino acid substitution on amidase activity were
investigated for two substrates, succinyl-Ala-Ala-Pro-Phe-p-nitroanilide
(negatively-charged succinyl group at the peptide N-terminus) and
Ala-Ala-Pro-Phe-p-nitroanilide (positively charged N-terminus) in 10% DMF.
Kinetics parameters are reported in Table IV.
TABLE IV
______________________________________
k.sub.cat, K.sub.M, k.sub.cat /K.sub.M and free energies of transition
state stabilization
(.DELTA..DELTA.G*) for the hydrolysis of succinyl-Ala--Ala--Pro--Phe-p-
nitroanilide by wild-type subtilisin E and Q103R variant thereof
in 0.1M Tris-HCl, 10 mM CaCl.sub.2, pH 8, with 10% DMF, 37.degree. C.
K.sub.M k.sub.cat
k.sub.cat /K.sub.M
.DELTA..DELTA.G*
(mM) (s.sup.-1)
(M.sup.-1 s.sup.-1 .times. 10.sup.3)
(kcal mol.sup.-1)
______________________________________
Suc-AAPFpna
WT 0.51 21 41 --
Q103R 0.27 34 126 -0.69
AAPFpna
WT 7.8 0.83 0.11 --
Q103R .gtoreq.37
.gtoreq.2.6
0.07 +0.25
______________________________________
The Q103R mutation decreases K.sub.M for the negatively charged peptide
substrate (suc-AAPFpna), but dramatically increases K.sub.M for the
positively charged substrate. Succinyl-Ala-Ala-Pro-Phe-p-nitroanilide was
used during the final screening step for this mutant. This example
demonstrates that the effectiveness and substrate specificity of the
random mutations that are found can strongly depend on the substrate used
during the screening process.
EXAMPLE XV
Effects of individual mutations on amidase activity of subtilisins in the
presence and absence of DMF
Kinetic constants are presented in Table V for the hydrolysis of
Succinyl-Ala-Ala-Pro-Phe-p-nitroanilide by variants containing the nine
individual amino acid substitutions found by the random mutagenesis and
screening procedures outlined in Examples II, III, IV and V and a double
variant containing the D60N+N218S substitutions.
TABLE V
__________________________________________________________________________
k.sub.cat K.sub.M, k.sub.cat /K.sub.M and free energies of transition
state stabilization (.DELTA..DELTA.G*)
for the hydrolysis of succinyl-Ala--Ala--Pro--Phe-p-nitroanilide by
wild-type subtilisin E and
variants thereof in 0.1M Tris-HCl, 10 mM CaCl.sub.2, pH 8, containing 0%
and 20% DMF, 37.degree. C.
0% DMF 20% DMF
k.sub.cat
K.sub.M
k.sub.cat /K.sub.M
.DELTA..DELTA.G*
k.sub.cat
K.sub.M
k.sub.cat /K.sub.M
.DELTA..DELTA.G*
(s.sup.-1)
(mM)
(M.sup.-1 s.sup.-1 .times. 10.sup.-3)
(kcal mol.sup.-1)
(s.sup.-1)
(mM)
(M.sup.-1 s.sup.-1 .times. 10.sup.-3)
(kcal mol.sup.-1)
__________________________________________________________________________
WT 21 0.56
38 -- 17 12.2
1.4 --
D60N
22 0.53
42 -0.06 23 7.6 3.1 -0.51
D97G
20 0.27
74 -0.41 21 5.2 4 -0.64
Q103R
31 0.25
124 -0.73 18 2.7 6.8 -0.98
G131D
39 1.15
33 +0.09 29 10.6
2.8 -0.43
E156G
10 0.25
39 -0.02 12 7.8 1.5 -0.04
N181S
27 0.23
120 -0.71 17 3.8 4.4 -0.71
S182G
18 0.47
38 0.0 11 8.0 1.4 0.0
S181P
19 0.52
37 +0.02 10 6.1 1.6 -0.08
N218S
36 0.45
81 -0.46 3.9 -0.61
T255A
7 0.14
52 -0.19 6 3.0 1.8 -0.17
__________________________________________________________________________
Several of the mutations (D60N, E156G, S188P, S182G) have little effect by
themselves on the amidase activity of the enzyme in water. The
substitution G131D in fact decreases the enzyme activity in water. In
contrast, some of those mutations significantly enhance activity in 20%
DMF. For example, D60N is only 10% more efficient than wild-type in water
(.DELTA..DELTA. G*=-0.06 kcal/mol), but is 220% better in 20% DMF
(.DELTA..DELTA. G*=-0.51 kcal/mol). This demonstrates the utility of
screening in the presence of the organic solvent in order to identify
amino acid substitutions effective for improving catalytic activity in
organic media.
