Back to EveryPatent.com
United States Patent |
5,316,908
|
Carlson
,   et al.
|
May 31, 1994
|
Size markers for electrophoretic analysis of DNA
Abstract
The present invention discloses a DNA marker ladder useful in Southern blot
hybridizations. The ladder is made up of pooled DNA restriction
endonuclease digests, where each restriction digest contains at least one
fragment complementary to a probe and at least one fragment not
complementary to the probe. The regions of complementarity between the
probe and the complementary fragments are double-stranded segments of the
fragments. The ladder is characterized by an approximately even spacing of
bands, resulting from choosing fragments having an logarithmic size
distribution. Kits incorporating this ladder and a probe or means for
making a probe or a probe and a means for labeling a probe are also
disclosed.
Inventors:
|
Carlson; David P. (Gaithersburg, MD);
Watkins; Paul C. (Gaithersburg, MD);
Klevan; Leonard (Gaithersburg, MD)
|
Assignee:
|
Life Technologies, Inc. (Gaithersburg, MD)
|
Appl. No.:
|
522406 |
Filed:
|
July 13, 1990 |
Current U.S. Class: |
435/6; 204/461; 204/462; 435/967; 436/8 |
Intern'l Class: |
C12Q 001/68 |
Field of Search: |
435/6,7.4,967
436/8
935/1,76,78
|
References Cited
U.S. Patent Documents
4415732 | Nov., 1983 | Caruthers et al. | 536/27.
|
4458066 | Jul., 1984 | Caruthers et al. | 536/27.
|
4500707 | Feb., 1985 | Caruthers et al. | 536/27.
|
4668777 | May., 1987 | Caruthers et al. | 536/27.
|
4762779 | Aug., 1988 | Snitman | 436/6.
|
4771384 | Sep., 1988 | Daniels et al. | 935/75.
|
4965349 | Oct., 1990 | Woo et al. | 536/27.
|
Foreign Patent Documents |
63-113359 | May., 1988 | JP.
| |
WO89/09780 | Oct., 1989 | WO.
| |
Other References
Pharmacia Catalogue, "Molecular Weight Markers", p. 23.
Gralla, Proc. Natl. Acad. Sci. USA, vol. 82, May 1985, Rapid "footprinting"
on supercoiled DNA, pp. 3078-3081. pp. 3078-3081.
Carman et al., J. Clin. Microb., Nov. 1989, vol. 27, No. 11, Detection of
Enzymatically Amplified Human Immunodeficiency Virus DNA by
Oligonucleotide Solution Hybridization and by Incorporation of
Radiolabeled Deoxynucleotides, pp. 2570-2573.
Budowle and Baechtel, Appl. Theor. Electrophoresis 1: 181-187 (1990).
1989 GIBCO/BRL Catalogue & Reference Guide, Life Technologies, Inc.,
Gaithersburg, Md., pp. 3,4, 8-18, 21, 22, 24, 26, 27, 29, 30 and 32.
1989-1990 New England Biolabs, Inc. Catalog, pp. 9-11, 14-20, 23, 24, 26,
28, 29, 31 and 33.
Package inserts supplied with Ava I, Ava II, Bam H I, Bgl I, Bgl II, Bst E
II, Cfo I, Cla I, Cvn I, Dde I, Dra I, Eco R I, Eco R V, Hae II, Hin c II,
Hin d III, Hin f I, Msp I, Nci I, Nco I, Nde I, Nsi I, Rsa I, Sau 3A I,
Sma I, Ssp I, SstI, Tha I, Xba I, and Xho I which were available on Jul.
13, 1990 and supplied by BRL/Life Technologies, Inc.
Bernards et al., Chemical Abstracts, No. 92470r, 105(11):187 (1986).
Huang J. et al., Chemical Abstracts No. 34093a 107(5):175 (1987).
Jones C. P. et al., Chemical Abstracts No. 230760h 112(25):172 (1990).
Rickwood D. et al., Practical Approaches in Biochemistry Series, pp.
227-232, Appendix I.
European Search Report for Applicants' Co-pending European Application EP O
466 404 A1.
|
Primary Examiner: Yarbrough; Amelia Burgess
Attorney, Agent or Firm: Sterne, Kessler, Goldstein & Fox
Claims
What is claimed is:
1. A DNA marker system comprising at least 5 DNA restriction endonuclease
digests pooled together and a single nucleic acid probe, wherein
(1) a DNA restriction endonuclease digest is a collection of DNA fragments
resulting from digestion of a DNA by one or more restriction
endonucleases,
(2) each restriction digest is obtained from the same DNA molecule;
(3) each restriction digest contains a first DNA fragment complementary to
said probe,
(4) each restriction digest contains at least one second DNA fragment not
complementary to said probe,
(5) the region of complementarity between said probe and the first DNA
fragment of each digest is a double stranded segment of the first
fragment, and
(6) wherein when said DNA restriction digests are separated by
electrophoresis and annealed to said probe, a detectably labeled DNA
marker ladder is obtained.
