Back to EveryPatent.com
| United States Patent |
5,279,957
|
|
Gross
|
January 18, 1994
|
cDNA encoding human phospholipase A.sub.2 polypeptide
Abstract
The present invention provides a novel human polypeptide having
phospholipase A.sub.2 activity, referred to as PLA.sub.2 (Ca.sup.-). The
invention also provides nucleic acid sequences coding for the novel
polypeptide, expression vectors comprising the nucleic acid sequences
coding for the novel polypeptide, host cells and cell cultures capable of
expressing the novel polypeptide. The present invention further provides
antisense oligonucleotides for modulation of expression of the gene coding
for the novel polypeptide. Assays for screening test compounds for their
ability to inhibit phospholipase A.sub.2 activity are also provided.
| Inventors:
|
Gross; Richard (St. Louis, MO)
|
| Assignee:
|
Washington University (St. Louis, MO)
|
| Appl. No.:
|
876284 |
| Filed:
|
April 30, 1992 |
| Current U.S. Class: |
435/348; 435/252.3; 435/252.31; 435/252.33; 435/254.11; 435/320.1; 536/23.2 |
| Intern'l Class: |
C12N 005/10; C12N 001/21; C12N 001/19; C12N 015/85 |
| Field of Search: |
435/320.1,69.1,172.3,252.31,252.33,252.3,240.2,256
536/23.2
935/9,11
|
References Cited
Other References
Davidson, et al., J. Mol. Evol. 31:228-238 (1990).
Clark, et al., Cell 65:1043-1051 (1991).
Sharp et al., J. Biol. Chem. 266:14850-14853 (1991).
Loeb, et al., J. Biol. Chem. 261:10467-10470 (1986).
Zupan, et al., FEBS 284:27-30 (1991).
Ichimura et al., Proc. Natl. Acad. Sci. U.S.A. 85:7084-7088 (1988).
Ford et al., Chapter 8, "Lipobiology" in Fundamentals of Medical Cell
Biology, vol. 3A, pp. 225-256 (1992).
Dennis et al., FASEB, 5:2068-2077 (1991).
Dennis, Biotechnology, 5:1294-1300 (1987).
Wolf, et al., J. Biol. Chem. 260:7295-7303 (1985).
Lombardo, et al., J. Biol. Chem. 260:7234-7240 (1985).
Deems et al., Biochem. Biophys. Acta 917:258-268 (1987).
Young, et al. Proc. Natl. Acad. Sci. U.S.A. 80:1194-1198 (1983).
Kushner (1987) Escherichia Coli and Salmonnella Typhimurium vol. 2 ed.
Neidhart PN J02111796-A (1990)*.
Isobe et al. (1991) J. Mol. Biol. vol. 217 pp. 125-132.
Nielsen (1991) Biochimica et Biophysica Acta vol. 1088 pp. 425-428.
Brandt et al. (1992) #Accession S1891l*.
Adams et al. (1992) Nature 355, 632-634*.
Hazen et al. (1990) J. Biol. Chem. vol. 265(18) pp. 10622-10630*.
Hazen et al. (1991) Biochem J. vol. 280 pp. 581-587.
Hazen et al. (1992) Circ Res. (U.S.) 70(3) pp. 486-495*.
Ye et al. (1987) J. Biol. Chem. vol. 262 (No. 8) pp. 3718-3725.
Ichimura et al. (1987) Febs Lett vol. 219 (No. 1) pp. 79-82.
Murakami et al. (1992) J. Biochem. 111(2) pp. 175-181.
Kramer et al. (1991) J. Biol. Chem 266 (8) pp. 5268-5272.
Aarsman et al. (1989) J. Biol. Chem vol. 264 (No. 17) pp. 10008-10014.
Hirashima et al. (1992) J. Neurochem. vol. 59(2) pp. 708-714.*
|
Primary Examiner: Schwartz; Richard A.
Assistant Examiner: Choi; Kathleen L.
Attorney, Agent or Firm: Woodcock Washburn Kurtz Mackiewicz & Norris
Goverment Interests
ACKNOWLEDGEMENT OF GOVERNMENT SUPPORT
This invention was made with Government support under HL35864 awarded by
NIH. The Government has certain rights in this invention.
Claims
What is claimed is:
1. A purified nucleic acid molecule having a nucleotide sequence that
encodes an amino acid sequence that comprises SEQ ID NO: 2.
2. The purified nucleic acid molecule according to claim 1 comprising the
coding portion of SEQ ID NO: 1.
3. An expression vector comprising the nucleic acid molecule of claim 1.
4. An expression vector comprising the nucleic acid molecule of claim 2.
5. A transformed host cell comprising the expression vector of claim 3.
6. A transformed host cell comprising the expression vector of claim 4.
Description
FIELD OF THE INVENTION
The present invention relates to the field of polypeptides produced by
recombinant DNA technology, more particularly the present invention
relates to the field of polypeptides having phospholipase A.sub.2
activity.
BACKGROUND OF THE INVENTION
Many lipids or lipid-derived products generated by phospholipases acting on
phospholipids in membranes have been implicated as mediators and second
messengers in signal transduction. Lipid-derived second messengers of
signal transduction are typically short-lived lipid metabolites that are
synthesized from membrane-derived lipid precursors in response to cell
stimulation (e.g., ligand-receptor coupling, electrical stimulation, and
elevation in intracellular calcium). The production of lipid-derived
second messengers is initiated by the activation of intracellular
phospholipases, which liberate metabolites capable of propagating a
cell-specific cascade of biochemical events that collectively results in
cell activation.
One such lipid second messenger is arachidonic acid which is found
esterified in the sn-2 position of membrane phospholipids and can
potentially be released by a number of phospholipases, although recent
research points to phospholipase A.sub.2 as the major mediator of
arachidonic acid release, at least for prostaglandin and leukotriene
biosynthesis. The other product of phospholipase A.sub.2 action is
lysophospholipid, a class of amphiphilic molecules that contribute to
membrane regulation by virtue of their ability to alter membrane physical
properties and also serve either as direct precursors of lipid second
messengers (e.g., platelet activating factor) or are second messengers in
their unmodified form. When the phospholipid is an alkyl ethercontaining
phosphatidylcholine, the lysophospholipid upon acetylation forms
platelet-activating factor (PAF), another lipid that is a potent cellular
mediator.
Arachidonic acid mobilized from intracellular phospholipid storage depots
in cellular membranes thus has multiple metabolic fates including: 1)
internal oxidation, resulting in the generation of biologically active
eicosanoids; 2) transacylation, resulting in the redistribution of
arachidonic acid in phospholipid molecular species; 3) thioesterification,
resulting in the subsequent reincorporation of released arachidonic acid
into lipid metabolic pathways; or 4) secretion into the extracellular
space, facilitating cell to cell communication.
Davidson and Dennis (1990) J. Mol. Evol. 31, 228-238 recently compared and
aligned all of the known sequences of phospholipase A.sub.2. Low molecular
weight phospholipases A.sub.2 sequenced to date are all considered to be
secreted and are composed of a single polypeptide chain, about 120 amino
acids long, containing 10-14 cysteines, all in disulfide pairs. These
cysteines constitute the bulk of the sequence conservation between the
mammalian, reptile and insect secreted enzymes. In addition, these
phospholipases A.sub.2 require Ca.sup.+2 for activity and contain a
conserved Ca.sup.+2 binding loop, whereas the nearby catalytic site
contains a histidine/aspartic acid pair conserved throughout. Two human
low molecular weight phospholipases A.sub.2 have been sequenced. One is
from the pancreas and is similar to the venom phospholipases A.sub.2 of
the old-world cobras and kraits, except for the addition of an internal
loop of five amino acids and the fact that it is produced as a proenzyme.