Several of the mutations by themselves still have little effect on the
amidase activity in 20% DMF (S182G, S188P, E156G). Nonetheless, when
combined with other mutations in the variants 6M, 7M, PC1 and PC3, these
mutations have a beneficial affect on activity. This demonstrates the
utility of accumulating mutations using the method outlined in Example VI.
EXAMPLE XVI
The effects of mutations can be additive
To some extent mutations identified in separate mutagenesis and screening
experiments can be combined to obtain cumulative improvements in enzyme
activity. The additivity of mutations can be ascertained by comparing the
.DELTA..DELTA.G* values for the single variants (see Example XV, Table V)
with those of combination variants (see Example XII, Table II). For
example, the triple variant D60N+Q103R+N218S has .DELTA..DELTA.G* of -2.15
with respect to wild type in 20% DMF (3M, Table V). The individual
mutations are -0.51 (-0.98) +(-0.61)=-2.1, which is almost identical to
the .DELTA..DELTA.G* observed in the variant containing all three
mutations. Thus the effects of these three mutations are additive.
Additivity is not observed, however, for all mutations under all
conditions. For example, the mutation D97G alone increases catalytic
efficiency k.sub.cat /K.sub.M by more than two-fold in 20% DMF (Table IV)
(.DELTA..DELTA. G*=-0.64 kcal/mol). However, when this mutation is
combined with D60N+Q103R+N218S to make 4M, the incremental change in
.DELTA..DELTA.G* is not -0.64, but rather+0.3 (Table II, 4M versus 3M in
20% DMF). In this case, the effect of the mutation on 3M is to decrease
its activity, the opposite to what was observed for the effect of the
single mutation. In 40% DMF, however, the effect of D97G is to slightly
increase the catalytic efficiency of 3M. This demonstrates that individual
mutations can be combined with beneficial cumulative improvements in
catalytic activity under some conditions.
EXAMPLE XVII
Location of mutations relative to the active site and/or substrate binding
pocket
The locations of the various mutations found to increase subtilisin E
activity in the presence of DMF were found within the subtilisin E
three-dimensional structure. Four of the mutations were found to be in the
substrate binding pocket: D97G, Q103R, E156G and N218S. Other mutations
were found to be close to the catalytic triad in the enzyme active site:
D60N and E156G. The mutations are all clustered in a region that
encompasses the active site and substrate binding pocket.
Using the PCR technique described in Examples II and VI, mutations were
introduced randomly throughout the subtilisin E gene fragment that was
targeted. However, the screening process identified only mutations that
were clustered in a particular region of the protein. This demonstrates
that all, or a majority of, mutations that enhance catalytic activity in
the organic solvent are located in or near the active site or substrate
binding pocket.
EXAMPLE XVIII
Location of mutations relative to subtilisin variable regions
Dijkstra and coworkers have compared the amino acid sequences of more than
40 subtilisins from different sources [see Siezen et al., supra]. FIG. 4
shows a schematic representation of the secondary structure topology of
the subtilisins, indicating those regions of the sequence that are
conserved (SCRs) and those that are not conserved (i.e., variable regions,
or VRs). Other amino acids are commonly found in the variable regions of
the sequences of other natural subtilisins. The locations of the 10 amino
acid substitutions listed in Table V are also marked on FIG. 4. Nine out
of these ten substitutions are found either in variable regions, or in
close proximity to the variable regions.