2. A system as in claim 1, comprising at least 10 DNA restriction
endonuclease digests pooled together.
3. A system as in claim 2, comprising at least 15 DNA restriction
endonuclease digests pooled together.
4. A system as in claim 3, comprising at least 20 DNA restriction
endonuclease digests pooled together.
5. A system as in claim 4, comprising at least 25 DNA restriction
endonuclease digests pooled together.
6. A system as in claim 1, wherein adjacent target fragment pairs differ in
size by no more than a measure of about 0.1.
7. A system as in claim 6, wherein adjacent target fragment pairs differ in
size by no more than a measure of about 0.075.
8. A system as in claim 1, wherein adjacent target fragment pairs differ in
size by at least a measure of about 0.025.
9. A system as in claim 6, wherein adjacent target fragment pairs differ in
size by at least a measure of about 0.025 and by no more than a measure of
about 0.075.
10. A system as in claim 1, wherein the largest target fragment is at least
10-fold longer than the smallest target fragment.
11. A system as in claim 10, wherein the largest target fragment is at
least 14-fold longer than the smallest target fragment.
12. A system as in claim 11, wherein the largest target fragment is at
least 17-fold longer than the smallest target fragment.
13. A system as in claim 1, wherein the target fragments are derived from
bacteriophage .lambda..
14. A system as in claim 13, wherein the target fragments may be detected
with a probe having sequence present in or a sequence complementary to a
sequence present in nucleotides 33,783 to 34,212 of bacteriophage
.lambda..
15. A system as in claim 14, wherein the target fragments include at least
10 fragments are chosen from a group of DNA fragments having sizes and
ends of 11,203 bp Xba I/Bgl II, 9,416 bp Hind III, 8,271 bp Sma I, 7,421
bp EcoR I, 6,442 bp Ava II, 5,861 bp Hae II, 5,415 bp EcoR V/Ava II, 4,716
bp Ava I, 4,333 bp Ava II/Hind III, 4,045 bp Bgl I/BstE II, 3,812 bp Ava
II/BstE II, 3,599 bp Dra I, 3,397 bp Xho I/Hind III, 3,101 bp Sma I/Hae
II, 2,876 bp Xho I/BstE II, 2,650 bp Nci I, 2,433 bp Nde I, 2,293 bp Msp
I, 2,213 bp Xho I/Bgl II, 2,015 bp Hinc II, 1,861 bp EcoR V/Msp I, 1,763
bp Xho I/Hinc II, 1,672 bp EcoR V/Hinc II, 1,568 bp Rsa I, 1,431 bp Ssp I,
1,342 bp Msp I/BamH I, 1,287 bp Tha I/Rsa I, 1,176 bp Sau3A I, 1,112 bp
Cla I, 993 bp Cfo I, 910 bp EcoR V/BamH I, 844 bp Hinf I, 784 bp Dde I,
730 bp EcoR V/Cvn I, and 653 bp Hinf I/Rsa I.
16. A system as in claim 15, wherein the target fragments include at least
15 fragments and are chosen from a group of DNA fragments having sizes and
ends of 11,203 bp Xba I/Bgl II, 9,416 bp Hind III, 8,271 bp Sma I, 7,421
bp EcoR I, 6,442 bp Ava II, 5,861 bp Hae II, 5,415 bp EcoR V/Ava II, 4,716
bp Ava I, 4,333 bp Ava II/Hind III, 4,045 bp Bgl I/BstE II, 3,812 bp Ava
II/BstE II, 3,599 bp Dra I, 3,397 bp Xho I/Hind III, 3,101 bp Sma I/Hae
II, 2,876 bp Xho I/BstE II, 2,650 bp Nci I, 2,433 bp Nde I, 2,293 bp Msp
I, 2,213 bp Xho I/Bgl II, 2,015 bp Hinc II, 1,861 bp EcoR V/Msp I, 1,763
bp Xho I/Hinc II, 1,672 bp EcoR V/Hinc II, 1,568 bp Rsa I, 1,431 bp Ssp I,
1,342 bp Msp I/BamH I, 1,287 bp Tha I/Rsa I, 1,176 bp Sau3A I, 1,112 bp
Cla I, 993 bp Cfo I, 910 bp EcoR V/BamH I, 844 bp Hinf I, 784 bp Dde I,
730 bp EcoR V/Cvn I, and 653 bp Hinf I/Rsa I.
