Back to EveryPatent.com
United States Patent |
5,281,531
|
Miyagawa
,   et al.
|
January 25, 1994
|
Host and vector for producing D-ribose
Abstract
Disclosed are (1) a method of producing D-ribose which comprises
cultivating a microorganism belonging to the genus Bacillus having
D-ribose producing ability in a medium, the microorganism belonging to the
genus Bacillus containing a DNA sequence participating in expression of a
gluconate operon which is partly or wholly modified so as to highly
express the gluconate operon in the microorganism belonging to the genus
Bacillus, accumulating D-ribose, and collecting D-ribose thus obtained;
(2) a novel microorganism belonging to the genus Bacillus having D-ribose
producing ability transformed with DNA which contains a DNA sequence
participating in expression of a gluconate operon which is partly or
wholly modified so as to highly express the gluconate operon in the
microorganism belonging to the genus Bacillus; (3) novel DNA in which a
promoter of a gluconate operon of a microorganism belonging to the genus
Bacillus is modified so as to highly express said gluconate operon in the
microorganism belonging to the genus Bacillus; and (4) a novel vector into
which DNA is introduced in which a promoter of a gluconate operon of a
microorganism belonging to the genus Bacillus is modified so as to highly
express the gluconate operon in the microorganism belonging to the genus
Bacillus, whereby D-ribose can be produced in stable form in large
amounts.
Inventors:
|
Miyagawa; Kenichiro (Osaka, JP);
Kanzaki; Naoyuki (Osaka, JP);
Miyazaki; Junichi (Ibaraki, JP)
|
Assignee:
|
Takeda Chemical Industries, Ltd. (Osaka, JP)
|
Appl. No.:
|
844295 |
Filed:
|
February 28, 1992 |
Foreign Application Priority Data
| Mar 01, 1991[JP] | 3-036129 |
| Jan 21, 1992[JP] | 4-008696 |
Current U.S. Class: |
435/252.31; 435/320.1; 536/23.2 |
Intern'l Class: |
C12N 001/21; C12N 015/54; C12N 015/74 |
Field of Search: |
435/105,252.31,320.1
536/27
|
References Cited
U.S. Patent Documents
3970522 | Jul., 1976 | Sasajima et al. | 435/105.
|
Foreign Patent Documents |
0412688 | Feb., 1991 | EP.
| |
Other References
Fujita et al. (1986), J. Biol. Chem. 261(29): 13744-13753.
Fujita et al. (1987), Proc. Nat. Acad. Sci USA 84: 4524-4528.
Lehninger (1982), Principles of Biochemistry, Worth Publishers Inc. (New
York), pp. 456-457.
K. Sasajima et al., Carbohydrate Metabolism-Mutants of a Bacillus Species
from Agricultural & Biological Chemistry, vol. 35, pp. 509-517 (1971).
|
Primary Examiner: Schwartz; Richard A.
Assistant Examiner: Carter; Philip W.
Attorney, Agent or Firm: Conlin; David G., Eisenstein; Ronald I.
Claims
What is claimed is:
1. A microorganism belonging to the genus Bacillus having D-ribose
producing ability transformed with a DNA segment comprising a gluconate
operon which is modified so as to highly express the gluconate operon in
said microorganism, wherein the modification of the gluconate operon
comprises deleting or inactivating the gntR gene.
2. A microorganism belonging to the genus Bacillus having D-ribose
producing ability transformed with a DNA segment comprising a gluconate
operon which is modified so as to highly express the gluconate operon in
said microorganism, wherein the modification of the gluconate operon
comprises deleting or inactivating a gntR gene, and replacing a promoter
of the gluconate operon with another promoter selected from the group
consisting of SP, SP01-15, SP01-26, .phi.29G3b, .phi.29G2, .phi.29A1, pur
operon, gua B and PI promoters.
3. The microorganism of claim 2, in which said another promoter is said SP
promoter.
4. The microorganism of claim 2 which belongs to Bacillus subtilis.
5. The microorganism of claim 2, wherein the modification of the gluconate
operon comprises deleting the gntR gene.
6. The microorganism of claim 2, wherein the modification of the gluconate
operon comprises inactivating the gntR gene.
7. A DNA segment comprising a gluconate operon of a microorganism belonging
to the genus Bacillus, which operon is modified so as to highly express
said gluconate operon in said microorganism, wherein the modification
comprises deleting or inactivating the gntR gene, and replacing a promoter
of the gluconate operon with another promoter wherein said another
promoter is selected from the group consisting of SP, SP01-15, SP01-26,
.phi.29G3b, .phi.29G2, .phi.29A1, pur operon, gua B and PI promoters.
8. The DNA segment of claim 7, in which said promoter is SP promoter.
9. The DNA segment of claim 7 wherein the microorganism belongs to Bacillus
subtilis.
10. The DNA segment of claim 7, wherein the modification comprises deleting
the gntR gene.
11. The DNA segment of claim 7, wherein the modification comprises
inactivating the gntR gene.
12. A vector into which a DNA segment is introduced, which DNA segment
comprises a gluconate operon of a microorganism belonging to the genus
Bacillus, which operon is modified so as to highly express said gluconate
operon in said microorganism, wherein the modification comprises deleting
or inactivating the gntR gene, an replacing a promoter of the gluconate
operon with another promoter wherein said another promoter is selected
from the group consisting of SP, SP01-15, SP01-26, .phi.29G3b, .phi.29A1,
pur operon, gua B and PI promoters.
13. The vector of claim 12, in which said another promoter is said SP
promoter.
14. The vector of claim 12 wherein the microorganism belongs to the genus
Bacillus subtilis.
15. The vector of claim 12, wherein the modification comprises deleting the
gntR gene.
16. The vector of claim 12, wherein the modification comprises inactivating
the gntR gene.
Description
BACKGROUND OF THE INVENTION
The present invention relates to a method of producing D-ribose by
fermentation, and more particularly to a method of producing D-ribose
using microorganisms belonging to the genus Bacillus modified by
recombinant DNA technology so as to produce D-ribose efficiently.
D-ribose is contained in all organisms as a constituent component of
ribonucleic acid, and ribitol, a reduced derivative thereof, is also
contained as a constituent composition of vitamine B.sub.2 or ribitol
teichonate constituting cell walls. This substance is therefore
physiologically very important.
On the other hand, D-ribose has previously been used as a raw material for
synthesis of vitamin B.sub.2, and has also recently been used as a raw
material for synthesis of nucleic acid flavor enhancers. It is therefore
industrially significant to prepare D-ribose at low cost and on a large
scale.