The other sequenced human low molecular weight phospholipase A.sub.2,
originally isolated from platelets and synovial fluid, is similar to the
venom phospholipases A.sub.2 of old- and new-world snakes such as the
diamondback rattlesnake. These sequences have an extended COOH terminus
and a related but distinct disulfide bond pattern. Bee venom phospholipase
A.sub.2 shows a highly divergent sequence that is missing an NH.sub.2
-terminal section, but is homologous in other regions.
In order to fully appreciate the activity of phospholipase A.sub.2 and its
role in cellular communication and disease, much research has been done on
extracellular secreted phospholipases A.sub.2. Although these studies have
provided valuable information, the contribution of intracellular
phospholipase A.sub.2 has not been well-studied. The single human non-low
molecular weight phospholipase A.sub.2 sequenced to date is an 85kD
polypeptide which shares limited structural homology with protein kinase
C, GAP, and phospholipase C, Clark et al. (1991) Cell 65, 1043-1051 and
Sharp et al. (1991) J. Biol. chem. 266, 14850-14853. Other forms of
intracellular phospholipase A.sub.2 remain poorly characterized. Thus
there continues to be a need for identification and characterization of
new phospholipase A.sub.2 enzymes.
SUMMARY OF THE INVENTION
The present invention provides a novel human polypeptide having
phospholipase A.sub.2 activity. Applicant has discovered a novel human
polypeptide having phospholipase A.sub.2 activity. The polypeptide
discovered by Applicant has not heretofore been reported in humans and
will be referred to hereinafter as PLA.sub.2 (Ca.sup.-). The novel
polypeptide of the invention catalyzes the cleavage of the sn-2 fatty acid
of choline and ethanolamine glycerophospholipids through the formation of
a stable acyl-enzyme intermediate. Transesterification of the sn-2 acyl
group of phosphatidylcholine to the recombinant 30 kDa polypeptide of the
invention is over 50-fold selective for arachidonic acid, is augmented by
calcium ion and results in the formation of an arachidonoyl-thioester
intermediate.
The polypeptide of the invention is a novel intracellular, mammalian
phospholipase A.sub.2 that employs a catalytic strategy distinct from that
utilized by extracellular phospholipases A.sub.2 (i.e., formation of an
acyl-enzyme intermediate by nucleophilic attack versus activation 10 of a
water molecule). The invention also provides nucleic acid sequences coding
for the novel polypeptide, expression vectors comprising the nucleic acid
sequences coding for the novel polypeptide, host cells and cell cultures
capable of expressing the novel polypeptide. The invention additionally
provides purified PLA.sub.2 (Ca.sup.-). The present invention further
provides antisense oligonucleotides for modulation of expression of the
gene coding for the novel polypeptide. Assays for screening test compounds
for their ability to inhibit phospholipase A.sub.2 activity are also
provided.
This invention is more particularly pointed out in the appended claims and
is described in its preferred embodiments in the following description.
BRIEF DESCRIPTION OF THE FIGURES
FIG. 1A and FIG. 1B shows nucleotide sequence and deduced amino acid
sequence of the human placental cDNA sequence coding for the novel
polypeptide of the invention. The sequence in FIG. 1A and FIG. 1B has 84
nucleotides present in the 5' non-translated region (SEQ ID NO: 1, bases
1-84), 735 bases of translated message corresponding to a polypeptide of
245 amino acids (SEQ ID NO: 1, bases 85-822) and 31 bases in the 3'
non-translated region. Sequences of proteolytic peptides derived from
sheep platelet phospholipase A.sub.2 are shown by underlining. These
proteolytic peptides were identical to the sequence deduced for the novel
polypeptide of the invention in 81 of 82 amino acids, differing only in
amino acid 219 where a glutamine for glutamate substitution was present in
the polypeptide of the invention.
DETAILED DESCRIPTION OF THE INVENTION
The present invention provides a novel intracellular human phospholipase
A.sub.2 that employs a catalytic strategy distinct from that utilized by
extracellular phospholipases A.sub.2 (i.e., formation of an acyl-enzyme
intermediate by nucleophilic attack versus activation of a water
molecule). Fragments of PLA.sub.2 (Ca.sup.-) having phospholipase A.sub.2
activity are also within the scope of the invention. The novel PLA.sub.2
(Ca.sup.-) of the invention catalyzes the cleavage of the sn-2 fatty acid
of choline and ethanolamine glycerophospholipids through the formation of
a stable acyl-enzyme intermediate. Transesterification of the sn-2 acyl
group of phosphatidylcholine to the recombinant polypeptide is over
50-fold selective for arachidonic acid, is augmented by calcium ion and
results in the formation of an arachidonoyl-thioester intermediate. The
major phospholipase A.sub.2 activity in sheep platelets is mediated by at
least three chromatographically resolvable isoforms of a 60 kDa dimeric
polypeptide (containing 30 kDa subunits) which are responsive to
physiologic increments in calcium ion and possess a dramatic substrate
selectivity (Loeb, L. A. and Gross, R. W. (1986) J. Biol. Chem: 261:10467-
10470). Similar to the sheep platelet PLA.sub.2 's, the PLA.sub.2 of the
present invention does not require calcium for activation.
Although calcium ion augmented the incorporation of arachidonic acid into
recombinant protein, it was not an obligatory cofactor in the formation of
the arachidonoylenzyme intermediate (i.e., the acylenzyme was formed in
the presence of EGTA). These results are comparable to prior experimental
findings utilizing sheep platelet phospholipase A.sub.2 where calcium ion
was found to be sufficient, but not necessary, for activation of this
phospholipase A.sub.2 (Zupan, L. A. Kruszka, K. K., and Gross, R. W. FEBS
284, 27-30 (1991)). PLA.sub.2 (Ca.sup.-) is presently believed to be
expressed in platelets. Polyclonal antibodies prepared against purified
sheep platelet PLA.sub.2 cross-react with the PLA.sub.2 found in human
platelets.
One unifying biochemical mechanism present during signal transduction in
the majority of mammalian cells is that arachidonic acid is released from
endogenous phospholipid storage pools after ligand-receptor coupling. The
concentration of free arachidonic acid in resting cells is small because
the overwhelming majority of cellular arachidonic acid is covalently
linked to the sn-2-position of phospholipid storage pools. However, during
cellular activation the concentration of non-esterified arachidonic acid
is dramatically increased by intracellular phospholipases.
Released arachidonic acid is rapidly oxygenated by one of several oxidative
enzymes (e.g. cyclooxygenase or lipoxygenase) to initiate an enzymatic
cascade that results in the generation of a multiplicity of different
oxygenated metabolites of arachidonic acid (e.g. eicosanoids). Eicosanoids
are a family of oxygenated arachidonic acid derivatives that interact with
specific cellular receptors to amplify and propagate the flow of
biological information. Because the eicosanoid-producing oxidative enzymes
can not oxygenate esterified arachidonic acid present in phospholipids,
arachidonic acid is biologically inactive until it is released from
endogenous phospholipids by intracellular phospholipases. Furthermore,
because the release of arachidonic acid from endogenous membrane stores by
phospholipases is the rate-limiting step in eicosanoid production it is
clear that the extent of phospholipase activation represents a primary
biochemical determinant of the magnitude and type of each cell's response
to stimulation. Since the Km of arachidonic acid for either cyclooxygenase
or lipoxygenase is well above the concentration of free arachidonic acid
in resting cells, the potential for the rapid catalytic amplification of a
single chemical stimulus by the activation of phospholipase is inherent in
the design of this signal transduction system.
After arachidonic acid is released from endogenous phospholipid stores, a
highly specific cascade of enzyme-related reactions is initiated, which
leads to the production of structurally related metabolites (eicosanoids)
that have separate and distinct biological functions. These oxygenated
eicosanoids are highly lipid soluble and thus they readily traverse
cellular membranes, facilitating their interaction with receptors on
adjacent cells or with receptors in their cell of origin.