17. A system as in claim 16, wherein the target fragments comprise at least
20 fragments and are chosen from a group of DNA fragments having sizes and
ends of 11,203 bp Xba I/Bgl II, 9,416 bp Hind III, 8,271 bp Sma I, 7,421
bp EcoR I, 6,442 bp Ava II, 5,861 bp Hae II, 5,415 bp EcoR V/Ava II, 4,716
bp Ava I, 4,333 bp Ava II/Hind III, 4,045 bp Bgl I/BstE II, 3,812 bp Ava
II/BstE II, 3,599 bp Dra I, 3,397 bp Xho IIHind III, 3,101 bp Sma IIHae
II, 2,876 bp Xho IIBstE II, 2,650 bp Nci I, 2,433 bp Nde I, 2,293 bp Msp
I, 2,213 bp Xho I/Bgl II, 2,015 bp Hinc II, 1,861 bp EcoR V/Msp I, 1,763
bp Xho I/Hinc II, 1,672 bp EcoR V/Hinc II, 1,568 bp Rsa I, 1,431 bp Ssp I,
1,342 bp Msp I/BamH I, 1,287 bp Tha I/Rsa I, 1,176 bp Sau3A I, 1,112 bp
Cla I, 993 bp Cfo I, 910 bp EcoR V/BamH I, 844 bp Hinf I, 784 bp Dde I,
730 bp EcoR V/Cvn I, and 653 bp Hinf I/Rsa I.
18. A system as in claim 17, wherein the target fragments comprise at least
25 fragments and are chosen from a group of DNA fragments having sizes and
ends of 11,203 bp Xba I/Bgl II, 9,416 bp Hind III, 8,271 bp Sma I, 7,421
bp EcoR I, 6,442 bp Ava II, 5,861 bp Hae II, 5,415 bp EcoR V/Ava II, 4,716
bp Ava I, 4,333 bp Ava II/Hind III, 4,045 bp Bgl I/BstE II, 3,812 bp Ava
II/BstE II, 3,599 bp Dra I, 3,397 bp Xho I/Hind III, 3,101 bp Sma I/Hae
II, 2,876 bp Xho I/BstE II, 2,650 bp Nci I, 2,433 bp Nde I, 2,293 bp Msp
I, 2,213 bp Xho I/Bgl II, 2,015 bp Hinc II, 1,861 bp EcoR V/Msp I, 1,763
bp Xho I/Hinc II, 1,672 bp EcoR V/Hinc II, 1,568 bp Rsa I, 1,431 bp Ssp I,
1,342 bp Msp I/BamH I, 1,287 bp Tha I/Rsa I, 1,176 bp Sau3A I, 1,112 bp
Cla I, 993 bp Cfo I, 910 bp EcoR V/BamH I, 844 bp Hinf I, 784 bp Dde I,
730 bp EcoR V/Cvn I, and 653 bp Hinf I/Rsa I.
19. A system as in claim 17, wherein the target fragments comprise at least
25 fragments and are chosen from a group of DNA fragments having sizes and
ends of 9,416 bp Hind III, 8,271 bp Sma I, 7,421 bp EcoR I, 6,442 bp Ava
II, 5,861 bp Hae II, 5,415 bp EcoR V/Ava II, 4,716 bp Ava I, 4,333 bp Ava
II/Hind III, 3,812 bp Ava II/BstE II, 3,397 bp Xho I/Hind III, 3,101 bp
Sma I/Hae II, 2,876 bp Xho I/BstE II, 2,650 bp Nci I, 2,433 bp Nde I,
2,213 bp Xho I/Bgl II, 2,015 bp Hinc II, 1,861 bp EcoR V/Msp I, 1,672 bp
EcoR V/Hinc II, 1,568 bp Rsa I, 1,431 bp Ssp I, 1,287 bp Tha I/Rsa I,
1,176 bp Sau3A I, 993 bp Cfo I, 910 bp EcoR V/BamH I, 784 bp Dde I, and
653 bp Hinf I/Rsa I.