The production methods of D-ribose hitherto known include the methods of
extracting and isolating from natural products, the methods of
synthesizing using furan, glucose, etc. as raw materials, and the
fermentation methods using microorganisms (Japanese Patent Publication
Nos. 47-7948/1972, 50-16878/1975, 51-7753/1976, 52-3/1977, 58-17591/1983
and 59-26276/1984).
On the other hand, enzymes such as gluconate permease involved in the
permeation of gluconate in cells and gluconokinase producing
6-phosphogluconate from gluconate are present in Bacillus subtilis. These
enzymes are coded for by a gene called gluconate operon. The gluconate
operon (gnt operon) consists of four regions, gntR, gntK, gntP and gntZ
[Y. Fujita et al., J. Biol. Chem., 261, 13744-13753 (1986)]. The
expression of these enzymes is regulated by the expression regulating
region (gntR) which is located adjacently upstream from the structural
genes (gntK and gntP) coding for these enzymes [Y. Fujita et al., Pro.
Natl. Acad. Sci. U.S.A., 84, 4524-4528 (1987)]. However, this document
does not suggest the relationship to D-ribose producing ability at all.
All of the above-mentioned methods for producing D-ribose have
disadvantages in that the production processes are complicated, in that
the raw materials are expensive, or in that the yield is lowered by
production of gluconate as a by-product. They are therefore not always
satisfactory as industrial production methods for D-ribose at low cost.
For this reason, a more advantageous method for producing D-ribose has
been desired.
SUMMARY OF THE INVENTION
In view of such a present situation, the present inventors studied methods
using microorganisms, and particularly screened factors participating in
the efficient production of D-ribose by fermentation using microorganisms
belonging to the genus Bacillus. The results revealed that D-ribose was
produced not only by the usual pentose phosphate pathway through
glucose-6-phosphate, but also by the gluconate pathway, in the
microorganisms belonging to the genus Bacillus having D-ribose producing
ability. Namely, the present inventors considered that gluconate was
phosphorylated with gluconokinase to produce 6-phosphogluconate and
D-ribose was produced therefrom through the pentose phosphate pathway in
order to accumulate it.
As a result of further studies, the present inventors have discovered that
it is important for the excess production of D-ribose to highly express
the gluconate operon (gnt operon) coding for gluconokinase and gluconate
permease, enzymes which are important for conversion from gluconate to
D-ribose, in the production of D-ribose by fermentation using the
microorganism belonging to the genus Bacillus.
Although the gluconate operon is known to have the region regulating the
expression of the gene as described above, the present inventors have
discovered that not only the gntR exists as such a region, but also a
promoter has an important role in the regulation. The present inventors
have further discovered that D-ribose can be stably produced in large
amounts by modifying the promoter as well as the gntR in a structure by
which the high expression is expected, preparing a novel DNA fragment
having the structural genes for gluconokinase and gluconate permease
located downstream thereof, transforming a microorganism belonging to the
genus Bacillus having D-ribose producing ability using this DNA fragment
to obtain a novel microorganism which highly expresses the gluconate
operon, and cultivating the resulting microorganism.
The present invention was completed based on such discoveries. The present
invention provides (1) a method of producing D-ribose which comprises
cultivating a microorganism belonging to the genus Bacillus having
D-ribose producing ability in a medium, the microorganism belonging to the
genus Bacillus containing a DNA sequence participating in expression of a
gluconate operon which is partly or wholly modified so as to highly
express the gluconate operon in the microorganism belonging to the genus
Bacillus, accumulating D-ribose, and collecting D-ribose thus obtained;
(2) a novel microorganism belonging to the genus Bacillus having D-ribose
producing ability transformed with DNA, the DNA contains a DNA sequence
participating in expression of a gluconate operon and being partly or
wholly modified so as to highly express the gluconate operon in the
microorganism belonging to the genus Bacillus; (3) novel DNA in which a
promoter of a gluconate operon of a microorganism belonging to the genus
Bacillus is modified so as to highly express said gluconate operon in the
microorganism belonging to the genus Bacillus; and (4) a novel vector into
which a DNA is introduced, in the DNA a promoter of a gluconate operon of
a microorganism belonging to the genus Bacillus is modified so as to
highly express the gluconate operon in the microorganism belonging to the
genus Bacillus.
BRIEF DESCRIPTION OF THE DRAWINGS
FIGS. 1(a) and 1(b) are restriction enzyme maps of plasmid pGNT3 obtained
in Example 1 (2) and plasmid pGNT5 obtained in Example 1 (3),
respectively, wherein each open box indicates an inserted fragment, each
solid line portion indicates a vector, and gene symbols gntR, gntK, gntP
and gntZ indicate positions corresponding to four open reading frames of a
gluconate operon in the inserted fragment;
FIG. 2 is a restriction enzyme map of plasmid pHGD918 and a portion of a
nucleotide sequence at a binding portion of an inserted fragment and a
vector, wherein the vertical dotted line indicates a binding point of the
inserted fragment and the vector, the sequence underlined with the dotted
line represented as "RBS" indicates a ribosome binding site, and the
sequence represented as "start codon" indicates an initiation codon of an
open reading frame of the gntK gene;
FIG. 3 is a schematic representation showing the construction of plasmid
pGLSC4, wherein B, E, K, Sp and St indicate the sites cleaved with
restriction enzymes BamHI, EcoRI, KpnI, SphI and StuI, respectively, St/B
indicates a binding site where the flush end generated by StuI and the
cohesive end generated by BamHI were ligated after being converted to a
flush end with T4 DNA polymerase, the open boxes indicate the gluconate
operon and regions adjacent thereto, the shaded boxes indicate
chloramphenicol acetyltransferase genes, and the black boxes indicate SP
promoters;
FIG. 4 is a representation showing a restriction enzyme map of plasmid
pGLSC4 and a gene locus of the gluconate operon, wherein the open boxes
indicate the gnt operon and its 5'-terminal adjacent region, the shaded
box indicates a chloramphenicol acetyltransferase gene, the black portion
indicates an SP promoter, and the solid line indicates a vector.