Arachidonic acid may be released directly by the action of phospholipase
A.sub.2 or by sequential enzymic reactions initiated by phospholipase
A.sub.1, C or D. Recent work has demonstrated that arachidonic acid
released during cell stimulation typically results from activation of at
least two types of phospholipase activities, phospholipase A.sub.2 and
phospholipase C. For example, platelet activation by thrombin results in
the highly selective release of arachidonic acid from endogenous
phospholipids that is accompanied by the concomitant accumulation of
lysophospholipids, diglycerides and phosphatidic acid.
A wide variety of cells produce platelet-activating factor (PAF) when
stimulated, including, but not limited to, platelets, basophils,
neutrophils, macrophages, and endothelial cells. An essential biochemical
requirement for the production of PAF is the ability of PAF-producing
cells to contain the enzymic machinery necessary to synthesize the
1-O-alkyl bond. Two predominant mechanisms for PAF biosynthesis occur in
mammalian cells. The first pathway is initiated by phospholipase A.sub.2
hydrolysis of 1-O-alkyl-2-acyl-sn-glycerol-3-phosphocholine (alkyl acyl
GPC) followed by acetylation of lyso-PAF. The second pathway involves
acetylation of 1-O-alkyl-2-lyso-sn-glycerol-3-phosphate followed by
dephosphorylation to yield 1-O-alkyl-2-acetyl-sn-glycerol. This moiety
subsequently condenses with CDP choline to produce PAF.
Platelet activation by thrombin or collagen results in PAF synthesis.
Subsequent interaction of PAF with its plasma membrane receptor induces
serotonin release from intracellular granules and platelet aggregation.
PAF also modulates neutrophil degranulation, phagocytosis, exocytosis,
chemotaxis, and superoxide production. Macrophage phagocytosis of zymosan
particles, antibody-coated erythrocytes and immune complexes is
accompanied by PAF production that modulates a variety of subsequent
macrophagemediated events.
PAF is also a lipid mediator of anaphylactic responses. PAF produced by
anti-IgE challenges of IgE-sensitized basophils results in degranulation
and histamine release. PAF can induce rapid and shallow breathing,
transient apnea, and pulmonary edema in the respiratory system. In the
cardiovascular system, PAF directly induces bradycardia hypotension,
elevated right ventricular pressure, vascular spasms and increased
vascular permeability.
PAF also has potent effects on many other biological systems. For example,
PAF induces hepatic phosphoinositide turnover and glycogenolysis, which is
accompanied by glucose release into the plasma. PAF has also been
implicated as a mediator of ischemic bowel necrosis because it can
independently induce lesions that are morphologically similar to those
present during human necrotizing enterocolitis. Additionally, the role of
PAF or a PAF-like lipid as an endogenous antihypertensive substance is
currently under intense experimental scrutiny.
Nucleic acid sequences coding for the novel phospholipase A.sub.2 of the
invention may be obtained from human tissue. Although the nucleic acid
sequences coding for PLA.sub.2 (Ca.sup.-) have been initially isolated
from cDNA libraries prepared from human placenta, the nucleic acid
sequences coding for PLA.sub.2 (Ca.sup.-) can also be isolated from
genomic DNA and other human cDNA libraries.
At the present time, several nucleic acid sequences coding for PLA.sub.2
(Ca.sup.-) have been discovered in human tissue (one of which has been
fully sequenced (SEQ ID NO: 1), the others partially characterized, SEQ ID
NO: 3 and SEQ ID NO: 4). Due to natural allelic variation or the presence
of isoforms of this activity, other variants of PLA.sub.2 (Ca.sup.-) may
also be present in human tissue. Accordingly, any and all such natural
variants of PLA.sub.2 (Ca.sup.-) are within the scope of the present
invention.
Fragments of the nucleic acid sequence of the invention coding for portions
of PLA.sub.2 (Ca.sup.-) having phospholipase A.sub.2 activity are also
within the scope of the invention. Phospholipase A.sub.2 activity refers
to the ability to cleave arachidonic acid from a phospholipid, preferably
from the sn-2 position and/or facilitate the subsequent release of fatty
acid to other nucleophilic acceptors, e.g. water (phospholipase), lipids
(transacylase) or protein (e.g. cyclooxygenase or lipoxygenase).
The nucleic acid sequences of the invention may also contain linker
sequences, restriction endonuclease sites and other sequences useful for
cloning, expression or purification of PLA.sub.2 (Ca.sup.-) or fragments
thereof.
Another aspect of the present invention provides expression vectors, host
cells transformed to express the nucleic acid sequences of the invention,
and cell cultures capable of expressing the nucleic acid sequences of the
invention. Nucleic acid coding for PLA.sub.2 (Ca.sup.-) or at least one
fragment thereof may be expressed in prokaryotic or eukaryotic host cells,
including bacterial cells such as E. coli, Bacillus subtilis and other
enterobacteriaceae such as Salmonella typhimurium or Serratia marcescens,
insect cells such as Spodoptera frugiperda, yeast cells such as
Saccharomyces cerevisiae, or mammalian cells such as Chinese hamster ovary
cells (CHO), COS-7 or MDCK cells. The foregoing list is illustrative only
and is not intended in any way to limit the types of host cells suitable
for expression of the nucleic acid sequences of the invention. As used
herein, expression vectors refers to any type of vector that can be
manipulated to contain a nucleic acid sequence coding for PLA.sub.2
(Ca.sup.-) or at least one fragment thereof, such as plasmid expression
vectors and viral vectors. In any particular embodiment of the invention,
the expression vector is selected to be compatible with the desired host
cell so that expression of the nucleic acid coding for PLA.sub.2
(Ca.sup.-) or fragment thereof will be achieved. Plasmid expression
vectors preferably comprise a nucleic acid sequence of the invention
operably linked with at least one expression control element such as a
promoter. In general, plasmid vectors contain replicon and control
sequences derived from species compatible with the host cell. To
facilitate selection of plasmids containing nucleic acid sequences of the
invention, plasmid vectors may also contain a selectable marker such as a
gene coding for antibiotic resistance. Most commonly used are the genes
coding for ampicillin, tetracycline, chloramphenicol, or kanamycin
resistance. Suitable expression vectors, promoters, enhancers, and other
expression control elements are known in the art and may be found, for
example, in Sambrook et al. Molecular Cloning: A Laboratory Manual, second
edition, Cold Spring Harbor Laboratory Press, Cold Spring Harbor, N.Y.,
1989. For example, for expression in E. coli, plasmids such as pBR322,
pUC18, and pUC19 may be used. For expression in S. cerevisiae plasmids
such as YRp7 may be employed. See, for example, U.S. Pat. No. 4,766,075
for other plasmids and methods for expression of foreign genes in yeast
cells. For expression in mammalian cells, plasmids such as pMT2 and pMSG
may be employed. Expression in yeast, insect or mammalian cells would lead
to partial or complete glycosylation of the recombinant material and
formation of any inter- or intrachain disulfide bonds, if such exist.
Suitable viral vectors include baculovirus (see U.S. Pats. Nos. 4,745,051
and 4,879,236, and Summers and Smith "Manual of Methods for Baculovirus
Vectors and Insect Cell Culture Procedures", 2nd edition, Texas
Agricultural Station Bulletin No. 15555, Texas Agricultural Experiment
Station, College Station, Tex.), Vaccinia virus (Mackett et al (1985) DNA
Cloning: A Practical Approach, D. M. Glover, ed., vol. 2, p. 191, IRL
Press, Oxford, England), and adenovirus (Berkner, K. L. (1988)
BioTechniques 6: 616). A preferred expression vector is baculovirus.
If PLA.sub.2 (Ca.sup.-) or fragment thereof is expressed as a fusion
protein, it is particularly advantageous to introduce an enzymatic
cleavage site at the fusion junction between the carrier protein and
PLA.sub.2 (Ca.sup.-) or fragment thereof. PLA.sub.2 (Ca.sup.-) or fragment
thereof may then be recovered from the fusion protein through enzymatic
cleavage at the fusion site and biochemical purification using
conventional techniques for purification of proteins and peptides.