20. A system as in claim 19, wherein the target fragments have sizes and
ends of 22,621 bp Sst I, 15,004 bp Xho I, 11,919 bp Nco I/Bgl I, 9,416 bp
Hind III, 8,271 bp Sma I, 7,421 bp EcoR I, 6,442 bp Ava II, 5,861 bp Hae
II, 5,415 bp EcoR V/Ava II, 4,716 bp Ava I, 4,333 bp Ava II/Hind III,
3,812 bp Ava II/BstE II, 3,397 bp Xho I/Hind III, 3,101 bp Sma I/Hae II,
2,876 bp Xho I/BstE II, 2,650 bp Nci I, 2,433 bp Nde I, 2,213 bp Xho I/Bgl
II, 2,015 bp Hinc II, 1,861 bp EcoR V/Msp I, 1,672 bp EcoR V/Hinc II,
1,568 bp Rsa I, 1,431 bp Ssp I, 1,287 bp Tha I/Rsa I, 1,176 bp Sau3A I,
993 bp Cfo I, 910 bp EcoR V/BamH I, 784 bp Dde I, 653 bp Hinf I/Rsa I, and
526 bp Nsi I.
21. A system as in claim 1, wherein relative quantities of each fragment is
such that in a Southern blot hybridization observed band intensities are
uniform within a factor of 2.
22. A DNA marker kit comprising
(a) a DNA marker system comprising at least 5 DNA restriction endonuclease
digests pooled together, wherein
(1) a DNA restriction endonuclease digest is a collection of DNA fragments
resulting from digestion of a DNA by one or more restriction
endonucleases,
(2) each restriction digest is obtained from the same DNA molecule;
(3) each restriction digest contains a first DNA fragment complementary to
a probe,
(4) each restriction digest contains at least one second DNA fragment not
complementary to said probe,
(5) the region of complementarity between said probe and the first DNA
fragment of each digest is a double stranded segment of the first
fragment, and
(b) a first probe nucleic acid which is complementary to said first target
DNA fragments;
wherein when said DNA restriction digests are separated by electrophoresis
and annealed to said probe, a detectably labeled DNA marker ladder is
obtained.
23. A kit as in claim 22, further comprising a second probe nucleic acid
complementary to target DNA fragments, wherein the first probe and the
second probe are DNA, are complementary to each other at their 3'-ends,
and are not complementary to each other at their 5'-ends.
24. A kit as in claim 22, wherein the sequence of the first probe is
present in or is complementary to a sequence present in nucleotides 33,783
to 34,212 of bacteriophage .lambda..
25. A kit as in claim 22, further comprising an enzyme capable of labeling
the probe.
26. A kit as in claim 25, further comprising an enzyme capable of
radioactively labeling the probe.
27. A kit as in claim 25, wherein the enzyme is a DNA polymerase.
28. A kit as in claim 27, wherein the enzyme is the Klenow fragment of E.
coli DNA polymerase I.
29. A kit as in claim 25, wherein the enzyme is polynucleotide kinase.
30. A DNA marker kit comprising the DNA marker system of claim 1 and a
means for making a probe.
31. A kit as in claim 30, wherein the means for making a probe is a means
for making an RNA probe.
32. A kit as in claim 31, wherein the means for making a probe comprises
(a) a means-DNA, wherein the means-DNA comprises probe sequences under
control of a promoter, and
(b) an RNA polymerase capable of initiating transcription from the promoter
and transcribing probe sequences of the means-DNA.
Description
FIELD OF THE INVENTION
The present invention is in the field of molecular biology and specifically
relates to the technique of gel electrophoresis of nucleic acid fragments.
BACKGROUND OF THE INVENTION
A number of mixtures of nucleic acid fragments are commercially available
that can be used as markers for determining the sizes of nucleic acid
molecules of experimental interest. For example, Collaborative Research,
Inc. (Lexington, Mass.) has sold a marker ladder ("Quik-Kit Size Markers",
cat. no. 30013) that is a mixture of 12 bacteriophage .lambda. (lambda)
fragments. They are visualized by hybridization with two .sup.32 P-labeled
12-nucleotide synthetic oligonucleotides, complementary to the left and
right bacteriophage cos sites.
A large number of other DNA marker fragments are available from numerous
suppliers. In every case, except the Collaborative markers, these marker
fragments are restriction digests of several bacteriophage or plasmid
DNAS. Every DNA fragment in the digests can then be visualized by
hybridization to the same bacteriophage or plasmid DNAS.
Other DNA marker ladders often use collections of fragments that have a
quasi-random size distribution. For example, the quasi-random size
distribution may be made by a digest of a DNA, often .lambda. DNA, by a
single restriction enzyme. Alternatively, the fragments may vary linearly
with molecular weight, i.e. adjacent bands may differ by about 1000 base
pairs (e.g. "1 Kb DNA Ladder", cat. no. 5615SA, BRL, Gaithersburg, Md.).
Bands in these linear ladders are not evenly spaced after electrophoresis,
they are "compressed" in the "upper", higher molecular weight region of a
gel. However some ladders have been constructed and sold that are
logarithmically spaced ("GenePrint.TM.", cat. no. DG1911, Promega,
Madison, Wis.).