These observations demonstrate that amino acid substitutions likely to give
beneficial effects on enzyme activity will be located in, or near, the
variable regions of the protein amino acid sequence. The variable regions
can be determined by sequence comparisons with homologous enzymes.
EXAMPLE XIX
Mutant subtilisins exhibit improved esterase activity in the presence of
DMF
The esterase activities of the wild-type and mutant subtilisins were
investigated for hydrolysis of the peptide ester substrate
succinyl-Ala-Ala-Pro-Phe-thiobenzyl ester in the presence of 70% DMF. The
reactions were carried out in 1.5 mL of 70% DMF, with 150 .mu.L of 0.1M
Tris-HCl, pH 8.2, 0.1M NaCl buffer and 5 .mu.L dithiodipyridine (0.16M in
DMF) at 37.degree. C. Assays were initiated by mixing the enzyme,
substrate and reaction buffer. The activity was measured
spectrophotometrically at 324 nm. K.sub.M and k.sub.cat values were
obtained by nonlinear regression using the program Enzfitter (Biosoft).
Kinetic constants are reported in Table VI for wild-type subtilisin E and
two mutants with 3 and 10 amino acid substitutions.
TABLE VI
______________________________________
k.sub.cat, K.sub.M, k.sub.cat /K.sub.M for the hydrolysis of
succinyl-Ala--Ala--Pro--Phe-thiobenzyl ester by wild-type
subtilisin E and mutants thereof in 70% DMF, 37.degree. C.
Mutant
k.sub.cat s.sup.-1)
K.sub.M (mM)
k.sub.cat /K.sub.M (M.sup.-1 s.sup.-1 .times.
10.sup.3)
______________________________________
WT 80 59 1.4
3M 222 25 8.9
PC3 292 18 16
______________________________________
Legend:
WT = wildtype
3M = D60N + Q103R + N218S
PC3 = D60N + Q103R + N218S + D97G + E156G + N181S + G131D + S182G + S188P
+ T255A
Both triple mutant 3M and the mutant containing 10 amino acid substitutions
(PC3) are more active in ester hydrolysis than the wild-type enzyme. This
example demonstrates that the mutant subtilisins also exhibit improved
esterase activity in the presence of a high concentration of polar organic
solvent.
EXAMPLE XX
Transesterification of N-acetyl-L-phenylalanine methyl ester in different
organic solvents
The activity of the D60N+Q103R+N218S (3M) subtilisin E triple variant was
compared to that of the wild-type enzyme for the transesterification of
N-acetyl-L-phenylalanine methyl ester to the ethyl ester in three organic
solvents. The reactions were carried out in 2 mL volumes of the indicated
solvent, containing 1 mg/mL of enzyme, 100 mM N-acetyl-L-phenylalanine
methyl ester, 1M ethanol. The samples were incubated, with shaking, at
32.degree. C., and the formation of the ethyl ester product was measured
by capillary gas chromatography. Values of the kinetic constants k.sub.cat
/K.sub.M are given in Table VII for the wild-type and 3M variant enzymes.
In all three solvents, anhydrous hexane, hexane containing 0.1% water, and
acetonitrile containing 0.1% water, the D60N+Q103R+N218S (3M) triple
variant was considerably more efficient than the wild-type enzyme.
TABLE VII
______________________________________
k.sub.cat /K.sub.M for transesterification of N-acetyl-L-
phenylalanine methyl ester by subtilisin E
(wild-type and variant 3M (D60N + Q103R + N218S)
in three different organic solvents, at 32.degree. C.
Solvent k.sub.cat /K.sub.M (Min.sup.-1 mg.sup.-1 .times. 10.sup.-3)
WT3M
##STR2##
______________________________________
hexane (anhydrous)
0.4 17 43
hexane (0.1% water)
5 220 43
Ch.sub.3 CN (0.1% water)
0.3 3.1 10
______________________________________
This example demonstrates that the mutant subtilisins can exhibit enhanced
activity in a transesterification reaction. Furthermore, the enhanced
activity is observed in organic solvents other than DMF. Finally, enhanced
activity is observed in an anhydrous solvent.