Depending on the type of expression vector employed, host cells can be
transformed to express the nucleic acid sequences of the invention using
conventional techniques such as calcium phosphate or calcium chloride
co-precipitation, DEAE-dextran-mediated transfection, or electroporation.
The term transformed, as used herein refers to the incorporation of an
expression vector containing the nucleic acid sequence coding for
PLA.sub.2 (Ca.sup.-) or at least one fragment thereof into a host cell by
any method including infection in the case of viral vectors. Suitable
methods for transforming the host cells are well-known and may be found in
Sambrook et al., Molecular Cloning: A Laboratory Manual, second edition,
Cold Spring Harbor Laboratory Press, Cold Spring Harbor, N.Y., 1989, and
other laboratory textbooks. The transformed host cells thus form cell
cultures capable of expressing PLA.sub.2 (Ca.sup.-) or at least one
fragment thereof. The nucleic acid sequences of the invention may also be
synthesized using standard techniques.
The host cells are then cultured in an appropriate medium to produce a
mixture of cells and medium containing the phospholipase A.sub.2
(Ca.sup.-) or fragment thereof. Optionally, the mixture may be purified to
produce purified phospholipase A.sub.2 (Ca.sup.-) or fragment thereof. The
terms "purified" and "isolated" are used interchangeably herein and, when
used to describe the state of PLA.sup.2 (Ca.sup.-) produced by the
invention, refers to PLA.sub.2 (Ca.sup.-) substantially free of protein or
other materials normally associated with PLA.sub.2 (Ca.sup.-) when
produced by non-recombinant cells, i.e. in its "native state".
"Substantially" refers to greater than about 50% purity of PLA.sub.2
(Ca.sup.-), i.e. PLA.sub.2 (Ca.sup.-) is present in a mixture of PLA.sub.2
(Ca.sup.-) and other material in an amount greater than about 50% of the
mixture. It is to be understood, that the level of purity of PLA.sub.2
(Ca.sup.-) is not critical to the activity or usefulness of the
polypeptide of the invention. For example, when produced in E. coli,
PLA.sub.2 (Ca.sup.-) is present in the membrane fraction and can be used
without purification. Thus purification of the polypeptide is not required
for its use in assays. Suitable purification methods include ion exchange
chromatography, affinity chromatography, electrophoresis and other
conventional methods for purification of proteins. See, for example,
Scopes, Protein Purification, Principles and Practice, second edition,
Springer-Verlag, New York, 1987 for these and other suitable methods for
purification of the PLA.sub.2 (Ca.sup.-) protein and fragments thereof.
Another aspect of the invention provides antisense oligonucleotides capable
of inhibiting expression of the nucleic acid sequence coding for PLA.sub.2
(Ca.sup.-). The oligonucleotides of the invention are preferably from
about 10 to about 50 bases in length, more preferably from about 12 to
about 30 bases in length, most preferably from about 15 to about 25 bases
in length. Oligonucleotides may be selected from any portion of the
complementary sequence of the nucleic acid sequence coding for PLA.sub.2
(Ca.sup.-) (SEQ ID NO: 1). Preferably, however, the oligonucleotides
comprise sequences complementary to the 5' end of the coding sequence
which may also include sequences complementary to the 3' end of the
promoter for this gene. Selected sequences of the nucleic acid sequence
coding for PLA.sub.2 (Ca.sup.-) can be tested for activity, e.g., by
contacting cells capable of expressing PLA.sub.2 (Ca.sup.-) with the
oligonucleotide under conditions appropriate for passage of the nucleic
acid sequence into the cells, and determining the presence of PLA.sub.2
(Ca.sup.-) or PLA.sub.2 (Ca.sup.-) activity in the cells. If expression of
the gene coding for PLA.sub.2 (Ca.sup.-) has been inhibited by the
oligonucleotide, PLA.sub.2 (Ca.sup.-) or PLA.sub.2 (Ca.sup.-) activity in
the cells will be less than that present in control cells not exposed to
the oligonucleotide.
The antisense oligonucleotide sequences can be DNA or RNA. Both types are
referred to herein as oligonucleotides. The oligonucleotides can be
chemically synthesized using known techniques or produced using
recombinant DNA techniques. The oligonucleotides of the invention can be
modified at a variety of locations along their length. For example, they
can be modified by the addition of groups at the 5' end, the 3' end or
both, as well as on the internal phosphate groups or on the bases. Whether
oligonucleotides to be used are modified, and, if so, the location and
extent of modification will be determined, for example, by the desired
effect on gene expression, uptake of the oligonucleotides into cells, and
inhibition of degradation of the oligonucleotides once they are inside
cells. For example, if the desired effect is increased uptake of the
oligonucleotide into cells, modification of the oligonucleotide by
addition of a lipophilic group at the 5' end would be beneficial. Uptake
of the oligonucleotides into cells can also be increased by linkage to a
protein which interacts with receptors or antigenic sites on the surface
of the cell as described in U.S. Pat. No. 4, 587,044. Modification of
oligonucleotides can also be carried out by the addition of an
intercalating agent such as an acridine dye at 5' or 3' ends of the
oligonucleotides, on bases, or on internucleophosphate groups.
Modification in this manner may result in stronger bonding between the
oligonucleotides of the invention and the target complementary sequence of
the gene. Modification of the internal phosphate groups or backbone of the
oligonucleotide can be accomplished in a variety of ways such as alkyl or
aryl phosphonate linkage of bases described in U.S. Pat. No. 4,469,863,
phosphorothioate linkage of bases, formacetal linkage as described in
Matteucci, M. (1990) Tetrahedron Letters 31, 2385-2388. This list is
exemplary only and is not intended to limit in any way the types of
modifications of the oligonucleotides that are useful in the present
invention.
A further aspect of the invention provides methods of inhibiting PLA.sub.2
(Ca.sup.-) expression comprising contacting cells with a nucleic acid
sequence complementary to one or more regions of the PLA.sub.2 (Ca.sup.-)
gene and capable of hybridizing with one or more regions of the PLA.sub.2
(Ca.sup.-) gene, under conditions appropriate for passage of the nucleic
acid sequence into the cells. Preferred cells are human cells.
For in vivo uses, it is generally preferred to apply the oligonucleotides
of the invention internally such as orally, intravenously, parenterally or
intramuscularly. Other forms of administration, such as transdermal or
topical may also be useful. Oligonucleotides are preferably administered
in combination with a pharmaceutically acceptable carrier or diluent such
as saline or a buffer. The oligonucleotides may also be mixed with
liposomes or other carriers. For in vitro use, the oligonucleotides are
generally in a suitable buffer.
The PLA.sub.2 (Ca.sup.-) is also useful as an antigen for preparation of
polyclonal and/or monoclonal antibodies. Such antibodies can be prepared
using standard techniques, such as the methods in Harlow and Lane,
Antibodies, A Laboratory Manual, Cold Spring Harbor Laboratory, Cold
Spring Harbor, N.Y. 1988.
PLA.sub.2 (Ca.sup.-) of the invention is additionally useful in screening
assays for identification of compounds capable of inhibiting PLA.sub.2
(Ca.sup.-) which are expected to be useful as an anti-platelet therapeutic
or in treating conditions or their sequelae linked to the release of
arachidonic acid and the synthesis of eicosanoids, as discussed herein,
such as myocardial infarction, autoimmune disease, allergy,
atherosclerosis and inflammation. Accordingly, the present invention
provides a method for identifying compounds capable of inhibiting
PLA.sub.2 (Ca.sup.-) comprising contacting PLA.sub.2 (Ca.sup.-) with a
arachidonic acid moiety; and determining arachidonic acid incorporation
into PLA.sub.2 (Ca.sup.-) and/or the release of arachidonic acid to other
nucleophilic acceptors as detailed previously.