SUMMARY OF THE INVENTION
The drawback of conventional marker ladders is that the signal generated by
each fragment is proportional to its length. As a result, levels of signal
that allow visualization of small fragments (e.g. 500 base pairs (bp))
give too much signal in large fragments (e.g. 20 kbp) for optimal
resolution. This drawback is overcome in the marker ladder of the present
invention.
The invention consists of a "target DNA" and a "probe DNA". Target DNA is
constructed by pooling several restriction endonuclease digests of a
single DNA of known sequence. Each restriction endonuclease digest
generates a number of DNA fragments, one of which contains a specific
sequence "S". The restriction endonucleases and the sequence "S" are
chosen so that the set of DNA fragments containing the same sequence "S"
would give approximately a logarithmic distribution of lengths. In other
words, when electrophoresed through a gel where nucleic acid fragments
migrate as a logarithmic function of molecular weight, the marker
fragments will be approximately evenly spaced and will leave no molecular
weight range without a marker. When the pooled, digested DNA is
electrophoresed in a gel matrix, a ladder of fragments is generated
containing sequence "S", with approximately equal spacing between them.
The probe DNA is complementary to sequence "S", and therefore can be bound
specifically to sequence "S" by nucleic acid hybridization. When the probe
DNA is labeled (for example, with radioactive phosphorus, biotin, or
alkaline phosphatase) it allows visualization of the DNA fragments
containing sequence "S".
The present invention preferably utilizes internal labeling sites, thus
allowing both ends of the DNA fragment to be altered by restriction
endonuclease cleavage. Therefore, a greater variety of DNA fragment sizes
can be generated.
The present invention is expected to be useful to research laboratories
employing DNA or RNA analysis techniques and it is especially useful to
laboratories and law enforcement agencies using DNA analysis to identify
individuals.
BRIEF DESCRIPTION OF THE DRAWINGS
FIG. 1 is a schematic, scale drawing of the how the first and second
molecular marker kits would migrate on an electrophoretic gel. The
positions were calculated by assuming that relative mobilities are a
linear function of the logarithm of the length of the fragment in base
pairs (bp). The length of each band in bp is indicated to the left of the
band.
DETAILED DESCRIPTION OF THE INVENTION
The present invention is a DNA size marker system, preferably a DNA marker
ladder, having pooled DNA restriction endonuclease digests. By the term
"DNA marker ladder" is meant DNA fragments of varying sizes containing the
sequence "S" that when electrophoresed through a gel matrix migrate with
approximately equal spacing between them. "Equal spacing" may refer either
to the physical location on a gel after electrophoresis (e.g. bands about
0.5 cm. apart) or to the size being marked (e.g. bands differing in size
by 1,000 bp). Each restriction digest contains at least one DNA fragment
having an "S" sequence complementary to a probe and one or more other DNA
fragments not complementary to the probe. The same probe is thus used for
all restriction digests. The region of complementarity between the probe
and the first DNA fragment of each digest is a double-stranded segment of
the first fragment.
The number of restriction digests pooled is at least 5, preferably at least
10, more preferably at least 15, yet more preferably at least 20, and most
preferably at least 25. In the present invention, the largest target
fragment is at least 10-fold, preferably 14-fold, and most preferably
17-fold, longer than the smallest target fragment.
In some embodiments, target fragments most similar in size differ in length
by defined amounts. As defined herein, the "measure", M, of the difference
in size is herein calculated by the formula M=log.sub.10 (U)-log.sub.10
(L), where U and L are the respective lengths in bp of the upper and lower
of the two adjacent bands being compared. This equation is equivalent to
10.sup.M =U/L. As a means of illustration, Table 1 shows the relationship
between M, U, and L, (U and L are in bp) with the latter being held
constant at 1,000 bp. Note that if U and L are both changed by the same
factor or multiple, M remains constant. For example, bands of 1,059 bp and
1,000 bp and bands of 530 bp and 500 bp both differ in size by measures of
0.025.
Preferably, target fragment pairs most similar in size differ in size by no
more than a measure of about 0.1 (e.g. bands of 1,259 bp and 1,000 bp),
and, most preferably, by no more than a measure of about 0.075 (e.g. bands
of 1,188 bp and 1,000 bp). In other words, bands that after gel
electrophoresis and Southern blotting would be adjacent to each other
differ in size by no more than a measure of about 0.1. As exemplified
herein, the target fragment pairs most similar in size differ in size by
at least a measure of about 0.025 (e.g. bands of 1,059 bp and 1,000 bp).