DESCRIPTION OF THE PREFERRED EMBODIMENTS
When the DNA sequence participating in the expression of the gluconate
operon is partly or wholly modified in the present invention, the gntR or
an expression regulating region located upstream from an open reading
frame coding for gluconokinase of the gluconate operon, and/or the
promoter is modified. Specifically, the modification of the gntR includes
deletion of the gntR or inactivation by insertion of other DNA(s) into the
gntR. Although this gntR has a region participating in expression
regulation by glucose and a DNA region participating in expression
induction by gluconate, either of them may be deleted or inactivated.
On the other hand, the modification of the promoter of the gluconate operon
may include, for example, a replacement of the promoter with another gene
expressible in the microorganism belonging to the genus Bacillus for the
promoter of the gluconate operon. Specifically, the promoter of the
gluconate operon is substituted by a promoter derived from the chromosomal
DNA of the microorganism belonging to the genus Bacillus or a promoter
derived from a phage of the microorganism belonging to the genus Bacillus
as described below.
The modification of the DNA sequence in the present invention includes the
modification of the gntR and/or the modification of the promoter. It is
however most preferred that both modifications are conducted together.
It is desirable that the gluconate operon-containing DNA used in the
present invention contains the entire DNA of the operon and some
peripheral regions upstream and downstream thereof. However, the DNA may
contain a 5'-terminal portion of the operon DNA or a 5'-terminal portion
of the operon DNA and a region upstream therefrom. The DNA is easily
isolated from the chromosomal DNA of microorganisms by cloning using
recombinant DNA techniques. For example, an Escherichia coli host-vector
system and a Bacillus subtilis host-vector system are used.
A donor of the DNA containing the gluconate operon is not necessarily
required to have D-ribose producing ability. There is no particular
restriction on its source as a general rule and any microorganism may be
used as the donor, as long as a nucleotide sequence of a gluconate operon
of the donor strain has high homology with a nucleotide sequence of a
gluconate operon on a chromosome of a microorganism belonging to the the
genus Bacillus used as a recipient having D-ribose producing ability
described below. In particular, the use of microorganisms belonging to the
genus Bacillus is preferred from the viewpoint of treatment, and the
resulting transformant is expected to be stable.
Such DNA donors include microorganisms belonging to the genus Bacillus such
as Bacillus subtilis and Bacillus pumilus. Examples thereof include the
following strains:
B. subtilis No. 168 (BGSC IA1)
B. subtilis No. 115 (IFO 14187, FERM BP-1327)
B. subtilis MII14 (Gene, 24, 255 (1983))
BGSC: The Bacillus Genetic Stock Center
IFO: The Institute for Fermentation, Osaka, Japan
As methods for preparing chromosomal DNA from donors, known methods such as
the method of extracting chromosomal DNA by use of phenol (H. Saito and K.
Miura, Biochim. Biophy. Acta, 72, 619) can be used. The chromosomal DNA
thus obtained is digested with a restriction enzyme appropriately
selected, and ligated to a vector by using DNA ligase. A gluconate
assimilation deficient host bacterium is transformed with the resulting
ligation mixture, and a transformant complemented in that deficiency is
selected, whereby gluconate operon-containing DNA can be obtained. Also,
the gluconate operon-containing DNA can be cloned by colony hybridization
methods or plaque hybridization methods using a DNA oligomer which is a
portion of the known Bacillus subtilis gluconate operon nucleotide
sequence [Y. Fujita et al., J. Biol. Chem., 261, 13744-13753 (1986)] as a
probe. When the host bacterium is Escherichia coli, it can be transformed
according to known methods such as the method of S. N. Cohen et al. (Pro.
Natl. Acad. Sci. U.S.A., 69, 2110).
The DNA containing the gene can be obtained in large amounts from the
transformant thus obtained, according to the method described in T.
Maniatis et al., Molecular Cloning, 2nd edition, 1.33-1.52, Cold Spring
Harbor Laboratory Press (1989).
In order to produce the novel DNA of the present invention from the
gluconate operon-containing DNA thus obtained, the use of recombinant DNA
techniques is convenient. For example, the DNA of the present invention
can be prepared and isolated by procedures briefly described below, using
the E. coli host-vector system.
In the course of the preparation of the DNA of the present invention in E.
coli hereinafter described, a DNA fragment is often subcloned to another
vector or bound thereto by use of a polylinker. For this purpose, it is
convenient also for the preparation of the novel DNA or the determination
of the nucleotide sequence to subclone the DNA fragment, utilizing, for
example, a polylinker portion of E. coli vector pUC118 or pHSG398.
The region participating in the expression regulation of the gluconate
operon is removed from the plasmid containing the gluconate operon using
an appropriate enzyme, and an enzyme having exonuclease activity which
digests a double stranded DNA from the terminus thereof in turn, for
example, BAL31, as so desired. More specifically, the region upstream from
the 5'-terminal side of the open reading frame coding for gluconokinase is
removed by cleavage, and a ribosome binding site, a sequence participating
in binding of the mRNA to the 16S ribosome RNA from a microorganism
belonging to the genus Bacillus, is ligated to the 5'-flanking region of
an initiation codon of the open reading frame, adjusting the direction. A
promoter sequence is further ligated upstream from the 5'-terminal side
thereof, whereby the DNA of the present invention can be obtained. When
the promoter sequence is ligated, it is preferred to ligate a promoter
sequence having promoter activity highly expressible in the microorganism
belonging to the genus Bacillus other than the gluconate operon promoter.
As the ribosome binding site, DNA cloned from the microorganisms belonging
to the the genus Bacillus and synthetic DNA may be used, as long as they
have a sequence complementing 3'OHUCUUUCCUCC5' (SEQ ID NO: 1), a messenger
RNA binding site of l6S ribosome of the microorganism belonging to the
genus Bacillus having D-ribose producing ability described below. DNA
located upstream from the openreading frame of gluconokinase in the
above-mentioned clone also may be used. In this case, in order to remove
the region participating in the expression regulation of the gluconate
operon exactly, the kind of each restriction enzyme used, the amount of
the enzyme having exonuclease activity and the reaction time are varied,
thereby obtaining various DNA fragments different in the kind and size of
the deleted portions. A desired DNA fragment may be selected from these
fragments by appropriate means as described below, for example, based on
the results of the nucleotide sequence determination of the fragments.
After the DNA fragment is subcloned into a vector used for the nucleotide
sequence determination, such as M13, pUC118 or pHSG398, the nucleotide
sequence can be determined by known methods such as the method of F.
Sangar et al. (Proc. Natl. Acad. Sci. U.S.A., 74, 5463).