PLA.sub.2 (Ca.sup.-) of the invention can be substituted for other
PLA.sub.2 's in assays designed to test PLA.sub.2 activity such as, for
example, the assay disclosed herein in the Examples or in Wolf and Gross
(1985) J. Biol. Chem. 260, 7295-7303 and modifications thereof. The
PLA.sub.2 (Ca.sup.-) of the invention can be substituted for other
PLA.sub.2 's in screening assays to identify compounds having PLA.sub.2
inhibitory or activating activity such as, for example, the assay
described herein in the Examples or Lombardo and Dennis (1985) J. Biol.
Chem. 260, 7234-7240 or Deems et al. (1987) Biochem. Biol. Acta 917,
258-268. PLA.sub.2 inhibitory activity refers to the ability of a compound
to inhibit the cleavage of arachidonic acid from a phospholipid by
PLA.sub.2, preferably from the sn-2 position of a phospholipid.
Conversely, PLA.sub.2 activating activity refers to the ability of a
compound to stimulate or increase the rate of cleavage of arachidonic acid
from a phospholipid by PLA.sub. 2, preferably from the sn-2 position of a
phospholipid.
Further, the nucleic acid sequence of the invention can be used in nucleic
acid hybridization assays for detection of RNA or DNA coding for PLA.sub.2
(Ca.sup.-) or closely related isoforms of this polypeptide in human tissue
according to methods known in the art.
EXAMPLES
Cloning Of cDNA Sequence Coding For PLA.sub.2 (Ca.sup.-) Antibody
Production
Sheep platelet phospholipase A.sub.2 was purified to apparent homogeneity
according to the method of Loeb, L. A., and Gross, R. W. (1986) J. Biol.
Chem. 261, 10467-10470 and injected intradermally into rabbits. The serum
of one of fourteen rabbits evaluated contained a high affinity antibody
(1:10,000 titer by ELISA) which recognized a predominant immunoreactive
band at 30 kD (i.e., sheep platelet PLA.sub.2) after Western blotting. The
polyclonal antibody was purified by ion exchange chromatography according
to the method of Bruck, D., Portetelle, D., Glineur, C., and Bollen A.
(1982) J. Immunol. Methods 53, 313-319 and the resultant salt eluate was
subsequently "cleared" by incubation with E. coli lysate.
cDNA Cloning
A human placental .lambda.gt11 cDNA library as disclosed in Ye, R. D., Wun,
T., and Sadler, J. E. (1987) J. Biol. Chem 262, 3718-3725 was kindly
provided by Dr. E. Sadler (Washington University, St. Louis, Mo.).
Expression screening of 2.6.times.10.sup.6 plaques with antibody directed
against sheep platelet phospholipase A.sub.2 described in 1. led to the
identification of eight positive clones. Secondary screening was performed
by identification of clones which produced a .beta.-gal fusion protein
capable of serving as antigen to affinity purified antibody directed
against sheep platelet phospholipase A.sub.2 according to the method of
Young and Davis (1983) Proc. Natl Acad. Sci. USA 80, 1194-1198.
Homogenates of isopropyl-.beta.-thiogalactopyranoside (IPTG) induced
clones were blotted onto nitrocellulose paper, incubated with polyclonal
antibody to sheep platelet phospholipase A.sub.2, exhaustively washed and
bound antibody was eluted by exposure to acidic buffer. The bound and
subsequently eluted antibody was neutralized prior to its utilization as
screening reagent by Western blotting of nitrocellulose strips containing
bound authentic purified sheep platelet phospholipase A.sub.2. Homogenates
from a single clone (termed Clone D) were able to bind polyclonal antibody
produced against sheep platelet phospholipase A.sub.2 fusion protein and
release it during exposure to acidic buffer culminating in a positive
Western blot with authentic sheep platelet phospholipase A.sub.2 Sanger
dideoxy sequencing of the single positive clone isolated after secondary
screening (clone D) demonstrated that it contained an open reading frame
which was insufficient to encode the entire 30 kDa polypeptide (clone D
corresponds in part to residues 426-855 in FIG. 1A and FIG. 1B SEQ ID NO:
1). Accordingly, the insert in clone D was labeled by random hexamer
priming according to the method of Feinberg, A. P. and Vogelstein, B.
(1983) Anal. Biochem. 132, 6-13 and was utilized to rescreen the placental
.lambda.gt11 cDNA library. Rescreening of the placental .lambda.gt111 cDNA
library was performed by oligonucleotide screening with the random hexamer
labelled probe. This led to the identification of an additional twelve
positive clones which were selected for "completeness" through
hybridization with an oligonucleotide probe corresponding to the 5' end of
clone D (CAAAGTCTTCTATTTGAA)(SEQ ID NO: 7). Of the four clones which
hybridized to the 5, end of clone D, only one (termed clone 38) contained
the entire coding region. All sequences were confirmed from independent
clones and/or sequencing of complementary strands.
The composite cDNA sequence assembled from overlapping cDNA clones is shown
in FIG. 1A and FIG. 1B (SEQ ID NO: 1) with the deduced amino acid sequence
below. A total of 2834 nucleotides were present with 84 nucleotides in the
5' non-translated region, 735 residues of translated message corresponding
to a polypeptide of 245 residues (calculated M.sub.r =27745) and 2015
bases in the 3' nontranslated region. The coding portion of the protein
begins at base 85 with methionine and ends with TAA at base 822.
The deduced amino acid sequence of this human intracellular phospholipase
A.sub.2 contained an open reading frame comprised of 245 residues
(calculated M.sub.r =27745) which was preceded by a typical Kozak
initiation sequence (GTCATGG) and was terminated by a TAA stop codon.
Inframe stop codons were present in both the 5' and 3' non-coding regions.
EXPRESSION OF DNA SEQUENCE CODING FOR PLA.sub.2 (Ca.sup.-)
The cDNA insert coding for the full-length PLA.sub.2 (Ca.sup.-) was excised
from .lambda.gt11 with EcoRI and cloned into pUC18 (Life Technologies,
Inc., Grand Island, N.Y.) at the EcoRI site. These were amplified by
polymerase chain reaction (PCR) utilizing primers which introduced an Nco
I restriction site flanking the 5' end and a BspMI restriction site
(containing a Hind III compatible sequence) flanking the 3' end. The
primers used had the following sequences:
TTCTGAATTCAGGAAACAGACCATGGATAAAAATGAGCTGGTT (SEQ ID NO: 5)
(the underlined portion is the Ncol site, and the 5' coding portion begins
at SEQ ID NO: 5, base 22)
AAGAGAATTCAGCTGGAAGCAGGTTTAATTTTCCCCTCCTTCTCC (SEQ ID NO: 6)
(the underlined portion is the BspMI site and the end of the coding region
(3') begins at SEQ ID NO: 6, base 25)
Polymerase chain reaction was performed according to the method of Saiki et
al. (1988) Science 238, 487-491. Subsequent restriction digestion with
NcoI and BspMI resulted in the generation of a 752 BP fragment containing
the entire coding sequence with Nco I and Hind III cohesive ends. Next,
pMON 5842 (Monsanto Co., Chesterfield, Missouri) was digested with Nco I
and Hind III restriction enzymes prior to the subsequent ligation of the
coding sequence into the adapted pMON 5842. The structural integrity of
the coding sequence was verified by Sanger dideoxy nucleotide sequencing.
pMON 5842 contains the isopropyl-.beta.-thio-galactopyranoside
(IPTG)-inducible ptac promoter with g10L leader sequence.
E. coli DH5.alpha.F'IQ cells (Life Technologies, Inc., Grand Island, N.Y.)
were transformed with recombinant plasmid and incubated overnight in LB
medium (Difco Laboratories, Detroit, Michigan) containing spectinomycin
(Sigma, St. Louis, Mo.) (20 ug/ml). Recombinant PLA.sub.2 (Ca.sup.-) was
subsequently induced by incubation with 2 mM IPTG for thirty minutes.