Preferably, the target fragments all anneal to a single probe sequence or
its complement. More than one molecular species may be in the probe,
provided that each digest contains at least one fragment that can anneal
to a probe molecule and at least one fragment that cannot anneal to a
probe molecule. Although not meant to be limiting, as exemplified herein,
the target fragments are derived from bacteriophage .lambda.. As also
exemplified herein, the target fragments may be detected with a probe
having sequence present in or a sequence complementary to a sequence
present in nucleotides 33,783 to 34,212 of bacteriophage .lambda..
The present invention may further be included in a kit having, in addition
to the target fragments, a probe nucleic acid complementary to target DNA
fragments. As exemplified herein, the sequence of the probe is present in
or is complementary to a sequence present in nucleotides 33,783 to 34,212
of bacteriophage .lambda..
The kit may further include an enzyme capable of radioactively labeling the
probe, e.g. polynucleotide kinase or the Klenow fragment of E. coli DNA
polymerase I.
Preferably, the target DNA is constructed from a single bacteriophage or
plasmid. The target DNA preferably consists of at least 10 restriction
endonuclease digests of that target DNA. Each restriction digest of the
target DNA creates one fragment complementary to the probe DNA, and the
lengths of these fragments may be distributed in a logarithmic array.
Preferably, the probe DNA is supplied as a pair of synthetic
oligonucleotides. Each of the probe oligonucleotides is preferably at
least 20 nucleotides in length and are complementary to each other for 15
to 30 base pairs at their 3'-ends. These oligonucleotides can then be
labeled by incorporation of labeled nucleotides in a chain extension
reaction, with each oligonucleotide serving as a primer and using the
other as a template in the chain extension reaction. As an illustration,
in the following arrangement the upper and lower case letters are
complements of each other:
##STR1##
After chain extension with a labeled nucleotide, here indicated by
underlining, the oligonucleotides will have the following structure:
##STR2##
This structure can then be separated to form two probes labeled at their
3'-ends: 5'abc . . . lmnopqrst . . . xyz3' and 5'ZYX . . . TSRQPONML . . .
CBA3'.
The probe may be labeled with a radioisotope (e.g. .sup.3 H, .sup.32 P,
.sup.35 S, or .sup.125 I), a ligand (e.g. biotin), a hapten (e.g.
dinitrophenol, fluorescein), or an enzyme (e.g. alkaline phosphatase,
.beta.-galactosidase, horseradish peroxidase, microperoxidase), or any
other suitable labeling method known to or discovered by the art. The
choice of labeling method will generally depend on the chosen method for
detecting the experimental sample for which the marker kit is serving as a
molecular weight standard.
A DNA marker kit of the present invention also include a means for making a
probe, instead of just a means for added labeled nucleotides, e.g. with
DNA polymerase, or another labeled entity, e.g. .sup.32 PO.sub.4 and
kinase. This means may be a means for making an RNA probe. The means for
making a probe may include being probe sequences under control of a
promoter (i.e. a means-DNA). The kit could also include an RNA polymerase
capable of initiating transcription from the promoter and transcribing
probe sequences of the means-DNA. Examples of such means-DNAs and RNA
polymerases are well known in the art. For instance, DNA sequences
downstream from SP6 promoters are commonly transcribed in vitro by SP6 RNA
polymerase and sequences downstream from T7 promoters are commonly
transcribed in vitro by T7 RNA polymerase.
In an actual gel electrophoresis, the bands may not be spaced exactly as
shown in FIG. 1 due to well known phenomena concerning mobility of very
large and very small fragments, sample loading effects, and
inhomogeneities in the gel. With the use of the present invention, these
effects can be detected more readily. Indeed, due to the way that DNA
fragments run in 1.0% agarose gels, the largest (e.g. above 10 kbp) target
fragments of the exemplified kits will appear more evenly spaced than as
illustrated in FIG. 1.
The DNA marker fragments should be hybridized with the probe, with the
fragments which bind probe molecules being the fragments detected. When
the total DNA of these ladder kits is inspected by non-specific,
sequence-independent staining, e.g. with ethidium bromide, the ladder DNA
may appear as a "smear" due to the multitude of fragments.
Although specific restriction endonucleases are recited in the Examples and
the Claims, it will be recognized that isoschizomers, i.e. enzymes that
have the same recognition sequence but cut in a different fashion, can be
substituted and the same result will be achieved.
EXAMPLES
Example 1: Common Materials and Methods
E. coli bacteriophage .lambda. (lambda) DNA (cIind 1, ts857, Sam 7) was the
source of all target DNAs.
The probe DNA for either of the ladders exemplified herein may consist of
any DNA from between nucleotides 33,783 and 34,212 of that .lambda. DNA.
Oligonucleotides were synthesized using standard phosphoramidite chemistry
well known to the art.