EXAMPLE XXI
Improved peptide synthesis using mutant subtilisins
The synthesis of peptide polymers by the mutant subtilisins was
investigated in DMF using methionine methyl ester as the substrate.
Approximately 250 .mu.g subtilisin E variant 3M (D60N+Q103R+N218S) was
added to a 1 mL reaction solution containing 60% or 70% (v/v) DMF, 0.75
.mu.L triethylamine, and 150 mg of methionine methyl ester hydrochloride.
The reaction was carried out at room temperature for 24 to 48 hours with
constant rotation of the tube. The precipitated polymer was collected by
centrifugation, washed several times with water and dried.
The polymer was then subjected to amino acid analysis. A portion of the
polymer was hydrolyzed with acid at high temperature, and the content of
free amino acid in the hydrolyzed sample was compared to that in the
unhydrolyzed polymer. A peak corresponding to free methionine appeared
only in the assay on the hydrolyzed polymer, indicating that the
precipitated material was a polymer of methionine, i.e., poly(methionine).
Mass spectrometric analysis of the polymer synthesized by 3M subtilisin in
70% DMF showed a molecular weight of approximately 4700 and a degree of
polymerization of approximately 36. Wild-type subtilisin E synthesized no
detectable polymer at this concentration of DMF (70%). In 60% DMF,
wild-type subtilisin catalyzed the polymerization of methionine to yield a
product with a molecular weight of 1000-1500 and a degree of
polymerization of approximately 10.
This example shows that the mutant subtilisin 3M is effective in peptide
synthesis in organic solvents. The mutant enzyme can produce
poly(methionine) in a high concentration of organic solvent (70% DMF),
where the wild-type enzyme is inactive. Furthermore, a higher degree of
polymerization (a longer polymer) is achieved using the mutant enzyme in
70% DMF than using wild-type enzyme in 60% DMF.
EXAMPLE XXII
Stability of mutant subtilisins
Stabilities of the various mutant subtilisins were determined from the loss
of activity as a function of time at a fixed temperature. The enzymes were
incubated at 25.degree. C. in 10 mM Tris-HCl, pH 8.0, 2 mM CaCl.sub.2 with
70% (v/v) DMF. The residual amidase activities were measured by diluting
not more than 100 .mu.L of the enzyme solution into a standard 1.5 mL
reaction mixture for the amidase activity assays described in Example XI.
The residual activities are reported in Table VIII.
TABLE VIII
______________________________________
Residual amidase activities of wild-type and
mutants of subtilisin E in 70% DMF, 25.degree. C.
Mutant 60 h 130 h 460 h
______________________________________
WT 88% 85% 49%
3M 98% 96% 63%
7M 94% 91% 55%
PC3 91% 85% 41%
______________________________________
Legend:
WT = wildtype
3M = D60N + Q103R + N218S
7M = D60N + Q103R + N218S + D97G + E156G + N181S + G131D
DC3 = D60N + Q103R + N218S + D97G + E156G + N181S + G131D + S182G + S188P
+ T255A
The 3M and 7M mutant subtilisins appear to be more stable than wild-type in
70% DMF at 25.degree. C. All the variants are stable for a period of many
days in 70% DMF. This example demonstrates that the amino acid
substitutions can enhance activity without compromising the stability of
the enzyme.
EXAMPLE XXIII
Subtilisins exhibiting enhanced stability in organic solvents
Site-directed mutagenesis
The following four deoxyoligonucleotides, corresponding to the specific
mutations Asp248.fwdarw.Asn, Ala or Leu (D248N, D248A, or D248L); and Asn
218.fwdarw.Ser (N218S) were used for site-directed mutagenesis of the
HindIII-BamHI DNA fragment of 789 basepairs, covering the amino acid
sequence from Ser 49 to the C-terminus of the mature subtilisin E gene,
according to the in vitro site-directed mutagenesis kit from Amersham:
##STR3##
Mutants in E. coli TG1 were screened by DNA sequencing according to the T7
Sequencing.TM. Kit from Pharmacia LKB. The unique HindIII-NcoI fragment of
the D248N subtilisin E gene was replaced by the corresponding fragment of
the N218S gene to obtain the double mutant N218S+D248N. All variants were
sequenced a second time to confirm the mutations. Plasmid pKWC was used
for expression of subtilisin E in Bacillus subtilis DB428, which does not
produce additional extracellular proteases.