Any promoter sequence may be used as long as it has a DNA sequence
expressible in the microorganisms belonging to the genus Bacillus having
D-ribose producing activity used below, and it does not matter whether it
is derived from procaryotes, eucaryotes or synthetic DNA.
Examples of such promoters include promoters derived from chromosomal DNA
of microorganisms belonging to the genus Bacillus, promoters derived from
phages of microorganisms belonging to the genus Bacillus and promoters
derived from plasmids autonomously replicating in microorganisms belonging
to the genus Bacillus.
Specific examples of such promoters include
AAAAGGTATTGACTTTCCCTACAGGGTGTGTAATAATTTATATACA, SPO1-15 (SEQ ID NO: 2)
AAAAGTTGTTGACTTTATCTACAAGGTGTGGCATAATAATCTTAAC, SPO1-26 (SEQ ID NO: 3);
GAAAAGTGTTGAAAATTGT CGAACAGGGTGATATAATAAAGAGTA, .phi. 29G3b (SEQ ID NO: 4);
GAAAAGGGTAGACAAACTATCGTTTAACATGTTATACTATAATAGAA, .phi. 29G2 (SEQ ID NO: 5);
ATTAATGTTTGACAACTAT TACAGAGTATGCTATAATGGTAGTATC, .phi. 29Al (SEQ ID NO: 6);
TAATATCGTTGACATTATCCATGTCCGTTGTTAAGATAAACATGAA, pur operon (SEQ ID NO: 7);
CCGCTTCCTTGACATGCTCTTGGCTAGTTGATAATCAACATATAAT, gua B (SEQ ID NO: 8); and
AAAACATTTACTCCATGGAAAATGATGATAGATTAATTTTTAA, PI (SEQ ID NO: 9).
These promoters can be cut out of DNA fragments (plasmids) containing the
promoters by use of appropriate restriction enzymes, and fractionated, for
example, on agarose gel electrophoresis or polyacrylamide gel
electrophoresis, followed by recovery to use them. DNAs having nucleotide
sequences of the above-mentioned promoters can also be synthesized by the
phosphoamidide method using commercial DNA synthesizers (for example, a
synthesizer manufactured by Applied Biosystems) according to the protocols
thereof.
Thus, the DNAs of the present invention are prepared and employed in
transformation of microorganisms belonging to the genus Bacillus. It is
sometimes convenient to ligate marker genes expressible in microorganisms
belonging to the genus Bacillus, such as drug resistant genes, to the DNAs
of the present invention, when transformants of the microorganisms
belonging to the genus Bacillus are selected as described below.
In this case, it is convenient to ligate a portion of the 5'-adjacent
region of the gluconate operon upstream from the 5'-terminus of the bound
promoter, because double crossover type recombination takes place when
recombination is conducted on a chromosome of the microorganism belonging
to the genus Bacillus having D-ribose producing activity as described
below.
Then, in order to obtain the DNA of the present invention in large amounts,
the host strain belonging to the E. coli is transformed using the
above-mentioned resulting solution in which ligation is performed by T4
DNA ligase. When drug resistance is used as a selective marker, a strain
is grown in a selective medium and the medium containing the drug is
obtained. The DNA of the present invention can be obtained from the
transformant thus obtained, according to the method described in Molecular
Cloning, 2nd edition, 1.33-1.52 mentioned above.
Methods for transforming the microorganisms belonging to the genus Bacillus
having D-ribose producing ability with the novel DNA thus obtained to
prepare novel microorganisms are hereinafter described.
The microorganisms belonging to the genus Bacillus having D-ribose
producing ability may belong to any species of Bacillus. For example,
bacteria belonging to B. subtilis or B. pumilus are preferably used. Most
preferred are Bacteria belonging to B. subtilis.
In order to produce D-ribose effectively by the present invention, it is
preferred that these D-ribose producing bacteria have gluconate producing
ability but strains which have too great an ability to produce gluconate
accumulate a large amount of gluconate in media and the strains cannot
therefore be expected to produce D-ribose effectively. However, when the
strains are transformed with the DNA of the present invention, gluconate
is converted to D-ribose. For this reason, D-ribose can be effectively
accumulated without production of gluconate as a by-product. Conversely,
when strains not having gluconate producing ability are used, the strains
can be easily induced to strains having gluconate producing ability by
enhancing 2-deoxy-D-glucose oxidation activity or by expressing the
glucose dehydrogenase gene of the strains using cloned glucose
dehydrogenase gene of B. subtilis (K. A. Lampel et al., J. Bacteriol.,
166. 238-243). It is possible for these strains to carry out the present
invention. For example, if one or more known properties which are
considered to be advantageous to the production and accumulation of
D-ribose, such as the deficiency in at least one of transketolase and
D-ribulose-5-phosphate-epimerase and the deficiency of sporogenous
ability, are further added to these strains to use them as D-ribose
producing bacteria, more suitable results can be obtained to improve the
productivity of D-ribose in many cases.
Typical examples of microorganisms belonging to the genus Bacillus having
D-ribose producing ability include the following strains:
B. subtilis No. 429 (IFO 12603, ATCC21359) *1
B. subtilis No. 483 (IFO 12604, ATCC21360) *1
B. subtilis No. 608 (IFO 13323, FERM P-1490) *2
B. subtilis No. 957 [IFO 13565, FERM P-2259) *3
B. subtilis No. 941 (IFO 13573, FERM P-2360) *3
B. subtilis No. 1054 (IFO 13586, FERM P-2467) *3
B. subtilis No. 1067 (IFO 13588, FERM P-2468) *3
B. subtilis No. 1097 (IFO 13621, FERM P-2833) *3, 4
B. subtilis TK 103 (IFO 15138, FERM BP-3290)
B. pumilus No. 503 (IFO 12600, ATCC21356) *1
B. pumilus No. 537 (IFO 12601, ATCC21357) *1
B. pumilus No. 558 (IFO 12602, ATCC21358) *1
B. pumilus No. 716 (IFO 13322, FERM BP-812) *2
B. pumilus No. 911 (IFO 13566, FERM P-2260) *3
B. pumilus No. 1027 (IFO 13585, FERM P-2466) *3
B. pumilus No. 1083 (IFO 13620, FERM P-2832) *3, 4
*1: Japanese patent publication No. 47-7948/1972, U.S. Pat. No. 3,607,648
*2: Japanese Patent Publication No. 50-16878/1975, U.S. Pat. No. 3,919,046
*3 Japanese patent publication No. 51-7753/1976, Japanese Patent
Publication No. 52-1993/1977, U.S. Pat. No. 3,970,522
*4: Japanese Patent Publication No. 58-17591/1983
In the present invention, the novel DNA which is the chromosomal DNA
containing the DNA sequence participating in the expression of the
gluconate operon of the microorganism belonging to the genus Bacillus and
the 3'-adjacent region of that sequence, the DNA sequence participating in
the expression of the gluconate operon being partly or wholly modified so
as to highly express the gluconate operon in the microorganism belonging
to the genus Bacillus, is used for the transformation of the microorganism
belonging to the genus Bacillus having D-ribose producing ability. In this
case, the DNA of the present invention can be used in the state that the
DNA is introduced into a plasmid. It is also possible to use linear DNA
obtained by cleaving the plasmid or the DNA cut out of the plasmid. To
obtain DNA fragments, the transformation can be accomplished either by
using said DNA fragments or by using a vector containing said DNA
fragments. Using the DNA fragments, the microorganisms belonging to the
genus Bacillus can be transformed by known methods such as the method
described in C. Anagnostopoulos and J. Spizizen, J. Bacteriol., 81, 741
(1961).