To make a restriction digest, .lambda. DNA was digested with one or two
restriction endonucleases. The enzymes used for individual digests are
indicated in Tables 2 and 3. Digestions were performed under standard
conditions, generally according to the instructions of the enzyme's
manufacturer. Restriction digests were pooled after digestion.
Example 2: First Marker Kit
In the first ladder, the target DNA consisted of pooled equal amounts of 31
different restriction digests of phage .lambda. DNA. The probe DNA was a
26-base oligonucleotide having a sequence of
5'GCGACATTGCTCCGTGTATTCACTCG3'
which is complementary to nucleotides 34,000 to 34,025 of the standard
.lambda. DNA map. This oligonucleotide was labeled at its 5'-end by T4
polynucleotide kinase and [.gamma.-.sup.32 P]-ATP (BRL cat. no. 8060SA,
Life Technologies, Inc., Gaithersburg, Md.). Hybridization of .sup.32
P-labeled probe DNA to a Southern blot of the target DNA revealed bands of
the expected pattern (FIG. 1). The restriction endonuclease digestions
used, the sizes of the fragments generated thereby, the .lambda. sequence
coordinates thereof, and the measures of the size differences between
adjacent bands are listed in Table 2.
Example 3: Second Marker Kit
This first kit was improved in three ways. The first improvement was to
change the probe DNA such that (a) it could easily be labeled with DNA
polymerase as well as polynucleotide kinase, and (b) it would remain
hybridized to the Southern blot even when washed at high temperature
(65.degree. C.) and low salt concentration (0.015M NaCl). This was
achieved by utilizing two 70-base, synthetic oligonucleotides that were
complementary to opposite strands of .lambda. DNA, and also complementary
to one another for 15 bases at their 3'-termini. The two oligonucleotides
were as follows:
##STR3##
The underlined segments are complementary to each other. The first
oligonucleotide is encoded by sequences from coordinates 34,078 (5'-end)
to 34,147 (3'-end) and the second oligonucleotide is encoded by sequences
from 34,133 (3'-end) to 34,202 (5'-end) on the standard .lambda. map.
These oligonucleotides were mixed together with each other and the Klenow
fragment of E. coli DNA polymerase I and four deoxynucleotide
triphosphates, one of which was .alpha.-.sup.32 P-labelled. The polymerase
extended each oligonucleotide using the other as a template and produced
two .alpha.-.sup.32 P-labelled, complementary oligonucleotides. This new
probe hybridizes to the same target fragments as the previous probe. A
mixture of the new 70-mers was labeled with the large fragment of E. coli
DNA polymerase I and hybridized to a Southern blot of the target DNA.
The second improvement was to change the target DNA to give a more linear
spacing on the Southern blot.
The third improvement was to increase the amounts, i.e. relative copy
number or the dosage, of the target DNA for the largest and smallest
bands. Large DNA fragments blot inefficiently. As is well known in the
art, small fragments are retained on membranes poorly during
hybridization. Therefore, the signal from large DNA fragments and small
DNA fragments tends to be less than the signal from bands in the middle
range. This improvement compensated for that effect.
Hybridization of .sup.32 P-labeled probe DNA to a Southern blot of the
target DNA revealed bands of the expected pattern (FIG. 1). The
restriction endonuclease digestions and dosage used, the sizes of the
fragments generated thereby, the .lambda. sequence coordinates thereof,
and measures of the size differences between adjacent bands are listed in
Table 3.
Although the foregoing refers to particular preferred embodiments, it will
be understood that the present invention is not so limited. It will occur
to those of ordinary skill in the art that various modifications may be
made to the disclosed embodiments and that such modifications are intended
to be within the scope of the present invention, which is defined by the
following Claims.
TABLE 1
______________________________________
Examples of Relationships between the Measure of the Difference
in Size and Sizes of Fragments.
M U L
______________________________________
0.0 1,000 1,000
0.025 1,059 1,000
0.05 1,122 1,000
0.075 1,188 1,000
0.1 1,259 1,000
0.15 1,413 1,000
0.2 1,585 1,000
0.3 1,995 1,000
0.5 3,162 1,000
0.7 5,012 1,000
1.0 10,000 1,000
______________________________________
M = log.sub.10 (U) log.sub.10 (L) = Measure of the difference in size.
U = Size in bp of the upper band in a comparison.
L = Size in bp of the lower band in a comparison, held constant at 1,000
bp.