Stability measurement
To determine the kinetic stabilities, lyophilized enzymes (from 2 mM
CaCl.sub.2, 10 mM Tris, pH=8) were redissolved in the same volume of
solvent mixture (80% (v/v) DMF, 20% H.sub.2 O or 40% DMF, 60% H.sub.2 O)
and incubated at 30.degree. C. or 50.degree. C. Because the stability of
subtilisin strongly depends on the calcium ion concentration, it was
necessary to maintain a constant CaCl.sub.2 concentration in the DMF/water
incubation mixture. Enzyme concentrations were mM or less. The samples
were prepared so that all the variants showed similar initial activities,
and residual hydrolytic activities were measured on sAAPF-pna at
37.degree. C. in 0.1M Tris-HCl, 10 mM CaCl.sub.2, pH 8.0, as described in
Example XI after incubation in the organic solvent. Half-lives for the
various mutant subtilisins are reported in Table IX.
TABLE IX
______________________________________
Half-lives for inactivation of wild-type and
variants of substilisin E in the presence of DMF.
Variant
80% DMF, 30.degree. C. t.sub.1/2 (h)
40% DMF, 50.degree. C. t.sub.1/2 (h)
______________________________________
WT 5.7 4.7
D248N 10.2 3.7
D248A 10.3 3.6
D248L 11.1 4.2
N218S 10.2 10.0
N218S +
19.2 8.0
D248N
______________________________________
Each of the variants is significantly more stable than the wild-type enzyme
in the presence of DMF. The double variant N218S+D248N is more than three
times as stable as the wild-type enzyme in 80% DMF. This example also
demonstrates that mutations affecting subtilisin stability in organic
solvents can be combined to obtain greater enhancements.
While the invention has been described in detail with reference to certain
preferred embodiments thereof, it will be understood that modifications
and variations are within the spirit and scope of that which is described
and claimed.
Summary of Sequences
Sequence ID No. 1 is the amino acid sequence of wild-type subtilisin E.
Sequence ID Nos. 2 and 3 are PCR primer sequences used for the random
mutagenesis of subtilisin E.
Sequence ID Nos. 4-6 are deoxyoligonucleotides, corresponding to the
specific mutations D248N, D248A, D248L, and N218S, respectively. These
oligos were used for site-directed mutagenesis of the HindIII-BamHI DNA
fragment of the mature subtilisin E gene.
__________________________________________________________________________
SEQUENCE LISTING
(1) GENERAL INFORMATION:
(iii) NUMBER OF SEQUENCES: 7
(2) INFORMATION FOR SEQ ID NO:1:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 275 amino acids
(B) TYPE: amino acid
(D) TOPOLOGY: linear
(ii) MOLECULE TYPE: peptide
(iii) HYPOTHETICAL: NO
(iv) ANTI-SENSE: NO
(vi) ORIGINAL SOURCE:
(A) ORGANISM: Bacillus subtilis
(B) STRAIN: I168
(xi) SEQUENCE DESCRIPTION: SEQ ID NO:1:
AlaGlnSerValProTyrGlyIleSerGlnIleLysAlaProAlaLeu
151015
HisSerGl nGlyTyrThrGlySerAsnValLysValAlaValIleAsp