Cells were pelleted by centrifugation at 750 xg.sub.max resuspended in
buffer (50 mM Tris-Cl, pH 7.0, containing 1 mM EGTA, 10% glycerol and
0.25M dextrose), sonicated for one 20 second burst and centrifuged at
175,000 xg.sub.max for thirty minutes to separate the cytosolic and
membrane fractions.
The membrane and cytosolic fractions were separated by SDS-PAGE.
Transformation of E. coli and induction of recombinant PLA.sub.2
(Ca.sup.-) by incubation with IPTG resulted in the de novo appearance of
immunoreactive protein migrating at 30 KDa which was predominantly present
in the membrane fraction. The de novo appearance of a polypeptide in
transformed E. coli precisely corresponded to the molecular mass of sheep
platelet phospholipase A.sub.2. The 30 kDa recombinant polypeptide was
recognized by antibody generated against purified sheep platelet
phospholipase A.sub.2.
Analysis Of Recombinant PLA.sub.2 (Ca.sup.-)
Both the purified sheep platelet phospholipase A.sub.2 and the recombinant
protein were digested with trypsin and the resulting peptides were
subjected to Edman degradation. The sequences of nine peptides derived
from proteolysis of homogeneous sheep platelet phospholipase A.sub.2 and
subsequent Edman degradation were contained in the deduced amino acid
sequence derived from Clone 38 which contained the entire coding sequence
for PLA.sub.2 (Ca.sup.-). (The peptides are shown underlined in FIG. 1A
and FIG. 1B).
PLA.sub.2 (Ca.sup.-) was found to have a molecular weight of about 30 kDa.
The polypeptide was highly charged, containing 13% basic residues and 18%
acidic residues which was consistent with its observed isoelectric point
of 4.8. A hydropathy plot did not reveal any extended regions of
hydrophobicity which could serve either as a signal polypeptide or as a
transmembrane domain. Northern analysis of human placental mRNA
demonstrated a single major band at 2.9 kb.
Homology searches demonstrated that 30 kDa PLA.sub.2 (Ca.sup.-) possesses
73% homology to the .eta. chain of the 14-3-3 protein, a brain-specific
dimeric protein having a molecular weight of about 55 kDa believed to have
a function in monoamine biosynthesis because of its ability to activate
tryosine hydroxylase and tryptophan hydroxylase, Ichimura et al. (1988)
Proc. Natl. Acad. Sci. U.S.A. 85, 7084-7088. Homology between the tryptic
peptides derived from sheep platelet phospholipase A.sub.2 and the deduced
human amino acid sequence of PLA.sub.2 (Ca.sup.-) was considerably more
extensive (matches between 81 of 82 amino acids) than that present between
bovine 14-3-3 protein and human phospholipase A.sub.2. These results
suggest that the clone described herein represents a distinct gene
product. No extended regions of significant homology between the PLA.sub.2
(Ca.sup.-) coding sequence and other previously reported extracellular or
intracellular phospholipase were found. Subsequent screening of a human
EMBL-3 genomic library (Clontech, Palo Alto, Calif.) demonstrated the
presence of at least three different genes. Partial sequences of two of
these genes are shown in SEQ ID NO: 3 and SEQ ID NO: 4.
Activity Of PLA.sub.2 (Ca.sup.-) Identification of Acyl-Enzyme
Intermediates. Membranes derived from wild type (untransformed) or
recombinant E. coli (PLA.sub.2 (Ca.sup.-) is found in the membrane
fraction) were incubated with 1-palmitoyl-2-[1-.sup.14
C]-arachidonoyl-sn-glycero-3-phosphocholine (.about.50 uM, specific
activity=110,000 dpm/nmol (dpm-disintegrations per min) in buffer (100 mM
Tris-Cl, pH 7.5) containing either 10 mM CaCl.sub.2 or 2 mM EGTA as
indicated) for three minutes and immediately mixed with an equal volume of
SDS sample buffer (60 mM Tris Cl (pH 6.8) 10% Glycerol, 10% SDS,
Bromphenol Blue) prior to heating at 90.degree. C. for three minutes.
Subsequently, proteins were separated by SDS-PAGE employing 12% acrylamide
gels, the gels were dried under vacuum and polypeptides containing
radiolabel were visualized by fluorography according to the method of
Hazen, S. L. and Gross, R. W. (1991) J. Biol. Chem. 266, 14526-14534. In
this system, unincorporated lipids migrate as mixed micelles with SDS at
the dye front which was eluted off the gel prior to the termination of
electrophoresis.
SDS-PAGE and fluorography demonstrated a predominant band at 30 kDa in
recombinant, but not wild type, E. coli. Exhaustive extraction of
radiolabeled recombinant membranes with butanol did not remove
radioactivity comigrating with the 30 kDa recombinant polypeptide.
Preincubation of recombinant membranes with the thiol-specific reagent
5,5' dithiobisnitrobenzoic acid (DTNB), or the thiol-selective reagent
N-ethylmaleimide ablated incorporation of [.sup.14 C] arachidonic acid in
phosphatidylcholine into the recombinant polypeptide.
To characterize the nature of the association of [.sup.14 C] arachidonic
acid and the recombinant polypeptide, recombinant membranes preincubated
with [.sup.14 C] arachidonoyl phosphatidyl-choline were quenched with SDS
sample buffer prior to subsequent incubation with 1M NH.sub.2 OH, 1N NaOH,
or 6N HCl for 60 min. Exposure to hydroxylamine resulted in the loss of
approximately 70% of [.sup.14 C] arachidonic acid with nearly complete
release of radiolabel manifest after treatment with acid or base.
Collectively, these results demonstrate that [.sup.14 C] arachidonic acid
was covalently bound to recombinant PLA.sub.2 (Ca.sup.-) through a
thioester linkage.
To examine the substrate selectivity of recombinant PLA.sub.2 (Ca.sup.-) ,
membranes derived from transformed E. coli were incubated with either
1-palmitoyl-2-[1-.sup.14 C]-archidonoyl-sn-glycero-3phosphoethanolamine,
1-palmitoyl-2-[1-.sup.14 C]-oleoyl-sn-glycero-3-phosphocholine or
1-palmitoyl-2-[1-.sup.14 C]-arachidonoyl-sn-glycero-3-phosphocholine and
the covalent incorporation of the sn-2 fatty acid into the recombinant
protein was quantified after SDS-PAGE and fluorography. Incorporation of
radiolabeled sn-2 fatty acid was highly selective for arachidonic acid
with only diminutive amounts of radioactivity incorporated utilizing
phosphatidyl-choline containing oleic acid at the sn-2 position.
Phosphatidylethanolamine was the preferred donor of arachidonic acid in
direct comparisons to phosphatidylcholine, a result which paralleled the
observed substrate selectivity of sheep platelet phospholipase A.sub.2
(Zupan, L. A. Kruszka, K. K., and Gross, R. W. (1991) FEBS 284, 27-30).
Furthermore, although calcium ion augmented the incorporation of
arachidonic acid into recombinant protein, it was not an obligatory
cofactor in the formation of the arachidonoyl-enzyme intermediate (i.e.,
the acylenzyme was formed in the presence of EGTA). These results are
comparable to prior experimental findings utilizing sheep platelet
phospholipase A.sub.2 where calcium ion was found to be sufficient, but
not necessary, for activation of this phospholipase A.sub.2, (Zupan, L. A.
Kruszka, K. K., and Gross, R. W. (1991) FEBS 284, 27-30). Calcium ion
bound with high affinity to recombinant protein as ascertained by .sup.45
Ca.sup.2+ blotting of the recombinant polypeptide. Calcium blotting was
performed as described in Maruymura, K. Mikawa, T., and Ebashi, S. (1984)
J. Biochem. 95, 511-519.
In contrast to results obtained with the 30 kDa protein isolated from sheep
platelets, recombinant 30 kDa protein did not release covalently bound
arachidonic acid suggesting that additional cofactors, covalent
modification, formation of appropriate heterodimers or alternative modes
of protein folding are necessary to induce the recombinant protein to
release thioesterified arachidonic acid.