For example, when the drug tolerance gene is used as the selective marker,
the selection of the transformant can be easily carried out using an agar
plate containing the corresponding drug.
It can be easily determined by the assay of gluconokinase activity whether
or not the transformant thus obtained is a novel microorganism having
desired characteristics. Namely, the microorganism transformed with the
DNA of the present invention which is derepressed and enhanced in the
expression of the gluconate operon has higher gluconokinase activity than
the parent strain thereof. Because of its high gluconokinase activity, the
D-ribose accumulating ability of the transformed microorganisms is higher
than that of the parent strain.
Typical examples of such transformants of the present invention include B.
subtilis RS101 (IFO 15138, FERM BP-3291) obtained in Example 2 described
below.
Of course, various transformants can be easily prepared in a similar manner
by selecting the promoters or the microorganisms belonging to the genus
Bacillus according to the methods desired in this specification.
Using the transformants obtained in the present invention, D-ribose is
prepared by methods similar to the conventional methods for cultivating
D-ribose producing bacteria. Namely, various nutrients such as carbon
sources and nitrogen sources are used as media. Examples of carbon sources
include D-glucose, D-mannose, D-sorbitol, D-mannitol, sucrose, molasses,
starch hydrolysates, starch, acetic acid and ethanol.
The nitrogen sources used include organic nitrogen compounds such as urea
and amino acids, as well as corn steep liquor, cotton seed meal, yeast
extract, dry yeast, fish meal, meat extract, peptone, Casamino acids, and
inorganic nitrogen compounds such as aqueous ammonia, gaseous ammonia,
ammonium sulfate, ammonium nitrate, ammonium chloride, ammonium carbonate,
ammonium phosphate and sodium nitrate. Corn steep liquor is advantageously
used among others.
In addition to these carbon sources and nitrogen sources, various metals,
vitamins, amino acids, etc. necessary for growth of the microorganisms
used are appropriately added to the media.
Cultivation is usually conducted under aerobic conditions such as submerged
culture in a flask with shaking or in a fermentor with aeration and
agitation.
There is no particular restriction on cultivation conditions, namely the
cultivation temperature, the pH of the media and the cultivation time.
However, the cultivation temperature is generally about 18.degree. to
about 45.degree. C., and preferably about 25 to about 40.degree. C.
The pH of the media is generally about 4.5 to about 9, and preferably about
5.5 to about 8. The cultivation time is generally about 18 to about 180
hours, and preferably about 36 to about 120 hours. In order to collect the
accumulated D-ribose from the culture solutions, separation and
purification methods of D-ribose known in the art are employed. For
example, the cells are removed by filtration or centrifugation of the
culture solution. Then, the solution from which the cells are removed is
decolorized and desalted by activated charcoal treatment or ion exchange
resin treatment, followed by concentration. A solvent such as ethyl
alcohol is added to the concentrated solution to crystallize and obtain
D-ribose.
According to the present invention, the D-ribose producing bacteria of
genus Bacillus having gluconate producing ability are transformed using
the novel DNA which is the chromosomal DNA containing the DNA sequence
participating in the expression of the gluconate operon of the
microorganism belonging to the genus Bacillus and the 3'-adjacent region
of that sequence, the DNA sequence participating in the expression of the
gluconate operon being partly or wholly modified so as to highly express
the gluconate operon in the microorganisms belonging to the genus
Bacillus. The gluconate operon coding for gluconokinase, etc. which are
enzymes important for conversion from gluconate to D-ribose is highly
expressed and the novel microorganisms having enhanced enzyme activity and
D-ribose producing activity can be obtained. By cultivating the novel
microorganisms in the media, D-ribose can be prepared in stable form in
large amounts without substantial accumulation of gluconate.
When nucleotides and so on are indicated by abbreviations in the
specification and drawings, the abbreviations adopted by the IUPAC-IUB
Commission on Biochemical Nomenclature or commonly used in the art are
employed. For example, the following abbreviations are used.
DNA: Deoxyribonucleic acid
A: Adenine
T: Thymine
G: Guanine
C: Cytosine
dATP: Deoxyadenosine triphosphate
dTTP: Deoxythymidine triphosphate
dGTP: Deoxyguanosine triphosphate
dCTP: Deoxycytidine triphosphate
ATP: Adenosine triphosphate
EDTA: ethylenediaminetetraacetic acid
The present invention will be described in more detail with the following
Examples. It is understood of course that these Examples are not intended
to limit the scope of the invention.
B. subtilis No. 115 used in Example 1 (1) described below was deposited
with the Institute for Fermentation, Osaka, Japan (IFO) under the
accession number IFO 14187 on Jul. 13, 1982, and with the Fermentation
Research Institute, the Agency of Industrial Science and Technology, the
Ministry of International Trade and Industry, Japan (FRI) under the
accession number FERM BP-1327 on Mar. 28, 1987.
Transformants B. subtilis TK103 and B. subtilis RS101 obtained in Example 2
described below were deposited with the Institute for Fermentation, Osaka,
Japan (IFO) under the accession numbers IFO 15138 and IFO 15139 on Feb.
14, 1991, and with the Fermentation Research Institute, the Agency of
Industrial Science and Technology, the Ministry of International Trade and
Industry, Japan (FRI) under the accession numbers FERM BP-3290 and FERM
BP-3291 on Feb. 21, 1991.