202530
SerGlyIleAspSerSerHisProAspLeuAsnValArgGlyGlyAla
354045
SerPheValProSerGluThrAsnProTyrGlnAspGlySerSerHis
505560
GlyThrHisValAlaGlyTh rIleAlaAlaLeuAsnAsnSerIleGly
65707580
ValLeuGlyValAlaProSerAlaSerLeuTyrAlaValLysValLeu
859095
AspSerThrGlySerGlyGlnTyrSerTrpIleIleAsnGlyIleGlu
100105110
TrpAlaIleSerA snAsnMetAspValIleAsnMetSerLeuGlyGly
115120125
ProThrGlySerThrAlaLeuLysThrValValAspLysAlaValSer
130 135140
SerGlyIleValValValAlaAlaAlaGlyAsnGluGlySerSerGly
145150155160
SerThrSerThrValGl yTyrProAlaLysTyrProSerThrIleAla
165170175
ValGlyAlaValAsnSerSerAsnGlnArgAlaSerPheSerSerAla
180 185190
GlySerGluLeuAspValMetAlaProGlyValSerIleGlnSerThr
195200205
LeuProGlyGlyThrTyr GlyAlaTyrAsnGlyThrSerMetAlaThr
210215220
ProHisValAlaGlyAlaAlaAlaLeuIleLeuSerLysHisProThr
225230 235240
TrpThrAsnAlaGlnValArgAspArgLeuGluSerThrAlaThrTyr
245250255
LeuGlyAsnSerPhe TyrTyrGlyLysGlyLeuIleAsnValGlnAla
260265270
AlaAlaGln
275
(2) INFORMATION FOR SEQ ID NO:2:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 18 base pairs
(B ) TYPE: nucleic acid
(C) STRANDEDNESS: single
(D) TOPOLOGY: linear
(ii) MOLECULE TYPE: cDNA
(vi) ORIGINAL SOURCE:
(A) ORGANISM: PCR Primer
(xi) SEQUENCE DESCRIPTION: SEQ ID NO:2:
GCGGAGCAAGCTTCGTAC18
(2) INFORMATION FOR SEQ ID NO:3:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 29 base pairs
(B) TYPE: nucleic acid
(C) STRANDEDNESS: single
(D) TOPOLOGY: linear
(ii) MOLECULE TYPE: cDNA
(vi) ORIGINAL SOURCE:
(A) ORGANISM: PCR Primer
(xi) SEQUENCE DESCRIPTION: SEQ ID NO:3:
CGGGATCCTGCAGGATTCAACATGCGGAG 29
(2) INFORMATION FOR SEQ ID NO:4:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 23 base pairs
(B) TYPE: nucleic acid
(C) STRANDEDNESS: single
(D) TOPOLOGY: linear
(ii) MOLECULE TYPE: cDNA
(vi) ORIGINAL SOURCE:
(A) ORGANISM: D248N site-directed mutagenesis primer
(xi) SEQUENCE DESCRIPTION: SEQ ID NO:4:
TTTCTAAACGGTTACGGACTTGC 23
(2) INFORMATION FOR SEQ ID NO:5:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 17 base pairs
(B) TYPE: nucleic acid
(C) STRANDEDNESS: single
(D) TOPOLOGY: linear
(ii) MOLECULE TYPE: cDNA
(vi) ORIGINAL SOURCE:
(A) ORGANISM: D248A site directed mutagenesis primer
(xi) SEQUENCE DESCRIPTION: SEQ ID NO:5:
CTAAACGAGCACGGACT17
(2) INFORMATION FOR SEQ ID NO:6:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 17 base pairs
(B) TYPE: nucleic acid
(C) STRANDEDNESS: single
(D) TOPOLOGY: linear
(ii) MOLECULE TYPE: cDNA
(vi) ORIGINAL SOURCE:
(A) ORGANISM: D248L site directed mutagenesis primer
(xi) SEQUENCE DESCRIPTION: SEQ ID NO:6:
CTAAACGAAGACGGACT17
(2) INFORMATION FOR SEQ ID NO:7:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 17 base pairs
(B) TYPE: nucleic acid
(C) STRANDEDNESS: single
(D) TOPOLOGY: linear
(ii) MOLECULE TYPE: cDNA
(vi) ORIGINAL SOURCE:
(A) ORGANISM: N218S site directed mutagenesis primer
(xi) SEQUENCE DESCRIPTION: SEQ ID NO:7:
CGCTTATAGCGGAACGT17
Top