The results presented herein demonstrate a previously unanticipated level
of complexity in both the chemical mechanism underlying the release of
arachidonic acid by intracellular phospholipase A.sub.2 and in the
biologic diversity of the cellular constituents participating in
arachidonic acid mobilization. The isolation of an arachidonoyl-enzyme
intermediate demonstrates the potential of the thioesterified arachidonic
acid to be specifically transferred to putative nucleophilic acceptors
including H.sub.2 O (i.e., phospholipase A.sub.2 activity), lipids (i.e.,
transacylase activity), proteins in oxidative cascades (e.g.,
cyclooxygenase or lipoxygenase) or proteins which facilitate the spatial
translocation of arachidonic acid (i.e., the release of arachidonic acid
to adjacent cells). The advantage that this catalytic strategy affords is
the preservation of the negative free energy present in the ester bond of
cellular phospholipids which allows the specificity inherent in
protein-protein interactions to target individual cellular proteins,
lipids or subcellular domains without an obligatory dependence on the
random diffusion of released arachidonic acid. Insofar as the intermediate
isolated in the present study is stable within mammalian cells (i.e.,
lifetimes >10.sup.-6 s), the potential for this family of phospholipases
A.sub.2 to serve as directors of arachidonic acid trafficking within cells
seems evident.
The activation of intracellular phospholipase A.sub.2 has traditionally
been considered a concerted process initiated by the activation of an
adjacent H.sub.2 O molecule in the active site of the enzyme. The results
of the present study demonstrate that at least one intracellular
phospholipase A.sub.2 activity is mediated by a sequential process which
is fundamentally distinct from the catalytic strategy employed by the
extracellular phospholipase A.sub.2. The genetic diversity present in this
family of proteins and the catalytic strategy which they exploit
underscore the complexity present in the orchestration of arachidonic acid
mobilization during signal transduction in mammalian cells.
ASSAY FOR TESTING COMPOUNDS FOR PLA.sub.2 (Ca.sup.-) INHIBITORY ACTIVITY
This assay measures the transfer of a radiolabeled arachidonic group from
phosphatidylcholine to PLA.sub.2 (Ca.sup.-). The PLA.sub.2 (Ca.sup.-) will
be incubated with phosphatidylcholine radiolabeled with tritium in the
sn-2 arachidonic acid and various concentrations of the test compound in a
diluent. The incubation will be terminated by cold, sodium dodecyl
sulphate, or the addition of excess unlabeled phosphatidylcholine. The
reaction mixture will be incubated with antibody directed against
PLA.sub.2 (Ca.sup.-), and then incubated with Scintillation Proximity
Assay Beads (Amersham, Arlington Heights, Ill.) coupled to either Protein
A or to anti-IgG, which will bind to the anti-PLA.sub.2 (Ca.sup.-)
antibody, in accordancewith the manufacturer's instructions. Antibody to
PLA.sub.2 (Ca.sup.-) can be prepared using standard methods for preparing
polyclonal or monoclonal antibodies.
Scintillation Proximity Assay beads emit light when they are exposed to the
radioactive energy from the tritiated arachidonic acid bound to the beads
through the PLA.sub.2 (Ca.sup.-) -antibody linkage, but the unreacted
radioactive phosphatidylcholine in solution is too far from the bead to
elicit light. The light from the beads will be measured in a liquid
scintillation counter and will be a measure of the arachidonic acid
transferred to the PLA.sub.2 (Ca.sup.-).
Values from assays conducted with test inhibitory compounds will be
compared to assays conducted with test compound diluent alone in order to
ascertain inhibitory potency.
In an alternative assay, the PLA.sub.2 (Ca.sup.-) will be
d with tritiated phosphatidylcholine as above and the mixture will be
treated with anti-PLA.sub.2 (Ca.sup.-) antibody bound to Magnetic Beads
(Advanced Magnetics, Cambridge, Mass., or Amersham, Arlington Heights,
Ill.). The arachidonate-PLA.sub.2 (Ca.sup.-) complex can then be separated
from unreacted phosphatidylcholine by using a magnet to pellet the
magnetic beads. The unreacted phosphatidylcholine would then be washed
away to waste. The radioactivity in the retained beads can then be
measured by conventional liquid scintillation counting.
PURIFICATION OF RECOMBINANT PLA.sub.2 (Ca.sup.-)
If PLA.sub.2 (Ca.sup.-) is expressed in a baculovirus/Spodoptera frugiperda
system (see U.S. Pat. Nos. 4,745,051 and 4,879,236, and Summers and Smith
"Manual of Methods for Baculovirus Vectors and Insect Cell Culture
Procedures", 2nd edition, Texas Agricultural Station Bulletin No. 15555,
Texas Agricultural Experiment Station, College Station, Texas), the
recombinant polypeptide so produced can be purified by the following
method.
The Sf9 cells containing recombinant PLA.sub.2 (Ca.sup.-) are centrifuged
and the cell pellet stored at -80.degree. C. in 50 ml plastic tubes prior
to polypeptide purification. The cell pellets are resuspended in 20 ml of
buffer A (50 mM Tris-Cl, pH 7.0, 1mM EGTA, 10% glycerol) at 4.degree. C.
and the cells broken by homogenization using a 50 ml glass homogenizer
with teflon pestle. The cells are further disrupted by two thirty second
bursts with a probe sonicator (Branson) using a microtip at 35% of maximum
power. All subsequent purification steps are done at 4.degree. C. The
broken cells are centrifuged at 100,000.times.g for 60 min. and the
supernatant is dialyzed against 100 volumes of buffer A for 6 hours or
overnight.
The dialyzed supernatant is then loaded onto a DEAE-cellulose column
(5.0.times.30 cm) previously equilibrated with buffer A. The PLA.sub.2
(Ca.sup.-) activities are eluted with a 4 liter salt gradient (0-450 mM
NaCl) in buffer A at a flow rate of 10 ml/min. The peak of PLA.sub.2
(Ca.sup.-) activity eluting from the column at about 250 mM NaCl is
collected (approximately 300 ml) and dialyzed against 30 volumes of buffer
A at pH 8.0 for 4 hours. The dialysate is then concentrated by loading on
a DEAE-cellulose "wide bore" column (1.6.times.2 cm) preequilibrated in
buffer A at pH 8.0 and eluted with buffer A, pH 7.0 containing 410 mM
NaCl. The concentrated PLA.sub.2 (Ca.sup.-) is dialyzed against two
changes of 10 volumes buffer C (50 mM HEPES, pH 7.4, 10% glycerol) for 4
hours. The dialyzate is loaded onto an HR 10/10 mono Q anion exchange
column and the PLA.sub.2 (Ca.sup.-) activity is eluted using a non-linear
salt gradient (0-350 mM NaCl in buffer C). The peak of PLA.sub.2
(Ca.sup.-) activity eluting from the Mono Q column is dialyzed against two
changes of 100 volumes buffer C for 4 hours. The dialysate is made 1 mM in
CHAPS (3-[(3-cholamidopropyl)-dimethylammonio]-1-propanesulfonate) and
aliquoted into 1 ml plastic tubes before quick freezing in liquid
nitrogen.