The Examples described below were carried out according to the following
processes (1) to (8) unless otherwise indicated.
(1) Digestion of DNA by Restriction Enzyme
Using a restriction enzyme (Takara Shuzo) in an amount of 10 units/.mu.g of
DNA and a buffer solution for the restriction enzyme recommended by the
manufacturer of the enzyme, digestion was conducted at the temperature of
60.degree. C. for 60 minutes. Subsequently, extraction was carried out
with phenol saturated with TE buffer [10 mM Tris-HCl (pH 7.5), 1 mM EDTA].
Then, 1/10 volume of 3M sodium acetate (pH 6) was added to the extract,
and 2.5 volumes of ethanol was further added thereto, followed by
centrifugation to recover DNA.
(2) Large Scale Preparation of Plasmid
Extraction was carried out according to the method described in Molecular
Cloning, 1.33-1.52. Namely, 250 ml of LB medium (10 g/l bactotryptone, 5
g/l yeast extract, 5 g/l sodium chloride) was inoculated with E. coli
containing the plasmid DNA. After cultivation was conducted overnight, the
cells were harvested and washed. Then, lysozyme was added to the washed
cells, and a 0.2N solution of sodium hydroxide containing 1% sodium lauryl
sulfate was further added thereto to lyse the cells. After addition of 5M
potassium acetate, a supernatant containing the plasmid was obtained by
centrifugation. To the supernatant was added 0.6 volume of isopropanol to
precipitate the plasmid DNA. After washing with ethanol, the plasmid DNA
was dissolved in TE buffer. Cesium chloride was added thereto to give a
specific gravity of 1.60, and ethidium bromide was added thereto to a
final concentration of 600 .mu.g/ml. Using an ultracentrifuge (rotor
V.sub.65 Ti), centrifugation was carried out at 20.degree. C. at 50,000
rpm for 12 hours. Plasmid bands detected by ultraviolet rays were
collected, and ethidium bromide was removed by extraction using n-butanol,
followed by ethanol precipitation.
(3) Transformation of E. coli
Transformation was conducted according to the method described in Molecular
Cloning, 1.74-1.84.
E. coli was inoculated onto 3 ml of LB medium, and cultivated overnight.
Then, 1 ml of the resulting culture solution was inoculated onto 100 ml of
LB medium, and cultivated at 37.degree. C. with shaking to give a cell
amount of about 5.times.10.sup.7 cells/ml. Subsequently, the cells are
collected, and 50 ml of a sterilized aqueous solution containing 50 mM
calcium chloride and 10 mM Tris-HCl (pH 8) cooled with ice was added
thereto to suspend the cells. The resulting suspension was cooled with ice
for 15 minutes, followed by centrifugation. The centrifuged cells were
suspended again in 6.7 ml of the above-mentioned aqueous solution. The DNA
was added to 0.2 ml of the resulting suspension, and cooled with ice for
30 minutes. Then, 0.8 ml of LB medium was added thereto, followed by
cultivation at 37.degree. C. for 1 hour. The resulting product was applied
to an LB agar plate medium containing a drug, and cultivated at 37
.degree. C. overnight.
(4) BAL 31 Exonuclease Digestion Treatment
BAL 31 digestion treatment was conducted to digest both strands of the DNA
from both termini. Namely, 10 .mu.g of the DNA treated with the
restriction enzyme was dissolved in 100 .mu.l of BAL 31 buffer (12 mM
calcium chloride, 12 mM magnesium chloride, 200 mM sodium chloride, 20 mM
Tris-HCl (pH 8), 2 mM EDTA), and 1 unit of BAL 31 exonuclease (Takara
Shuzo) was added thereto. After the resulting solution was incubated at
30.degree. C., it was subjected to phenol extraction and ethanol
precipitation. Then, the above-mentioned DNA was suspended in 20 .mu.l of
a buffer for T4 DNA polymerase [33 mM Tris-acetate (pH 7.9), 10 mM
magnesium acetate, 0.5 mM dithiothreitol, 66 mM potassium acetate, 0.01%
BSA, 0.1 mM dATP, 0.1 mM dGTP, 0.1 mM dCTP, 0.1 mM dTTP] to convert
cohesive end to flush end with 5 units of T4 DNA polymerase (Takara
Shuzo). After the resultant suspension was maintained at a temperature of
37.degree. C. for 30 minutes, it was subjected to phenol extraction and
ethanol precipitation.
(5) Ligating Reaction of DNA
Using a DNA ligation kit (Takara Shuzo), two or three kinds of DNA
fragments were ligated. Ligation was carried out according to the method
specified by the manufacturer.
(6) Transformation of B. subtilis
Transformation was performed according to the method of Dubnou et al.
Namely, B. subtilis was inoculated onto 5 ml of LB medium, and cultivated
at 37.degree. C. overnight. Then, 0.5 ml of the resulting product was
transferred to 20 ml of SPI medium (1.4% dipotassium phosphate, 0.6%
monopotassium phosphate, 0.2% ammonium sulfate, 0.1% sodium citrate, 0.02%
magnesium sulfate, 0.5% glucose, 0.02% Casamino acids, 0.1% yeast extract,
50 .mu.g/ml tryptophan, 50 .mu.g/ml leucine), and cultivated at 37.degree.
C. for 4 hours. Subsequently, 10 ml of the culture solution was
transferred to 100 ml of SPII medium (1.4% dipotassium phosphate, 0.6%
monopotassium phosphate, 0.2% ammonium sulfate, 0.1% sodium citrate, 0.02%
magnesium sulfate, 0.5% glucose, 75 .mu.g/ml calcium chloride, 508
.mu.g/ml magnesium chloride), and cultivated at 37.degree. C. for 90
minutes. To 1 ml of this cell suspension was added 1 .mu.g of the DNA,
followed by shaking at 37.degree. C. for 30 minutes. The resulting product
was applied to an LB agar plate medium containing a drug, and cultivated
at 37.degree. C. overnight.
(7) Plaque Hybridization
.lambda.ZAP (Toyobo) in vitro packaged was infected with E. coli BB4, and
inoculated onto an agar plate to form plaques, and then, a nylon filter
(Colony/Plaque Screen NEF-978X, du Pont) was adhered on the agar plate for
3 minutes.
Then, this nylon filter was stripped off from the plate medium, and
immersed in a 0.5N aqueous solution of sodium hydroxide for 10 minutes.