TABLE 2
______________________________________
DNA Analysis Marker Ladder Target DNA Fragments, First Kit
Lambda Coordinates
Enzyme(s) Size Diff. Left Right
______________________________________
Xba I* 23,994 0.204 24,508 48,502
Xho I 15,004 0.127 33,498 48,502
Xba I/Bgl II*
11,203 0.075 24,508 35,711
Hind III 9,416 0.056 27,479 36,895
Sma I 8,271 0.047 31,619 39,890
EcoR I 7,421 0.061 31,747 39,168
Ava II 6,442 0.041 32,562 39,004
Hae II 5,861 0.034 28,859 34,720
EcoR V/Ava II
5,415 0.060 33,589 39,004
Ava I 4,716 0.067 33,498 38,214
Bgl I/BstE II*
4,045 0.026 32,329 36,374
Ava II/BstE II
3,812 0.025 32,562 36,374
Dra I* 3,599 0.065 32,705 36,304
Sma I/Hae II
3,101 0.033 31,619 34,720
Xho I/BstE II
2,876 0.036 33,498 36,374
Nci I 2,650 0.037 33,158 35,808
Nde I 2,433 0.026 33,680 36,113
Msp I* 2,293 0.056 33,157 35,450
Hinc II 2,015 0.035 33,246 35,261
EcoR V/Msp I
1,861 0.023 33,589 35,450
Xho I/Hinc II*
1,763 0.051 33,498 35,261
Rsa I 1,568 0.040 32,868 34,436
Ssp I 1,431 0.028 33,572 35,003
Msp I/BamH I*
1,342 0.057 33,157 34,499
Sau3A I 1,176 0.024 33,323 34,499
Cla I* 1,112 0.087 33,585 34,697
EcoR V/BamH I
910 0.033 33,589 34,499
Hinf I* 844 0.064 33,783 34,627
EcoR V/Cvn I*
730 0.048 33,589 34,319
Hinf I/Rsa I
653 0.094 33,783 34,436
Nsi I 526 -- 33,686 34,212
______________________________________
Diff. = The difference, M, in size between the band and the band
immediately below, calculated by the formula, M = log.sub.10 (U)
log.sub.10 (L), where U and L are the lengths in bp of the upper and
lower, respectively, of the two bands being compared.
*indicates enzyme combinations used in the first ladder but not used in
the second ladder.
TABLE 3
______________________________________
DNA Analysis Marker Ladder Target
DNA Fragments, Second Kit
Lambda Coordinates
Enzyme(s) Size Diff. Left Right Dose
______________________________________
Sst I* 22,621 0.178 25,881 48,502 3
Xho I 15,004 0.100 33,498 48,502 3
Nco I/Bgl I*
11,919 0.102 32,329 44,248 3
Hind III 9,416 0.056 27,479 36,895 3
Sma I 8,271 0.047 31,619 39,890 3
EcoR I 7,421 0.061 31,747 39,168 3
Ava II 6,442 0.041 32,562 39,004 3
Hae II 5,861 0.034 28,859 34,720 1
EcoR V/Ava II
5,415 0.060 33,589 39,004 1
Ava I 4,716 0.037 33,498 38,214 1
Ava II/Hind III*
4,333 0.056 32,562 36,895 1
Ava II/BstE II
3,812 0.050 32,562 36,374 1
Xho I/Hind III*
3,397 0.040 33,498 36,895 1
Sma I/Hae II
3,101 0.033 31,619 34,720 1
Xho I/BstE II
2,876 0.036 33,498 36,374 1
Nci I 2,650 0.037 33,158 35,808 1
Nde I 2,433 0.041 33,680 36,113 1
Xho I/Bgl II*
2,213 0.041 33,498 35,711 1
Hinc II 2,015 0.035 33,246 35,261 1
EcoR V/Msp I
1,861 0.047 33,589 35,450 1
EcoR V/Hinc II*
1,672 0.028 33,589 35,261 1
Rsa I 1,568 0.040 32,868 34,436 1
Ssp I 1,431 0.046 33,572 35,003 1
Tha I/Rsa I*
1,287 0.039 33,149 34,436 1
Sau3A I 1,176 0.073 33,323 34,499 1
Cfo I* 993 0.038 33,726 34,719 1
EcoR V/BamH I
910 0.065 33,589 34,499 1
Dde I* 784 0.079 33,535 34,319 3
Hinf I/Rsa I
653 0.094 33,783 34,436 3
Nsi I 526 -- 33,686 34,212 3
______________________________________
Diff. = The difference, M, in size between the band and the band
immediately below, caculated by the formula M = log.sub.10 (U) log.sub.1
(L), where U and L are the lengths in bp of the upper and lower,
respectively, of the two bands being compared.
*indicates enzyme combinations used in the second ladder but not used in
the first ladder.
Dose refers to the relative amounts of each restriction digest.
Top