__________________________________________________________________________
SEQUENCE LISTING
(1) GENERAL INFORMATION:
(iii) NUMBER OF SEQUENCES: 7
(2) INFORMATION FOR SEQ ID NO:1:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 853 base pairs
(B) TYPE: nucleic acid
(C) STRANDEDNESS: single
(D) TOPOLOGY: linear
(ii) MOLECULE TYPE: cDNA to mRNA
(ix) FEATURE:
( A) NAME/KEY: CDS
(B) LOCATION: 85..822
(xi) SEQUENCE DESCRIPTION: SEQ ID NO:1:
GCCCACTCCCACCGCCAGCTGGAACCCTGGGGACTACGACGTCCCTCAAACCTTGCTTCT60
AGGAGATAAAAAGAACATCCAGTCATGGATAAAAATGAGCTGGTTCAGAAG111
MetAspLysAsnGluLeuValGlnLys
15
GCCAAACTGGCCGAGCAGGCTGAGCGATATGATGACATGGCAGCCTGC159
AlaLysLeuAlaGluGln AlaGluArgTyrAspAspMetAlaAlaCys
10152025
ATGAAGTCTGTAACTGAGCAAGGAGCTGAATTATCCAATGAGGAGAGG207
MetLysSerValTh rGluGlnGlyAlaGluLeuSerAsnGluGluArg
303540
AATCTTCTCTCAGTTGCTTATAAAAATGTTGTAGGAGCCCGTAGGTCA255
AsnLeuLeuSerV alAlaTyrLysAsnValValGlyAlaArgArgSer
455055
TCTTGGAGGGTCGTCTCAAGTATTGAACAAAAGACGGAAGGTGCTGAG303
SerTrpArgValVal SerSerIleGluGlnLysThrGluGlyAlaGlu
606570
AAAAAACAGCAGATGGCTCGAGAATACAGAGAGAAAATTGAGACGGAG351
LysLysGlnGlnMetAlaArg GluTyrArgGluLysIleGluThrGlu
758085
CTAAGAGATATCTGCAATGATGTACTGTCTCTTTTGGAAAAGTTCTTG399
LeuArgAspIleCysAsnAspValLeuSe rLeuLeuGluLysPheLeu
9095100105
ATCCCCAATGCTTCACAAGCAGAGAGCAAAGTCTTCTATTTGAAAATG447
IleProAsnAlaSerGlnAlaGluS erLysValPheTyrLeuLysMet
110115120
AAAGGAGATTACTACCGTTACTTGGCTGAGGTTGCCGCTGGTGATGAC495
LysGlyAspTyrTyrArgTyrLeu AlaGluValAlaAlaGlyAspAsp
125130135
AAGAAAGGGATTGTCGATCAGTCACAACAAGCATACCAAGAAGCTTTT543
LysLysGlyIleValAspGlnSerGln GlnAlaTyrGlnGluAlaPhe
140145150
GAAATCAGCAAAAAGGAAATGCAACCAACACATCCTATCAGACTGGGT591
GluIleSerLysLysGluMetGlnProThrHi sProIleArgLeuGly
155160165
CTGGCCCTTAACTTCTCTGTGTTCTATTATGAGATTCTGAACTCCCCA639
LeuAlaLeuAsnPheSerValPheTyrTyrGluIleLeuA snSerPro
170175180185
GAGAAAGCCTGCTCTCTTGCAAAGACAGCTTTTGATGAAGCCATTGCT687
GluLysAlaCysSerLeuAlaLysThrAlaPheAsp GluAlaIleAla
190195200
GAACTTGATACATTAAGTGAAGAGTCATACAAAGACAGCACGCTAATA735
GluLeuAspThrLeuSerGluGluSerTyrLysAsp SerThrLeuIle
205210215
ATGCAATTACTGAGAGACAACTTGACATTGTGGACATCGGATACCCAA783
MetGlnLeuLeuArgAspAsnLeuThrLeuTrpThrSe rAspThrGln
220225230
GGAGACGAAGCTGAAGCAGGAGAAGGAGGGGAAAATTAACCGGCCT829
GlyAspGluAlaGluAlaGlyGluGlyGlyGluAsn
235 240245
TCCAACTTTTGTCTGCCTCATTCT853
(2) INFORMATION FOR SEQ ID NO:2:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 245 amino acids
(B) TYPE: amino acid
(D) TOPOLOGY: linear
(ii) MOLECULE TYPE: protein
(xi) SEQUENCE DESCRIPTION: SEQ ID NO:2:
MetAspLysAsnGluLeuValGlnLysAlaLysLeuAlaGluGlnAla
151015
GluArgTyrAspAspMetAlaAlaCysMetLysSer ValThrGluGln
202530
GlyAlaGluLeuSerAsnGluGluArgAsnLeuLeuSerValAlaTyr
354045
LysA snValValGlyAlaArgArgSerSerTrpArgValValSerSer
505560
IleGluGlnLysThrGluGlyAlaGluLysLysGlnGlnMetAlaArg
6570 7580
GluTyrArgGluLysIleGluThrGluLeuArgAspIleCysAsnAsp
859095
ValLeuSerLeuLeuGluLysPhe LeuIleProAsnAlaSerGlnAla
100105110
GluSerLysValPheTyrLeuLysMetLysGlyAspTyrTyrArgTyr
115120 125
LeuAlaGluValAlaAlaGlyAspAspLysLysGlyIleValAspGln
130135140
SerGlnGlnAlaTyrGlnGluAlaPheGluIleSerLysLysGluMet
145 150155160
GlnProThrHisProIleArgLeuGlyLeuAlaLeuAsnPheSerVal
165170175
PheTyrTyrGluI leLeuAsnSerProGluLysAlaCysSerLeuAla
180185190
LysThrAlaPheAspGluAlaIleAlaGluLeuAspThrLeuSerGlu
1952 00205
GluSerTyrLysAspSerThrLeuIleMetGlnLeuLeuArgAspAsn
210215220
LeuThrLeuTrpThrSerAspThrGlnGlyAspGluAlaGluAla Gly
225230235240
GluGlyGlyGluAsn
245
(2) INFORMATION FOR SEQ ID NO:3:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 121 base pairs
(B) TYPE: nucleic acid
(C) STRANDEDNESS: single
(D) TOPOLOGY: linear
(ii) MOLECULE TYPE: DNA (genomic)
(xi) SEQUENCE DESCRIPTION: SEQ ID NO:3:
GTCTCAAGTATTGAACAAAAGACGGAAGGTGCTGAGAAAAAACAGCAGATGGCTCGAGAA60
TACAGAGAGAAAATTCAGACAGAGCTAAGAGATATCTGCAATGATGTACTGTCTCTTTGG120
G 121
(2) INFORMATION FOR SEQ ID NO:4:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 162 base pairs
(B) TYPE: nucleic acid
(C) STRANDEDNESS: single
(D) TOPOLOGY: linear
(ii) MOLECULE TYPE: DNA (genomic)
(xi) SEQUENCE DESCRIPTION: SEQ ID NO:4:
TCAAGTA TTGAACAAAAGACGGAAGGTGCTGAGAAAAAACAGCAGATGGCTCGAGAACAC60
AGAGAGAAAATTGAGACGGAGCTAAGAGATATCTGTAATGATGTATTGTCTCTTTTGGAA120
AAGTTCTTGATCCCCAATGCTTCACAAGCAGAGAGCAAAGTC 162
(2) INFORMATION FOR SEQ ID NO:5:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 43 base pairs
(B) TYPE: nucleic acid
(C) STRANDEDNESS: single
(D) TOPOLOGY: linear
(xi) SEQUENCE DESCRIPTION: SEQ ID NO:5:
TTCTGAATTCAGGAAACAGACCATGGATAAAAATGAGCTGGTT 43
(2) INFORMATION FOR SEQ ID NO:6:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 45 base pairs
(B) TYPE: nucleic acid
(C) STRANDEDNESS: single
(D) TOPOLOGY: linear
(xi) SEQUENCE DESCRIPTION: SEQ ID NO:6:
AAGAGAATTCAGCTGGAAGCAGGTTTAATTTTCCCCTCCTTCTCC45
(2) INFORMATION FOR SEQ ID NO:7:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 17 base pairs
(B) TYPE: nucleic acid
(C) STRANDEDNESS: single
(D) TOPOLOGY: linear
(xi) SEQUENCE DESCRIPTION: SEQ ID NO:7:
CAAAGTCTTCTATTGAA17
Top