Subsequently, the filter was immersed in 1M Tris-HCl (pH 7.5) for 10
minutes, followed by drying at room temperature.
On the other hand, a probe was prepared using MEGALABEL (Takara Shuzo)
according to the protocol specified by the manufacturer. Hybridization was
carried out according to the protocol specified for the nylon filter.
(8) Determination of Nucleotide Sequence
The nucleotide sequence of the DNA was determined using Sequenase (Toyobo)
according to the method specified by the manufacturer.
EXAMPLE 1
(1) Preparation of Chromosomal DNA
B. subtilis No. 115 [IFO 14187, FERM BP-1327 (deposited on Mar. 28, 1987),
(Japanese Patent Publication No. 3-35916/1991, U.S. Pat. No. 4,701,413)]
was inoculated onto 40 ml of LB medium, and cultivated at 37.degree. C.
overnight, followed by extraction with phenol to obtain 5 mg of
chromosomal DNA.
(2) Cloning of Gluconate Operon (gnt Operon)
10 .mu.g of the chromosomal DNA prepared in the preceding item (1) was
digested with EcoRI, and the resulting DNA fragments were fractionated by
agarose gel electrophoresis. A DNA fragment corresponding to about 7.0 to
8.0 kb was recovered using a unidirectional electroeluter (International
Biotechnologies Inc.).
On the other hand, 0.5 .mu.g of .lambda.ZAP (Toyobo) was digested with
EcoRI and mixed with the above-mentioned DNA fragments. After ligation, in
vitro packaging was conducted, and E. coli BB4 (Toyobo) was infected with
the resulting product to form plaques on an agar plate. Using a synthetic
oligonucleotide (5'-AGCTACGAAAGCTCATGTCTCGGCGCCTGC-3': SEQ ID NO: 10) as a
probe, plaque hybridization was conducted. The in vitro packaging was
carried out using Packgene (Seikagaku Kogyo) according to the attached
protocol. As a result, DNA was obtained from positive plaques, and a
7.0-kb EcoRI fragment inserted therein was subcloned to the EcoRI site of
pBR322 to obtain recombinant plasmid pGNT3 containing the gluconate operon
(gntR, gntK, gntP, gntZ). The restriction enzyme map of pGNT3 is shown in
FIG. 1(a).
(3) Preparation of DNA Fragment from Which a Large Portion of gntR Is
Deleted
After 5 .mu.g of pGNT3 was double-digested with HindIII and EcoRI, the
digested product was applied on agarose gel electrophoresis. Subsequently,
a fragment corresponding to 5.0 kb was extracted from the gel, and
inserted into the HindIII-EcoRI site of pUC19. Then, E. coli JM109 was
transformed therewith to ampicillin-resistant strain E. coli JM109
(pGNT5), from which plasmid pGNT5 shown in FIG. 1(b) was obtained.
Subsequently, 10 .mu.g of pGNT5 was digested with HindIII, followed by
treatment with BAL31 for 5 minutes. Then, the resulting product was
completely digested with SphI to obtain fragments. The fragments were
fractionated on agarose gel electrophoresis, and a DNA fragment
corresponding to about 3.7 kb was obtained. The DNA fragment thus obtained
was ligated to 0.5 .mu.g of pHSG398 (Takara Shuzo) double-digested with
SmaI and SphI. Then, E. coli JM109 was transformed therewith and a strain
resistant to chloramphenicol (30 mg/ml) was selected. As a result, pHGD918
having the structure shown in FIG. 2 was obtained. The determination of
the nucleotide sequence confirmed that this plasmid contained all of the
gntK gene and the gntP gene and a portion of the gntZ gene of the
gluconate operon, but a large portion of the gntR gene was deleted
therefrom.
(4) Preparation of Plasmid Containing Gluconate Operon Highly Expressible
in microorganisms belonging to the genus Bacillus
i) Plasmid pSP19 (European Patent publication No. 412,688) into which an sp
promoter was introduced was double-digested with EcoRI and KpnI, and a
0.1-kb fragment was obtained. The fragment was ligated to the EcoRI-KpnI
site of plasmid pSKC (European Patent Publication No. 412,688) containing
a chloramphenicol acetyltransferase gene, and E. coli JM109 was
transformed therewith to obtain plasmid pSKCSP from
chloramphenicol-resistant strains.
Then, 10 .mu.g of pSKCSP was cleaved with BamHI, and thereafter the end of
the fragment was rendered flush with T4 DNA polymerase. The resulting
product was further cleaved with KpnI, and then subjected to agarose gel
electrophoresis to obtain a fragment of about 1.1 kb.
ii) 5 .mu.g of pHGD918 was double-cleaved with KpnI and SphI, and the
resulting fragments were fractionated on agarose gel electrophoresis.
Then, a fragment of about 3.7 kb was obtained.
iii) Similarly, an StuI-SphI fragment of about 5.4 kb was obtained from
pGNT3.
iV) Three fragments obtained in i), ii) and iii) described above were mixed
and ligated to one another, and E. coli JM109 was transformed therewith to
obtain ampicillin-resistant strain E. coli JM109 (pGLSC4). Plasmid pGLSC4
was extracted from that strain. The preparation method of pGLSC4 is shown
in FIG. 3, and the detailed structure of pGLSC4 is shown in FIG. 4.
pGLSC4 a is recombinant plasmid which contains all of the gntK gene and the
gntP gene and a portion of the gntZ gene of the gluconate operon, from
which a large portion of gntR considered to participate in their
expression regulation is deleted, and which has an SP promoter 5'-upstream
from gnt.
EXAMPLE 2
Preparation of Transformant of microorganism belonging to the genus
Bacillus in Which Gluconate Operon Is Highly Expressed
Using B. subtilis No. 115 (IFO 14187, FERM BP-1327) (Japanese Patent
Publication No. 3-35916/1991, U.S. Pat. No. 4,701,413) as a parent strain,
mutation treatment was conducted with N-methyl-N'-nitro-N-nitrosoguanidine
according to the method of Sasajima et al. [Agric. Biol. Chem., 34, 381
(1970); ibid., 35, 509 (1971)] and the method described in Japanese Patent
Publication No. 52-1993/1977 (U.S. Pat. No. 3,970,522). Then, using the
known replica plate method, mutant B. subtilis TK103 (IFO 15138, FERM
BP-3290) having shikimic acid requirement and high 2-deoxy-D-glucose
oxidation activity was obtained. This mutant has D-ribose producing
activity. Then, 10 .mu.g of PGLSC4 obtained in Example 1 was completely
digested with SphI to linear DNA. Using this DNA, B. subtilis TK103 was
transformed to obtain resistant strains to chloramphenicol (10 .mu.g/ml).
One of the resistants was named B. subtilis RS101 (IFO 15139, FERM
BP-3291). This strain was cultivated in a medium containing glucose as a
carbon source, and its gluconokinase activity was assayed. As a result,
the activity of forming 75 nmol/mg of protein in the cell free
extract/minute of 6-phosphogluconate was observed. When the gluconokinase
activity of B. subtilis TK103 was assayed under the same conditions, the
activity of only 0.3 nmol/mg of protein in the cell free extract/minute of
6-phosphogluconate was observed. The gluconokinase activity was assayed
according to the method of J. Nishida and Y. Fujita [Biochim. Biophys.
Acta, 798, 88-95 (1984)].
EXAMPLE 3
Preparation of Ribose by B. subtilis RS101
Transformant B. subtilis RS101 obtained in Example 2 was inoculated onto 20
ml of a medium comprising 2% sorbitol, 2% corn steep liquor, 0.1% KH.sub.2
PO.sub.4, 0.3% K.sub.2 HPO.sub.4 and 50 .mu.g/ml L-tryptophan (pH 7.2),
and cultivated with shaking at 37.degree. C. for 16 hours. Then, 1 ml of
the resultant culture broth was transferred to 20 ml of a medium
containing 16% glucose (separately sterilized), 2% corn steep liquor, 0.5%
(NH.sub.4).sub.2 SO.sub.4, 1.5% CaCO.sub.3 and 50 .mu.g/ml L-tryptophan,
and cultivated with shaking at 37.degree. C. for 72 hours. After
completion of cultivation, the accumulated amount of D-ribose was
determined on high performance liquid chromatography. This result revealed
that 62 mg/ml of D-ribose was accumulated. When B. subtilis TK103 was
cultivated under the same conditions, the amount of D-ribose accumulated
in the culture broth after completion of cultivation was only 39 mg/ml.
__________________________________________________________________________
SEQUENCE LISTING
(1) GENERAL INFORMATION:
(iii) NUMBER OF SEQUENCES: 10
(2) INFORMATION FOR SEQ ID NO:1:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 10 base pairs
(B) TYPE: nucleic acid
(C) STRANDEDNESS: single
(D) TOPOLOGY: linear
(ii) MOLECULE TYPE: rRNA
(xi) SEQUENCE DESCRIPTION: SEQ ID NO:1:
CCUCCUUU CU10
(2) INFORMATION FOR SEQ ID NO:2:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 46 base pairs
(B) TYPE: nucleic acid
(C) STRANDEDNESS: double
(D) TOPOLOGY: linear
(ii) MOLECULE TYPE: DNA (genomic)
(xi) SEQUENCE DESCRIPTION: SEQ ID NO:2:
AAAAGG TATTGACTTTCCCTACAGGGTGTGTAATAATTTATATACA46
(2) INFORMATION FOR SEQ ID NO:3:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 46 base pairs
(B) TYPE: nucleic acid
(C) STRANDEDNESS: double
(D) TOPOLOGY: linear
(ii) MOLECULE TYPE: DNA (genomic)
(xi) SEQUENCE DESCRIPTION: SEQ ID NO:3:
AAAA GTTGTTGACTTTATCTACAAGGTGTGGCATAATAATCTTAAC46
(2) INFORMATION FOR SEQ ID NO:4:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 46 base pairs
(B) TYPE: nucleic acid
(C) STRANDEDNESS: double
(D) TOPOLOGY: linear
(ii) MOLECULE TYPE: DNA (genomic)
(xi) SEQUENCE DESCRIPTION: SEQ ID NO:4:
GA AAAGTGTTGAAAATTGTCGAACAGGGTGATATAATAAAAGAGTA46
(2) INFORMATION FOR SEQ ID NO:5:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 47 base pairs
(B) TYPE: nucleic acid
(C) STRANDEDNESS: double
(D) TOPOLOGY: linear
(ii) MOLECULE TYPE: DNA (genomic)
(xi) SEQUENCE DESCRIPTION: SEQ ID NO:5:
GAAAAGGGTAGACAAACTATCGTTTAACATGTTATACTATAATAGAA47
(2) INFORMATION FOR SEQ ID NO:6:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 46 base pairs
(B) TYPE: nucleic acid
(C) STRANDEDNESS: double
(D) TOPOLOGY: linear
(ii) MOLECULE TYPE: DNA (genomic)
(xi) SEQUENCE DESCRIPTION: SEQ ID NO:6:
ATTAATGTTTGACAACTATTACAGAGTATGCTATAATGGTAGTATC46
(2) INFORMATION FOR SEQ ID NO:7:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 46 base pairs
(B) TYPE: nucleic acid
(C) STRANDEDNESS: double
(D) TOPOLOGY: linear
(ii) MOLECULE TYPE: DNA (genomic)
(xi) SEQUENCE DESCRIPTION: SEQ ID NO:7:
TAATATCGTTGACATTATCCATGTCCGTTGTTAAGATAAACATGAA46
(2) INFORMATION FOR SEQ ID NO:8:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 46 base pairs
(B) TYPE: nucleic acid
(C) STRANDEDNESS: double
(D) TOPOLOGY: linear
(ii) MOLECULE TYPE: DNA (genomic)
(xi) SEQUENCE DESCRIPTION: SEQ ID NO:8:
CCGCTTCCTTGACATGCTCTTGGCTAGTTGATAATCAACATATAAT46
(2) INFORMATION FOR SEQ ID NO:9:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 43 base pairs
(B) TYPE: nucleic acid
(C) STRANDEDNESS: double
(D) TOPOLOGY: linear
(ii) MOLECULE TYPE: DNA (genomic)
(xi) SEQUENCE DESCRIPTION: SEQ ID NO:9:
AAAACATTTACTCCATGGAAAATGATGATAGATTAATTTTTAA43
(2) INFORMATION FOR SEQ ID NO:10:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 30 base pairs
(B) TYPE: nucleic acid
(C) STRANDEDNESS: double
(D) TOPOLOGY: linear
(ii) MOLECULE TYPE: DNA (genomic)
(x i) SEQUENCE DESCRIPTION: SEQ ID NO:10:
AGCTACGAAAGCTCATGTCTCGGCGCCTGC30
Top